SEARCH

SEARCH BY CITATION

Keywords:

  • neural crest;
  • induction;
  • Wnt6;
  • non-canonical;
  • chick embryo;
  • Wnt1

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

The neural crest is a multipotent embryonic cell population that arises from neural ectoderm and forms derivatives essential for vertebrate function. Neural crest induction requires an ectodermal signal, thought to be a Wnt ligand, but the identity of the Wnt that performs this function in amniotes is unknown. Here, we demonstrate that Wnt6, derived from the ectoderm, is necessary for chick neural crest induction. Crucially, we also show that Wnt6 acts through the non-canonical pathway and not the beta-catenin–dependant pathway. Surprisingly, we found that canonical Wnt signaling inhibited neural crest production in the chick embryo. In light of studies in anamniotes demonstrating that canonical Wnt signaling induces neural crest, these results indicate a significant and novel change in the mechanism of neural crest induction during vertebrate evolution. These data also highlight a key role for noncanonical Wnt signaling in cell type specification from a stem population during development. Developmental Dynamics 236:2502–2511, 2007. © 2007 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Neural crest cells are a population of multipotent progenitors that arise at the border between the developing neural plate and ectoderm in all vertebrates during embryogenesis. After induction, neural crest undergoes an epithelial–mesenchymal transition and delaminates from the neural folds. Subsequent migration into the periphery allows these cells to form a multitude of tissues that are of such importance that neural crest is sometimes referred to as the fourth germ layer.

The induction of neural crest from the neural tube requires signaling from adjacent tissues. It is widely acknowledged that an ectodermally derived signal plays a pivotal role in the induction of neural crest (Dickinson et al.,1995; Liem et al.,1995; Selleck and Bronner-Fraser,1995,2000), although both paraxial mesoderm and the epiblast can induce some neural crest populations (Selleck and Bronner-Fraser,1995; Bonstein et al.,1998; Marchant et al.,1998; Monsoro-Burq et al.,2003; Basch et al.,2006). Members of the Wnt family of signaling molecules have been implicated in neural crest induction as they are expressed in the ectoderm overlying the neural tube. In anamniotes, canonical Wnt signaling has been shown to induce neural crest (Saint-Jeannet et al.,1997), and in amniotes, Wnt6 has been proposed as a candidate for the neural crest inducer based on its spatiotemporal pattern of expression in the ectoderm (Garcia-Castro et al.,2002). An elegant study has demonstrated that Wg, an invertebrate member of the Wnt family, can induce neural crest in the chick (Garcia-Castro et al.,2002) but it has not been directly demonstrated that any specific vertebrate Wnt, including Wnt6, can perform this role in the amniote embryo in vivo.

We have addressed the roles of Wnts in neural crest induction by examining the inductive properties of Wnt1, 3a, 4, 6, and 11 in the chick embryo. We found that Wnt6 was the only family member examined capable of fulfilling this role in vivo and in vitro. We also demonstrate that in this context, Wnt6 acts through the non-canonical signaling pathway. Importantly, reducing the levels of Wnt6 using siRNA caused a marked decrease in neural crest production, demonstrating that Wnt6 is necessary for neural crest induction. Surprisingly, we found that Wnt1, another candidate for the “inducer” that functions through the canonical pathway, actually inhibited neural crest induction in the chick embryo. In support of these findings, we demonstrate that inhibition of the canonical Wnt pathway promoted the induction of neural crest while activation of the canonical pathway inhibited the genesis of neural crest. These data show that Wnt6 plays a pivotal role in the early development of neural crest and implicates the non-canonical pathway in the specification of a cell type from a stem population.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Wnt6 Induces Neural Crest Production and Wnt1 Inhibits Neural Crest Induction

The ability of Wnt1, 3a, 4, 6, and 11 to induce neural crest in the chick embryo was examined by implanting Wnt-expressing cells into the open caudal neural plate at HH10–HH12. At this axial level, markers of neural crest development such as Slug, Sox10, FoxD3, and RhoB are not expressed in the dorsal neural folds (Cheung and Briscoe,2003; Liu and Jessell,1998). We monitored the expression of the neural crest markers Slug, RhoB, Sox10, FoxD3, and HNK-1 for 8 to 12 hr after implantation. Using this assay, we found that cells expressing Wnt3a, 4, or 11 had no effect on the induction of neural crest (data not shown). In contrast, Wnt6-expressing cells induced ectopic expression of early neural crest markers (Fig. 1B,D,F). These markers were ectopically expressed in caudal regions of the embryo adjacent to the implanted cells. In addition, we found that Wnt1-expressing cells (Fig. 1H) and LacZ control cells (Fig. 1A,C,E,G) did not induce the expression of neural crest markers. The effect of Wnt6 and Wnt1 on neural crest induction was quantified in vitro, by plating identical portions of neural tube, from the level of segmental plate, onto Wnt-expressing cells and counting the number of cells expressing the neural crest marker HNK-1 in eight individual cultures for each cell type after 20–24 hr. In Wnt6 cultures, an average of 230 ± 9 cells were produced in each culture, compared with 37 ± 1.2 in each LacZ control culture—equating to a sevenfold increase in neural crest cell production (Fig. 1I). Surprisingly, culture of neural tubes on Wnt1-expressing cells resulted in a complete inhibition of crest induction compared with the LacZ controls, with no HNK-1–positive cells in any of the experiments (Fig. 1I). This latter result was confirmed in vivo by analyzing Sox10 expression in embryos up to 40 hr after implantation of Wnt1-expressing cells. There was a significant reduction in the amount of neural crest generated in the region where cells were implanted (Fig. 1J,K). These results are significant because, first, they highlight a novel role for Wnt6 as a neural crest inducer protein, and second, we show that Wnt1, a previous candidate for the neural crest inducer, actually inhibits the production of these cells.

thumbnail image

Figure 1. Neural crest induction after implantation of Wnt6- and Wnt1-expressing cells. A–K: Expression of neural crest markers, assayed by in situ hybridization 8–12 hr after implantation of cells (A–I) and 40 hr after implantation of cells (J,K). A:Slug expression in the control dorsal neural tube (black arrow) extends to the level of the last formed somite (indicated by white arrowhead). B: Wnt6-induced higher levels (black arrow) and ectopic (black arrowheads) expression of Slug caudal to the last somite (white arrowhead). C:RhoB expression is absent in the caudal neural tube (arrowhead) but present in the tail bud. D: Wnt6 increased RhoB expression in the caudal neural tube (arrowheads). E:Sox10 is expressed in rostral migrating neural crest in control embryos. White arrowhead indicates the caudal limit of migration. F: Wnt6-induced ectopic Sox10 expression caudally compared with control (black arrowheads). White arrowhead is equivalent somite level as in E. G,H: Wnt1 does not induce neural crest. Arrowheads indicate equivalent level in neural tube. n = 20/20 for all markers. Original magnification, ×8 in all. I: In vitro analysis of neural crest induction by Wnt1 and Wnt6. Wnt6 induced a sevenfold increase in numbers of neural crest cells compared with control. Wnt1 produced an inhibition of neural crest production compared with controls. Analysis by two tailed t-test indicates both Wnt6 and Wnt1 are highly significantly different from the controls at the 0.0001% level (indicated by ***). J,K: Analysis of Sox10 expression in embryos 40 hr after implantation of Wnt1-expressing cells confirms that Wnt1 inhibits neural crest production (black arrows). N = 7/7.

Download figure to PowerPoint

Wnt6 Induces Neural Crest Production Through the Noncanonical Signalling Pathway

We subsequently examined the intracellular signaling cascade utilized by Wnt6 during neural crest induction as previous studies have provided evidence that it can signal through both the canonical and noncanonical pathway (Itaranta et al.,2002; Buttitta et al.,2003). First, we examined whether Wnt6 acts through the canonical pathway by examining the localization of activated beta-catenin, as its nuclear localization is predictive of activation of the canonical pathway. In Wnt6 implanted embryos, nuclear localization of activated beta-catenin was not found in the dorsal neural tube cells (Fig. 2B,C), suggesting that the canonical pathway was not active. In contrast, activated beta-catenin was found in the nuclei of dorsal neural tube cells in Wnt1 implanted embryos (Fig. 2D,E), suggesting that the canonical pathway was active in these cells. The nuclei of these cells appeared condensed, suggesting they are undergoing apoptosis. However, when the dorsal neural tube of Wnt6- and Wnt1-implanted embryos was examined using terminal deoxynucleotidyl transferase–mediated deoxyuridinetriphosphate nick end-labeling (TUNEL) labeling, there was no difference in the pattern of apoptosis seen in either treatment (Fig. 2F,G), with very few apoptotic cells in either case. To determine whether the non-canonical signaling pathway was activated by Wnt6, we examined the expression of two down stream components of this pathway: RhoA (Kim and Han,2005) and Jun N-terminal kinase (JNK; Li et al.,1999). RhoA and activated (phosphorylated) JNK expression was found in dorsal neural tube cells when Wnt6 cells had been implanted (Fig. 2I,K) indicating that the non-canonical pathway was active. In contrast, implantation of control cells (Fig. 2H) or Wnt1 cells (Fig. 2J) did not result in the expression of either molecule in cells of the dorsal neural tube. This finding is a clear indication that Wnt6 and Wnt1 are working through separate pathways, resulting in opposing effects on neural crest induction in the amniote.

thumbnail image

Figure 2. Wnt6 signals through the noncanonical pathway in neural crest induction. Embryos HH16–HH18. A: Control section labeled with activated beta-catenin antibody (green) and 4′,6-diamidine-2-phenylidole-dihydrochloride (DAPI, blue). Box indicates area shown at higher magnification in B–E. B,C: Wnt6 cells did not induce activated beta-catenin translocation to the nucleus in dorsal neural tube cells. D,E: Wnt1-induced translocation of beta-catenin to the nucleus in many dorsal neural tube cells. Arrowheads indicate numerous labeled nuclei. F,G: Wnt6-implanted (F) and Wnt1-implanted (G) embryos did not show differing levels of terminal deoxynucleotidyl transferase–mediated deoxyuridinetriphosphate nick end-labeling (TUNEL) labeling. H: Control embryo demonstrates RhoA is expressed ventrally (arrow). I: Local induction of RhoA in the dorsal neural tube by Wnt6 (arrowheads). J: In Wnt1-implanted embryos, there is no pJNK labelling. K: Wnt6-induced cells in the neural tube are pJNK-positive (arrowheads). N = 7/ 7 for each experiment. Original magnification, ×10 in A, ×40 in B–E, ×64 in F,G, ×20 in H–K.

Download figure to PowerPoint

It has previously been suggested that nuclear localization of activated beta-catenin can be seen in the dorsal neural tube during neural crest induction (i.e., in the open neural plate) at stage 10 (Garcia-Castro et al.,2002). We examined un-operated embryos between stages 9 and 12 for activated beta-catenin localization along the whole anteroposterior axis of the neural tube (see Supplementary Figure S1A–E, which can be viewed at http://www.interscience.wiley.com/jpages/1058-8388/suppmat) but were only able to identify nuclear staining in the most cranial regions (Supplementary Figure S1E).

Activation of the Non-canonical Pathway Through Dishevelled Induces Neural Crest

To prove that the non-canonical pathway induces neural crest and that the canonical cascade inhibits this process, we specifically inhibited each pathway with dishevelled deletion mutant constructs. Dishevelled is a component of both the canonical and non-canonical signaling pathway and activation of each pathway is controlled by specific domains in the dishevelled protein—the non-canonical pathway requiring the DEP domain, whereas the canonical pathway requires the DIX domain (Axelrod et al.,1998; Li et al.,1999). Deletion of these specific domains blocks signaling through each specific pathway (Krylova et al.,2000; Rosso et al.,2005). These inhibiting constructs were individually electroporated into one side of the chick caudal open neural plate between Hamburger and Hamilton stage (HH) 10 and HH12. Effects on neural crest were assayed by analysis of Slug and Sox10 expression. Electroporation of Delta DIX-Dvl construct, which prevents canonical signaling allowing the non-canonical pathway to predominate, resulted in an increased number of premigratory Slug-positive cells in the caudal neural tube at stage 15 (Fig. 3A). Sections demonstrate that, while crest is induced, it does not migrate prematurely (Fig. 3B). In addition, migratory Sox10-positive cells at the dorsal edge of the neural tube and in the periphery were also increased at stage 19, compared with the contralateral control (Fig. 3C,D), similar to implantation of Wnt6 cells (Fig. 1B,F). The Delta DEP-Dvl construct, which prevents signaling through the non-canonical pathway, allowing the canonical pathway to predominate, resulted in a significant reduction in neural crest production (Fig. 3E,F) and mirrored the effect of Wnt1 overexpression (Fig. 1H–K).

thumbnail image

Figure 3. Inhibition of the non-canonical or canonical pathway during neural crest induction. Unilateral electroporation of half of the neural tube was assayed by either Slug expression at Hamburger and Hamilton stage (HH) st14/15 or Sox10 expression at HH18/19. Red arrows indicate the region of the neural tube electroporated. A,B: Inhibition of the canonical pathway by delta DIX-Dvl increased numbers of Slug-expressing neural crest cells in the dorsal neural tube (black arrowheads). C,D: Inhibition of the canonical pathway by delta DIX-Dvl increased numbers of Sox10-expressing neural crest cells in the dorsal neural tube and periphery (black arrowheads). E,F: Inhibition of the non-canonical pathway by delta DEP-Dvl inhibited neural crest production in the dorsal neural tube (arrowheads) and a subsequent absence of crest in the periphery. G,H: Overexpression of beta-catenin reduced Sox10 expression in the electroporated side (arrowheads) compared with the contralateral (control) side. I,J: Inhibition of the canonical pathway with dn-TCF increases Slug expression in the neural tube (arrowhead). K,L: Inhibition of the canonical pathway with dn-TCF increases Sox10 expression in the neural tube (arrowheads), resulting in the loss of the normal segmented pattern seen on the control side (arrows). M,N: Inhibition of the canonical pathway with nkd increased the normal expression of Sox10 (red arrows), and also-induced ectopic Sox10 expression in caudal neural tube (arrowheads). N = 7/7 for all experiments. Original magnification, ×10 in A,C,E,G,I,K,M, ×20 in B,D,F,H,J,L,N.

Download figure to PowerPoint

Canonical Wnt Pathway Inhibits Neural Crest Induction

Our results suggest that the non-canonical and canonical pathways may act antagonistically in the context of neural crest induction. To test this hypothesis, we either amplified or attenuated canonical signaling and examined the outcome of such action on neural crest production. Activation of the canonical pathway by overexpression of a constitutively active beta-catenin construct (Baker et al.,1999) in the neural tube resulted in a reduction in neural crest formation (Fig. 3G,H). We performed the complementary experiment in which we inhibited Wnt1 activity at two different points in the signaling pathway. Overexpressing a dominant negative form of TCF-4 (Tetsu and McCormick,1999) resulted in both increased and ectopic induction of neural crest (Fig. 3I–L) as shown with both Slug and Sox10 expression. Second, overexpression of Naked cuticle (nkd), an inhibitor of canonical Wnts (Rousset et al.,2001), resulted in a similar but stronger phenotype, with increased and ectopic neural crest production in the electroporated side (Fig. 3M,N).

Specific Inhibition of Wnt6 Reduces Neural Crest Production

These experiments indicate that Wnt6 can induce neural crest; however, they do not definitively prove that Wnt6 is required for this function in the embryo. To demonstrate that Wnt6 is necessary for neural crest induction, we developed two replication-competent retroviral vector (RCAS) siRNA constructs (T1 and T2) to reduce endogenous levels of Wnt6 protein. siRNA containing RCAS viral particles were injected onto the ectoderm adjacent to the developing neural tube at HH7–HH11 and embryos were allowed to develop for 2–3 days. Viral spread was mainly restricted to the ectoderm, with a small amount in the underlying tissue (assessed by GAG labeling, Fig. 4 Bi). These reagents caused a considerable decrease in the level of Wnt6 protein in the ectoderm adjacent to and overlying the dorsal neural tube, (compare Fig. 4A and insert panel with Fig. 4B and insert panel Bii), comparable to levels achieved previously (Das et al.,2006). The reduction in ectodermal Wnt6 corresponds to the site of siRNA viral construct infection (Fig. 4 Bi and ii). Construct T2 had greater efficacy than T1 and was selected for use in further studies. Analysis of neural crest markers FoxD3 and HNK-1 showed a marked reduction in neural crest at the dorsal edge of the neural tube and migrating into the periphery (Fig. 4B,D,F; N = 4/5) compared with controls (Fig. 4A,C,E). These results indicate that neural crest induction has been inhibited. At later stages (HH22), there were fewer neural crest cells in the adjacent somites, indicated by Sox10 expression (data not shown). Wnt1 and Wnt3a expression were not affected (data not shown), indicating the specificity of the siRNA construct. Thus, specific inhibition of Wnt6 expression demonstrates that it is required for neural crest induction in the chick embryo.

thumbnail image

Figure 4. Wnt6 SiRNA inhibits neural crest induction. All embryos Hamburger and Hamilton stage (HH) 18. A: Wnt6 protein expression in control embryos. Wnt6 is strongly expressed in the ectoderm (black arrowheads). Insert panel shows region labeled with the asterisk at higher magnification. FoxD3 is expressed in the dorsal neural tube. B: Wnt6 expression in Wnt6 siRNA-treated embryos. Wnt6 levels are much reduced (arrowhead). i: Insert panel shows GAG labeling, which demonstrates the extent of viral spread, mainly in the ectoderm with some in underlying tissue. ii: Insert panel shows region labeled with the asterisk in the main image. FoxD3 expression is absent in the dorsal neural tube and Wnt6 levels in the ectoderm are much reduced. C:FoxD3 expression in neural crest. Lines indicate the level of sections displayed in the adjacent panels. FoxD3 is expressed in neural crest in the dorsal neural tube and in the periphery. D:FoxD3 expression in embryo treated with Wnt6 siRNA. Again, lines indicate levels of adjacent sections. Expression of FoxD3 is significantly reduced in regions of the neural tube (arrowhead and panel 2, 3) and in the periphery. E: HNK-1 and FoxD3 expression in control embryo. Arrowhead indicates migrating crest. F: HNK-1 and FoxD3 expression in Wnt6 siRNA-treated embryo. FoxD3 expression is significantly reduced in the neural tube (white arrowhead). N = 4/5. Original magnification, ×20 in A,B,E,F, ×10 in C,D.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

New Role for the Non-canonical Pathway in Neural Crest Induction

Wnt proteins have been implicated as the inducers of neural crest in vertebrates. Wnt6 is the only Wnt known to be expressed in the ectoderm at the precise time of neural crest induction in the chick embryo. However, it has not been demonstrated that a vertebrate Wnt can induce crest in the amniote embryo in vivo. We show for the first time, both in vivo and in vitro, that Wnt6 can fulfill this role in the chick embryo. Importantly, we demonstrate that other Wnts, both canonical and non-canonical, do not perform this role and thus this is not a general property of Wnt molecules. Critically, by specifically inhibiting Wnt6 with siRNA, we demonstrate that Wnt6 is not only able to induce neural crest but also that it is required for induction in the chick embryo.

Intriguingly, the absence of nuclear activated beta-catenin in Wnt6-induced neural crest cells suggests that Wnt6 is not acting by means of the canonical pathway. This hypothesis is further supported through several lines of experimental evidence that we present here: (1) Expression of an inhibitory Dishevelled construct that specifically blocks the canonical signaling pathway but leaves the noncanonical pathway active (delta DIX-Dvl, Krylova et al.,2000; Rosso et al.,2005), resulted in increased neural crest cell production. (2) Key components of the non-canonical pathway—RhoA (Kim and Han,2005) and activated Jun kinase (Li et al.,1999) are ectopically expressed in the dorsal neural tube in Wnt6-implanted embryos. These experiments all indicate that Wnt6 acts non-canonically. This is an unexpected finding, given that previous studies in anamniotes such as Xenopus and zebrafish indicated that, although neural crest migration is controlled by non-canonical signaling (De Calisto et al.,2005), the induction of neural crest is controlled by canonical Wnt signaling (Saint-Jeannet et al.,1997; LaBonne and Bronner-Fraser,1998; Lewis et al.,2004; Abu-Elmagd et al.,2006).These anamniote studies were conducted at earlier stages in development than ours, partly reflecting the earlier production of neural crest in these species, and mainly analyzed anterior trunk crest populations. Although it is unlikely that the requirement for canonical signaling is radically changed in more posterior trunk populations of anamniotes, this has yet to be determined.

The apparent discrepancy in the pathways utilized to induce neural crest in amniotes and anamniotes may reflect changes in the specific Wnts and Wnt signaling pathways used to induce and segregate crest during the evolution of the amniote lineage. In support of our findings, key components of the non-canonical signaling pathway are found to be transiently expressed in the amniote dorsal neural tube around the time of neural crest induction, including RhoA (Liu and Jessell,1998) and Flamingo/Celsr (Formstone and Mason,2005). Equally, in amniote embryos, canonical Wnts (Wnt1 and 3a) are expressed too late to be inducers of neural crest (Dickinson et al.,1995). However, the presence of nuclear beta-catenin has been reported in the open neural plate of the stage 10 chick embryo (Garcia-Castro et al.,2002) which would suggest that canonical signaling occurs at the time of crest induction. In our study, we were only able to localize nuclear beta-catenin in more cranial regions and not in the open or fusing neural plate between stages 9 and 12. A possible explanation for this discrepancy is that different antibodies were used in the two analyses. Garcia-Castro et al. used the 5H10 antibody, which detects pan beta-catenin labeling, in both the cytoplasm and the nucleus. In contrast, we have used an antibody that detects only dephosphorylated beta-catenin, which is the activated form of the molecule and, therefore, more likely to be involved in signaling. We find many fewer nuclei are labeled using this antibody and none in the caudal neural tube or plate.

In the same study, it was shown that Drosophila Wg can induce chick neural crest in vitro (Garcia-Castro et al.,2002), which would appear to contradict our results. However, the full spectrum of Wg activity in the amniote is unknown, and it may be able to activate the amniote non-canonical signaling pathway. Crucially, experiments using Wg to induce neural crest did not examine downstream components to definitively prove which pathway was active.

The exact mechanism by which Wnt6 induces crest from the neuroepithelium remains obscure. We find little difference in cell proliferation rates in the neural tube of Wnt6- and Wnt1-implanted embryos compared with controls (not shown); therefore, Wnt6 does not simply increase cell number. The main described function of the non-canonical Wnt signaling pathway is to establish cell polarity and has also been implicated in controlling the orientation of cell division during zebrafish gastrulation (Gong et al.,2004). Changes in the plane of cell polarity during cell division are involved in inducing multiple cell types from a single neuroepithelia, such as the retina, and this may lead to cell fate specification (Cayouette and Raff,2003). Neural tube cells predominantly orient their mitotic spindles along the anteroposterior axis; however, delaminating neural crest cells orientate their cell division at 90 degrees to this (Le Douarin and Kalcheim,1999) suggesting that neural crest cell induction involves changes in cell polarity. Therefore, it is possible that Wnt6 and the non-canonical pathway change the polarity of cell division in dorsal neural tube cells during crest induction. Induction of neural crest through an alteration in cell polarity may explain an apparent discrepancy between our results and those of Burstyn-Cohen et al (Burstyn-Cohen et al.,2004), where inhibition of the non-canonical signaling pathway did not reduce proliferation at the dorsal edge of the neural tube, prompting the authors to suggest that the non-canonical pathway did not have a role in neural crest induction.

Canonical Pathway Inhibits Neural Crest Induction

A final unexpected finding of our work was that Wnt1 and activation of the canonical pathway inhibited neural crest formation and that removal of non-canonical signaling using a delta DEP-Dvl construct, leaving only the canonical active, also resulted in a reduction in neural crest formation. A similar DEP domain deletion construct in Xenopus dishevelled (dd2; Sokol,1996) has been proposed to inhibit signaling through both the canonical and non-canonical pathways (see De Calisto et al.,2005). Although there is no evidence that the constructs we have used also do this, the resulting phenotype would be identical to the one that we obtained—a significant inhibition in neural crest production, as the neural tube would lack the inducing signal. However, we have also inhibited the function of the canonical pathway, with either dn-TCF-4, nkd, or delta DIX-Dvl, all resulting in an increase in neural crest production. Although these constructs affect different parts of the signaling pathway, they all indicate that canonical signaling inhibits neural crest production in the chick embryo.

Whereas previous experiments in Xenopus (anamniote) embryos indicate that overexpressing Wnt1 resulted in neural crest formation (Saint-Jeannet et al.,1997), our results show that this is not the case in the chick. However, it has previously been shown that dn-Wnt1–expressing cells inhibit Slug expression when implanted in the closing neural plate of the chick embryo (Garcia-Castro et al.,2002). This construct has broad Wnt-inhibiting ability (Hoppler et al.,1996), so it is possible that this construct may also be able to inhibit Wnt6 activity, which would result in loss of Slug expression. The activity of this inhibitor requires further investigation.

The activity of Wnt1 and canonical signaling during neural crest induction has not been studied in great detail in other amniotes; however, specific overexpression of beta-catenin in the neural crest in mouse embryos resulted in an overall decrease in the amount of neural crest produced, with the remaining neural crest mainly segregating into the sensory neuron lineage (Lee et al.,2004). This finding suggests that, in mice, similar to chick, canonical Wnt signaling can inhibit neural crest induction, suggesting that this is an amniote characteristic. Wnt1 is expressed too late to induce neural crest in amniote embryos, being expressed a few hours after the appearance of neural crest markers (Dickinson et al.,1995; Garcia-Castro et al.,2002). Moreover, neural crest is induced in the absence of either Wnt1 or 3a (Dickinson et al.,1995; Ikeya et al.,1997), but later expansion of the neural crest population is affected. Equally, mouse knockouts of beta-catenin (Brault et al.,2001; Hari et al.,2002) do not have altered neural crest induction but have altered differentiation and specification of neural crest derived lineages, suggesting that Wnt1 and the canonical pathway are not responsible for neural crest induction. A comprehensive analysis of the role of Wnt1 in chick neural crest delamination used similar constructs to those used in this study but examined later stages and more anterior crest populations (rostral segmental plate and somite level) to temporally and spatially separate induction and delamination of neural crest (Burstyn-Cohen et al.,2004). This study demonstrated a significant role for Wnt1 and the canonical pathway in the delamination process and also showed that canonical signaling did not affect expression of FoxD3, Sox9, or Slug at these later stages. This finding suggests a very dynamic role for Wnt1 in chick neural crest development. When neural crest induction commences, it is not immediately expressed, but as it switches on in the caudal neural tube, it initially acts as an inhibitor of neural crest production before rapidly changing its role to promote delamination at more anterior levels of the neural tube. It is also interesting to note in Xenopus (an anamniote), neural crest delamination is controlled by the non-canonical signaling pathway (De Calisto et al.,2005), suggesting that the downstream signaling pathway controlling delamination in anamniotes and amniotes has also swapped between the canonical and non-canonical pathways.

One interesting finding from our studies was that it appears that Wnt1 and Wnt6 both act in concert during neural crest production to mutually repress each other. Inhibition of the canonical pathway with the delta DIX-Dvl construct resulted in a phenotype identical to overexpression of non-canonical Wnt6, namely induction of crest. Conversely, inhibition of the non-canonical pathway, with both inhibiting dishevelled construct delta DEP-Dvl and Wnt6 siRNA resulted in a phenotype identical to overexpression of the canonical pathway—namely inhibition of neural crest production. This mutual repression may act as a system to “balance” neural crest production. Mutual repression by a canonical and a non-canonical Wnt is an emerging theme; for example, during axis formation, where noncanonical Wnt5 is expressed ventrally and canonical Wnt8 dorsally, removal of Wnt5 increases canonical signaling and dorsalizes the embryo (Westfall et al.,2003), although the exact mechanism by which this repression occurs is not clear. Thus, mutual Wnt repression may be a common mechanism used throughout the embryo to regulate cell induction, cell differentiation, and cell migration.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Embryos

Fertilized eggs, from Henry Stewart and Co. (UK) were incubated at 38°C to HH10–HH12 (Hamburger and Hamilton,1951).

Culture of Wnt-Expressing Cells

Wnt1-, 3a-, 4-, 6-, and 11-expressing murine NIH 3T3 cells were produced as described in Itaranta et al. (2002). Control cells were transfected with empty LacZ vector. Transfected cells were selected in G418 and grown until confluent.

Implantation of Cells Into the Chick Neural Tube

Implantation of cells into embryos has previously been described (Schmidt et al.,2004). Briefly, cells were injected into the open neural tube at the level of the caudal segmental plate at HH10–HH12, using micropipettes. Injections occasionally affected the closure of the neural tube. However, there were no differences in results obtained from embryos that had closed neural tubes compared with those that had not.

Neural Crest Cell Culture

Neural crest was cultured as previously described (McGonnell and Graham,2002), except that neural tubes from the level of the segmental plate were placed onto confluent layers of Wnt-expressing cells or control cells, and the neural crest allowed to migrate out from the explant for 20–24 hr. They were subsequently labeled with HNK-1 antibody (1:100) followed by goat anti-mouse AP secondary (Dako) 1:200 dilution and developed using nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate mix (NBT/BCIP; Roche). The numbers of cells in eight separate cultures were counted double blind and analyzed statistically and plotted graphically in Graphpad Prism software.

In Situ Hybridization

In situ hybridization was performed as previously described (Nieto et al.,1996). The following probes were used in this study: Sox10, FoxD3, RhoA, RhoB (all from A. Graham), and Slug (from A. Nieto). During the process of in situ hybridization, the implanted Wnt-expressing or control cells dispersed and are, therefore, not visible in either whole or sectioned embryos.

Immunohistochemistry

Sections were incubated with dephosphorylated (active) beta-catenin (clone 8E7, Upstate) primary antibody (1:50) followed by Alexa 488 secondary antibody and counterstained with 4′,6-diamidine-2-phenylidole-dihydrochloride (DAPI). Sections were examined on a Leica SP2 RS AOBS confocal microscope. Incubation with antibodies against phosphorylated Jun Kinase (pJNK; Santa Cruz) 1:200, or Wnt6 (Zymed) 1:50 was followed by ABC secondary-horseradish peroxidase antibody labeling (Vectastain) and development with diaminobenzidine. Sections were photographed on a Leica DMRA2 microscope using IM500 image software. TUNEL labeling was performed with the Dead End Colourimetric TUNEL labeling kit (Promega) according to manufacturer's instructions.

Electroporation of Expression Constructs Into the Neural Tube

Electroporation of the neural tube was performed as described in Nakamura and Funahashi (2001). All embryos were electroporated into one side of the neural tube at the level of the caudal segmental plate at HH10–HH12. Constructs containing Delta DIX-Dvl, an inhibitor of canonical Wnt signaling and Delta DEP-Dvl, an inhibitor of noncanonical signaling, are described in (Krylova et al.,2000; Rosso et al.,2005). Dominant-negative TCF-4 construct is described in Tetsu and McCormick (1999). Constitutively active beta-catenin construct is described in (Baker et al.,1999). Full-length chick Naked cuticle (Nkd) gene was cloned into RCAS (Schmidt et al.,2006).

Wnt6 siRNA RCAS Construct

Wnt6 target sequences were selected using Sfold (http://sfold.wadsworth.org/sirna.pl) and Genscript (http://www.genscript.com/ssl-bn/app/rnai), based upon stability (ΔE). Two target sequences, T1 (ΔE 12.3) and T2 (ΔE 11.94), were selected and forward and reverse primers designed for each: T1 = acgacgtgcagtttggctatga, T2 = cactcattgatctgcacaacaa. These primers were used, along with flanking primers to generate the siRNA construct, which was cloned into the pRFPNAiC vector containing the chick U6 promoter. This was directionally subcloned into a modified RCAS vector (see Das et al.,2006, for more details). DF-1 cells were infected with the construct and supernatant harvested after 7 days. The supernatant was concentrated to give a minimum titer of 108 pfu/ml and injected onto the surface of the right side of the developing embryo at HH 7–HH11, from the level of somites II–III to the caudal tail bud. Embryos were allowed to develop for either 2 or 3 days. Control embryos were infected with empty vector.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Thanks to Prof. Seppo Vanio for Wnt6 cells; Prof. Andreas Kispert for Wnt1, 3a, 4, and 11 cells; Prof. Richard Harland for beta-catenin construct; Prof. F. McCormick for dn-TCF4 construct; Prof. P. Salinas for inhibiting dishevelled constructs; and Dr. S. Wilson for pRFPNAiC siRNA vector. We thank Anthony Graham, Marty Cohn, Caroline Formstone and Ian McKinnell for critical reading of the manuscript. C.S. was funded by the Deutsche Forschungsgemeinschaft, I.M.M. was funded by The Royal Society and S.A., A.O., and K.P. were funded by the BBSRC.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

The Supplementary Material referred to in this article can be found at http://www.interscience.wiley.com/jpages/1058-8388/suppmat

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.