The commonly used marker ELAV is transiently expressed in neuroblasts and glial cells in the Drosophila embryonic CNS



Glial cells in the Drosophila embryonic nervous system can be monitored with the marker Reversed-polarity (Repo), whereas neurons lack Repo and express the RNA-binding protein ELAV (Embryonic Lethal, Abnormal Vision). Since the first description of the ELAV protein distribution in 1991 (Robinow and White), it is believed that ELAV is an exclusive neuronal and postmitotic marker. Looking at ELAV expression, we unexpectedly observed that, in addition to neurons, ELAV is transiently expressed in embryonic glial cells. Furthermore, it is transiently present in the proliferating longitudinal glioblast, and it is transcribed in embryonic neuroblasts. Likewise, elav-Gal4 lines, which are generally used as postmitotic neuronal driver lines, show expression in neural progenitor cells and nearly all embryonic glial cells. Thus, in the embryo, elav can no longer be considered an exclusive marker or driver for postmitotic neurons. elav loss-of-function mutants show no obvious effects on the number and pattern of embryonic glia. Developmental Dynamics 236:3562–3568, 2007. © 2007 Wiley-Liss, Inc.


The Drosophila embryonic central nervous system comprises approximately 30 glial cells and 300 neurons per truncal hemineuromere. These cells are generated by neural progenitor cells called neuroblasts (NBs). Most of the NBs divide in a stem cell mode to generate ganglion mother cells (GMCs), which have the potential to divide one more time thereby producing two neurons and/or glial cells (reviewed in, e.g., Bhat,1999; Skeath,1999; Technau et al.,2006). In the embryonic nervous system, the differentiation towards a glial cell fate is dependent on the expression of the key regulatory gene glial cells missing (gcm). Loss of gcm function results in a nearly complete loss of lateral glial cells, whereas ectopic expression transforms presumptive neurons towards a glial cell fate (Hosoya et al.,1995; Jones et al.,1995; Bernardoni et al.,1999). One factor acting downstream of gcm during glial differentiation is Reversed polarity (Repo). Repo is expressed in all lateral glial cells in the embryonic CNS (Xiong et al.,1994; Halter et al.,1995). Thus, gcm and repo are useful marker genes to identify glial precursors and their differentiating progeny cells. Differentiating cells that do not express either of these markers are, therefore, neuronal. Nevertheless, having positive markers that allow the identification of cells acquiring a neuronal fate would be of importance. A lot of markers that specifically label subtypes of neurons are already available. For example, Even-skipped can be used to label particular neurons deriving from the NB lineages NB1-1, 3-3, 4-2, and 7-1 (Frasch et al.,1987; Broadus et al.,1995). However, such markers are not sufficient to distinguish between neuronal and glial fate in general. A marker that is commonly used to monitor neuronal cell fate is the product of the elav gene (embryonic lethal, abnormal vision). Correspondingly, elav-GAL4 is a widely used driver line for neuron-specific ectopic gene expression. Since the discovery of elav and the first detailed description of the protein distribution by Robinow and White (1988,1991), elav is believed to be expressed exclusively in postmitotic neurons. It encodes an RNA-binding protein essential for the regulation of alternative splicing and generation of a number of neural-specific splice forms of neuroglian, erected wing, and armadillo (Koushika et al.,2000; Lisbin et al.,2001; Soller and White,2003,2005). In addition, elav was shown to regulate axonal pathfinding by ensuring proper expression of the commisureless gene in neurons (Simionato et al.,2007).

While studying segmental cell fate decisions in the lineage of NB6-4, which acts as a glioblast in abdominal and as a neuroglioblast in thoracic segments (Berger et al.,2005), we used ELAV as a marker for neuronal cell fate. To our surprise, we also observed ELAV in the NB6-4-derived cell body glia of wild type embryos. In further analysis, we found a transient ELAV expression in nearly all lateral glial cells of the embryonic CNS. In contrast to a nuclear localisation as described for neurons (Robinow and White,1991; Yannoni and White,1997), ELAV in glial cells seems to be located predominantly in the cytoplasm. However, in elav mutant embryos we did not detect an obvious glial phenotype. Further expression analysis revealed that elav is transcribed in embryonic NBs as well. In agreement with these new observations, we could further show that the elav-Gal4 driver lines are also active in proliferating cells (NBs and GMCs) as well as in glial cells, and thus can no longer be considered as exclusive postmitotic neuronal driver lines.


The Neuronal Marker ELAV Is Expressed Transiently in Embryonic Glial Cells

While analysing mutants for changes in neuronal versus glial cell fate within CNS cell lineages, we applied Repo (Reversed polarity) as a marker for differentiating glia (Halter et al.,1995) and ELAV (Embryonic lethal, abnormal vision), a commonly used marker for differentiating neurons (Robinow and White,1991). However, performing immunofluorescent double staining, we realized that both ELAV and Repo localise in early born glial cells (Fig. 1A1–A4). Further investigations revealed that ELAV is transiently expressed in nearly every glial cell. From approximately stage 14/15 onwards, ELAV can no longer be detected in glial cells in the embryo or in postembryonic tissues (See Supplemental Fig. S1A, which can be viewed at; and data not shown). In Figure 1A1–A4, glial cells at stage 12 are shown, some of which are identifiable by their position and time-point of appearance. For example, the cell body glia deriving from NB 6-4 (Fig. 1A1), glia deriving from NB 7-4 (Fig. 1A2), and longitudinal glia generated by the longitudinal glioblast (LGB; Fig. 1A4) show expression of ELAV. In later stages, two peripheral glial cells also express ELAV (Fig. 1B2, B3). As opposed to neurons, most of the detectable ELAV signal in glial cells is located in the cytoplasm, as revealed by using a membrane-bound form of GFP driven with repo-Gal4 (Fig. 1B1–B3). Using a full-length cDNA in situ probe, we also detected elav expression at the mRNA level in some of the Repo-positive glial cells. Figure 1C shows elav mRNA signal surrounding nuclear Repo staining.

Figure 1.

elav is detectable in embryonic glial cells. A1A4: Neuromeres T3 and A1 of wild type (WT) stage 12 (St12) embryos; single confocal sections (0.7 μm in thickness) at different ventral (A1) to dorsal (A4) levels. Glial cells (blue nuclear Repo staining) show a localisation of the ELAV protein (red) in the cytoplasm. Cell body glia derived from NB6-4 (green arrows), NB7-4 derived glia (magenta arrows), and longitudinal glia (LG; blue arrows) can be identified and show ELAV expression. Other glial cells (white arrows) also show expression of ELAV. B: ELAV localises to the cytoplasm of glial cells. Neuromeres A1 to A3 of stage 14 (St14) embryos of a repo-Gal4 line driving a membrane-bound UAS-mCD8:gfp; single confocal sections (0.8 μm in thickness) at different ventral (B1) to dorsal (B3) levels. In B4–B6, only the ELAV signal is shown. Two peripheral glial cells and one CNS glial cell are depicted by white arrows and show cytoplasmic localisation of Elav. C: elav mRNA can be detected in glial precursor cells at stage 11. Single confocal section (0.6 μm in thickness); top and bottom show frontal and saggital sections, respectively. D1, D2: ELAV protein is detectable in the longitudinal glioblast, which at stage 11 is still proliferating (Griffiths and Hidalgo,2004). Single confocal section (0.7 μm in thickness). In D2, only the ELAV channel is shown. In this and in all following figures, anterior is up; dotted line resembles the midline.

As Repo and ELAV are also commonly used markers for distinguishing between neuronal and glial fate in cell cultures, we examined their expression in primary cultures. Cell clones derived from neuroectodermal progenitor cells (Lüer and Technau,1992) were double-stained for ELAV and Repo at two time-points, after 6 and 24 hr in culture. In Figure 2A and B, two different 6-hr-old cell clones are shown, both comprising neurons and glial cells. In both clones, the Repo-positive glial cells co-express high levels of ELAV. As observed in the embryo, most of the protein seems to be located to the cytoplasm. In neurons, most ELAV protein is located to the nucleus as described earlier (Yannoni and White,1997). ELAV staining in glial cells is no longer detectable in 24-hr-old cultures (Fig. 2C).

Figure 2.

Glial cells derived from cultured neuroectodermal progenitor cells express ELAV. A1, B1, B5, C1: Triple staining with anti-Repo (red), anti-ELAV from rat (green), and anti-ELAV from mouse (blue). A2, B2, B6, C2: Anti-ELAV from rat and anti-Repo from rabbit; A3, B3, B7, C3: Anti-ELAV from mouse and anti-Repo from rabbit. All images show a single confocal section (0.5 to 0.7 μm in thickness). A4, B4, B8: Phase contrast microscopy pictures of the clones shown in A1, B1, and B5. A1A4: Four-cell clone after 6 hr of culture. Two cells show colocalisation of Repo (red) and ELAV (white arrows). The two Repo-negative neurons show only ELAV expression (yellow arrows). B1B8: Ventral (B1–B4) and dorsal (B5–B8) focal planes of a cell clone after 6 hr of culture. The clone is composed of several neurons, glial cells, ganglion mother cells (GMC), and one neuroblast (NB; small white arrowheads; GMC and NB identification based on size of the cells). The NB and the GMC show no ELAV expression. The Repo-positive glial cells show colocalisation of ELAV and Repo (white arrows). C1C3: Clone after 24 hr of culture. The Repo-positive glial cells show no expression of ELAV (white arrows), whereas the Repo-negative neurons show ELAV expression.

Taken together, we show at the mRNA and protein level that in addition to neurons, elav is expressed by embryonic glial cells in situ and in primary cell cultures. Glial elav expression is transient, and most of the protein seems to be located to the cytoplasm.

Monoclonal Antibodies Are Specific to ELAV

To exclude that ELAV staining in glial cells is non-specific, we tested both available monoclonal antibodies (from DSHB) by Western blot analysis. Both antibodies showed a single band on isolated embryonic protein extracts at approximately 50 kDa, which is the predicted molecular weight for the ELAV protein (see Supplemental Fig. S1B; Robinow and White,1991; Yannoni and White,1997). Furthermore, in elav5 mutant embryos at stage 15 (elav5 is a small interstitial deletion removing the entire elav coding sequence; Robinow and White,1991), no staining can be observed with either antibody, whereas Repo expression can be detected in glial cells (Supplemental Fig. S1C1–C3). This rules out that cross-reaction of either of the antibodies (ELAV, Repo, and secondary antibodies) used is responsible for the observed expression of ELAV in glial cells. Thus, both antibodies used in this study are specific to ELAV.

elav Is Expressed in Embryonic Neuroblasts

As we found ELAV expression in the purely glial lineage of the longitudinal glioblast (LGB, Fig. 1A4), we examined early developmental stages to see whether ELAV is also present in the dividing progenitor cell. Griffiths and Hidalgo (2004) described the proliferation pattern of the LGB, which produces 10 to 12 progeny cells. Initially, symmetric divisions generate four cells, which then differ in their division modes (Griffiths and Hidalgo,2004). We observed ELAV expression already at stage 11, after the first division of the LGB (Fig. 1D). Thus, ELAV is expressed in dividing progenitors of the longitudinal glial cells.

To see whether elav is also expressed in embryonic neuroblasts (NBs), we double-stained for elav mRNA and the neuroblast marker Worniu (Wor) (Ashraf et al.,1999; Ashraf and Ip,2001; Cai et al.,2001). In wildtype embryos at stage 11 (Fig. 3A), we detected elav mRNA in a number of Wor-positive NBs (dotted circles). It appears unlikely that the mRNA signal is due to a maternal contribution, as we cannot detect the signal earlier than stage 10 (data not shown). To obtain direct evidence for elav transcription, we generated an in situ probe against the first intron of the elav gene locus (see Experimental Procedures) to detect unprocessed RNA. As shown in Figure 3B, the in situ signal appears as one or two dots in the nucleus of the large Wor-positive cells at stage 11, indicating active transcription of the elav locus in embryonic NBs.

Figure 3.

elav is transcribed in dividing neuroblasts. A1, A2: elav-mRNA can be detected in Wor-positive (green) NBs. The mRNA signal surrounds the Wor-positive nucleus. In A2, only the mRNA signal is shown. The focal plane is in the ventrally located NBs layer. Dotted circles mark NBs. B1, B2: An in situ probe directed against the first intron of elav labels unspliced RNA in the nucleus of cells, where elav is expressed. B2 shows a higher magnification of the area marked in B1. Wor-positive NBs (asterisks) show one or two single spots of unspliced elav-RNA in their nucleus. Ganglion mother cells (GMC) are not Wor-positive, but also show elav-RNA signal. C1C6: ELAV protein expression in Wor-positive cells. Some NBs in the medial NB layer (C3, yellow arrows) and one dorsal precursor of the midline (C5, yellow arrow) show double staining of ELAV and Wor. Most NBs show no detectable signal of ELAV expression. The inset in C6 shows the Wor expression of the dorsal midline precursor. A and C show single confocal sections (0.5 to 0.7 μm in thickness); B shows light microscopic pictures.

Next we triple-stained embryos at stage 11 with antibodies against Wor, ELAV, and Miranda (Mira; Fig. 3C) to see whether elav mRNA in NBs is translated into protein. Mira is a cargo protein, which is asymmetrically localized to the basal cortex of dividing NBs. It is needed to shuttle Prospero and Brat to the ganglion mother cell during division (Ikeshima-Kataoka et al.,1997; Betschinger et al.,2006). Thus, a crescent-like Mira staining visualizes the M-phase of mitotic NB division. In most NBs, no clear ELAV signal can be detected (Fig. 3C1, C2). Only in some NBs (Fig. 3C3, C4; yellow arrows) and in one midline precursor (Fig. 3C5, C6; yellow arrows) can a weak staining be observed. One could speculate that elav mRNA could be transferred into the GMCs during asymmetric NB divisions. However, we did not find indications for such an asymmetric distribution of the elav mRNA in dividing NBs, and in string loss-of-function mutants, in which NBs are arrested in G2-phase, only a slight increase in the ELAV protein level can be observed in NBs (see Supplemental Fig. S2B). Therefore, posttranscriptional regulation in NBs may inhibit protein synthesis.

We conclude that elav is transcribed in mitotically active embryonic NBs. At the protein level, only weak staining is detectable in some NBs at stage 11.

elav-Gal4 Drives Reporter Gene Expression in Embryonic Glial Cells and Mitotically Active Cells

As ELAV is generally used as a marker for postmitotic neurons, the existing elav-Gal4 driver lines were used in a series of papers to drive the expression of a particular gene specifically in postmitotic neurons. As we could observe an expression of ELAV in glial cells and in mitotically active progenitor cells, we next tested whether the Gal4 lines elavC155-Gal4 and elav.L2-Gal4 reflect the observed elav expression pattern. The elavC155-Gal4 line is an enhancer trap insertion in the elav gene locus, whereas the elav.L2-Gal4 is an enhancer fragment cloned to Gal4 (Luo et al.,1994; Flybase). We used the UAS-mCD8::gfp transgenic line to monitor the activity of the Gal4 lines. This UAS line was tested for a possible leakiness, which would lead to an unspecific GFP expression (Supplemental Fig. S1 D1, D2). As shown for the elavC155-Gal4 driver line in Figure 4, clear expression of CD8::GFP and Mira can be observed from late stage 11 onwards (Fig. 4A1, A2 yellow arrows). This shows that the Gal4 line drives expression already in dividing NBs. Furthermore, Repo-positive glial cells show a double-labelling with CD8::GFP already at early stages (Fig. 4A2, A3, white arrows). In late stage 12, the numbers of both mitotically active cells and glial cells expressing CD8::GFP have increased (Fig. 4B1-B3, yellow (NBs) and white (glial cells) arrows). Concordant with the anti-ELAV staining (Fig. 1), cell body glia derived from NB6-4, subperineural and channel glia derived from NB7-4, and some longitudinal glia derived from the LGB were identifiable among the CD8::GFP-expressing cells (Fig. 4C1–C3). At late stage 16, many of the identified CNS glial cells, as well as some peripheral glial cells, still show strong CD8::GFP expression (Supplemental Fig. S3A1–A6).

Figure 4.

elavC155-Gal4 shows reporter gene expression in glial cells and dividing embryonic neuroblasts. A1,A2: At late stage 11 (St11l), single mitotically active NBs (yellow arrows) show double staining for Mira (red) and CD8::GFP (green), revealing that the Gal4 line is already driving reporter gene expression in NBs. A3: Glial cells (white arrows) are also positively labelled for CD8::GFP. B1B3: In later stages (St12l), strong CD8::GFP expression in Mira-positive NBs (yellow arrows) and glial cells (white arrows) can be observed. For clarity, only the CD8::GFP channel is shown in A2 and B2. C1C3: Numerous identified glial cells express CD8::GFP in stage 12. As observed by anti-ELAV staining (Fig. 1A1–A4), NB6-4 derived cell body glia (green arrows), NB7-4 derived glial cells (magenta arrows), and longitudinal glia (LG; blue arrows), as well as other glia cells (white arrows) show CD8::GFP expression. All images show single confocal sections (0.5 to 0.7 μm in thickness).

Similar results were obtained when we used the elav.L2-Gal4 as a driver line (Supplemental Fig. S3 B1–C6). Thus, the commonly used elav-Gal4 lines drive reporter gene expression in both mitotically active progenitor cells and glial cells throughout embryonic development.

elav Mutants Show No Obvious Glial Phenotype

We reinvestigated the number and position of glial cells in elav loss-of-function (elav5) mutant embryos (Supplemental Fig. S2D). We observe 25 CNS glia (n=14) and 10–12 peripheral glia (n=13) per hemisegment, which corresponds to wildtype numbers (Ito et al.,1995; Beckervordersandforth et al., unpublished data). However, we detect slightly abnormal positioning of peripheral glia and longitudinal glia. Since the organization of the neuropile is clearly disrupted, as revealed by FasII staining (Supplemental Fig. S2D and Hummel et al.,1999; Simionato et al.,2007), we cannot exclude that mislocalisation of glial cells represents a secondary effect.


The discovery and characterization of elav as a neuronal postmitotic gene (Robinow and White,1988,1991) had enduring effects on studies dealing with embryonic nervous system development in Drosophila. As this was the first exclusively neuronal marker available, researchers also used the elav-Gal4 driver lines as a genetic tool to ectopically or exclusively express particular genes in postmitotic neurons. Analysing ELAV in conjunction with other cell-specific markers, and using confocal microscopy for analysis on a single cell level, we observed that, in addition to neurons, elav is transiently expressed in most embryonic glia cells. Similarly, expression in glial cells of the optic nerve was also shown for a vertebrate homologue of ELAV, the Hu paraneoplastic antigen (Kostyk et al.,1996). Furthermore, Drosophila elav is transiently expressed in proliferating progenitor cells (neuroblasts and glioblasts). Correspondingly, the elav-Gal4 lines drive reporter gene expression in embryonic glia and neural progenitor cells. Thus, ELAV can no longer be used as an exclusive marker or driver for postmitotic neurons. However, in accordance with earlier reports (Robinow and White,1991), we did not find elav expression in late embryonic glial cells or postembryonic NBs (data not shown). Since the elav loss-of-function mutation has no obvious effects on the number or pattern of embryonic glial cells, there is so far no indication for a role of elav in glial development. Nevertheless, a possible impact on the establishment of glial function cannot be excluded.



Standard methods were used to rear flies and collect embryos. OregonR was used as a wild type strain. The elav5 allele (Robinow and White,1991) is an interstitial deletion of the complete coding region of elav. The elav[C155]-Gal4, elav.L2-Gal4, UAS-mCD8::gfp, and Stg4 lines are from Bloomington Stock Center. Repo-Gal4 line was obtained from Bradley Jones (Lee and Jones,2005).

Cell Culture

Primary cultures of neuroectodermal progenitor cells were generated as previously described (Lüer and Technau,1992). Cells were cultured for either 6 or 24 hr. Clones derived from cultured progenitors were incubated with anti-ELAV from mouse or rat and anti-Repo from rabbit. Clones with identifiable glial cells were analysed for ELAV expression.


Following dechorionization in 7.5% bleach, embryos from overnight collections were devitellinized and fixed in heptane with 4% formaldehyde in phosphate-buffered saline for 25 min. The fixed embryos were dehydrated by a 10-min wash in methanol. For staining with diaminobenzidine (DAB, Sigma), embryos were incubated in 3% H2O2 solution in ethanol for 15 min. Primary antibodies used were rat anti-ELAV-7E8A10 (1:500), mouse anti-ELAV-9F8A9 (1:1,000), mouse anti-FasII (all from Developmental Studies Hybridoma Bank), rabbit anti-Repo (1:500, Halter et al.,1995), rabbit anti-β-gal (1:2,000, Cappel), mouse anti-Dig (1:500, Molecular Probes), mouse anti-Worniu (1:1,000, M. Büscher), rat anti-mCD8 (1:10, Caltag), and guinea pig anti-Mira (1:100, A. Brand).

The secondary antibodies used were anti-mouse-biotin, anti-rat-biotin, anti-guinea-pig-biotin, anti-rabbit-biotin, anti-mouse-FITC, anti-rat-FITC, anti-rabbit-FITC, anti-guinea-pig-Cy5, anti-rat-Cy5, anti-rabbit-Cy5, anti-mouse-Cy3, anti-guinea-pig-Cy3, anti-rabbit-Cy3 (1:250, all from donkey, all Jackson Immunoresearch Laboratories), anti-mouse-Cy5 from goat (1:250, Jackson Immunoresearch Laboratories), and donkey anti-mouse-Alexa488 (1:250, Molecular Probes). For DAB staining, the ABC Kit from Vectastain was used. Colour images were produced using a Zeiss Axioplan 2 microscope. The Leica TCS SPII confocal microscope was used for fluorescent imaging, and the images were processed using Leica Confocal software and Adobe Photoshop.

In Situ Hybridisation

The in situ probe against elav mRNA was generated from an EST clone LD33076 covering the complete coding sequence (from Berkely Drosophila Genome Project, Gold collection). After linearising by BamH1 digestion, the probe was generated using the SP6 polymerase.

The probe against the first intron of the elav gene was amplified from genomic DNA using the following primer: forward primer (coupled to T7 RNA polymerase promoter sequence) CTGAGTGATAGGTGAGAGGATCGGG; reverse primer GCAGAGCTTTGATTTCTAGTGCGCG.

Both probes were labelled using dig-labelled nucleotides. After hybridization, the probes were stained using anti-dig antibody. The signal was amplified using the TSA amplification system from Perkin Elmer.

Western Analysis

To prepare embryonic extracts for Western blots, 50 μl embryos were homogenized in 500 μl 2× sample buffer (0.09M Tris, pH 6.8, 20% glycerol, 2% SDS, 0.02% Bromphenol Blue, 0.1M DTT). Samples were boiled for 10 min, loaded and electrophoresed through a 10% SDS-polyacrylamide gel, and transferred to a PVDF membrane (Roth) in transfer buffer (pH 8.3: 25 mM Tris, 150 mM Glycin, 10% methanol) using a B33 Biometra Fast-Blot. The membrane was blocked for 1 hr in 1% Western blocking reagent (Roche). Affinity-purified ELAV antibodies (rat 1:2,000 and mouse 1:500 in Western blocking reagent) were incubated with the membrane overnight at 4°C. The secondary antibody, AP-conjugated goat anti-rat and goat anti-mouse were used at 1:5,000 dilution in PBST, for 2 hr at room temperature. All washes were done using PBST. For enzymatic staining reaction, 66 μl NBT and 33 μl BCIP were added to 10 ml AP-detection buffer. After complete staining, the membrane was washed again. As a loading control, a monoclonal antibody against Actin (Sigma; 1:500) was used.


We thank Matthias Soller for the elav mutants, Andrea Brand for antibodies, Ana Rogulija-Ortman for critical comments on the manuscript, and the Deutsche Forschungsgemeinschaft for support. The Elav and FasII antibodies were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, IA 52242.