SEARCH

SEARCH BY CITATION

Keywords:

  • epithelial to mesenchymal transition (EMT);
  • integrin-linked kinase (ILK);
  • E-cadherin;
  • Snail;
  • Poly(ADP-ribose)polymerase (PARP);
  • cancer

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Repression of E-cadherin expression by the transcription factor, Snail, is implicated in epithelial to mesenchymal transition and cancer progression. We show here that Integrin-Linked Kinase (ILK) regulates E-cadherin expression through Poly(ADP-ribose) polymerase-1 (PARP-1). ILK overexpression in Scp2 cells resulted in stimulation of Snail expression and loss of E-cadherin expression. Silencing of ILK, Akt or Snail resulted in re-expression of E-cadherin in PC3 cells. To elucidate the signaling pathway downstream of ILK, we identified candidate Snail promoter ILK Responsive Element (SIRE) binding proteins. PARP-1 was identified as a SIRE-binding protein. ILK silencing inhibited binding of PARP-1 to SIRE. PARP-1 silencing resulted in inhibition of Snail and ZEB1, leading to up-regulation of E-cadherin. We suggest a model in which ILK represses E-cadherin expression by regulating PARP-1, leading to the binding of PARP-1 to SIRE and modulation of Snail expression. Developmental Dynamics 237:2737–2747, 2008. © 2008 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Epithelial to mesenchymal transition (EMT) is a process by which epithelial cells acquire mesenchymal properties, dissociate from the epithelium and migrate to secondary sites (Savagner,2001). As cells undergo EMT, cell–cell and cell–extracellular matrix (ECM) interactions are altered, the ECM is degraded and the cytoskeleton is re-organized (Savagner,2001). Importantly, EMT is characterized by a switch from epithelial to mesenchymal gene expression (Savagner,2001; Thiery,2002). EMT is an essential process during early embryonic development, but is also associated with several fibrotic diseases (Iwano et al.,2002) and with possibly metastatic progression in many human cancers (Savagner,2001; Thiery,2002). Indeed, the metastatic propensity of malignant disease is a marker of poor prognosis (Thiery,2002; Weigelt et al.,2005). Therefore, a better understanding of the components and mechanisms of EMT is critical if we are to make meaningful advances in the development of efficacious treatment modalities for cancer.

The loss of E-cadherin expression and the associated disruption of cell–cell junctions is a key step in the process of EMT, and is a marker of poor patient prognosis in many solid cancers (Umbas et al.,1994; Thiery,2002). Loss of E-cadherin may result from genetic mutations, promoter hypermethylation or transcription factor dysregulation (Hennig et al.,1996; Giroldi et al.,1997; Ji et al.,1997; Batlle et al.,2000). In particular, transcriptional repressor complexes are emerging as important regulators of E-cadherin expression. The Snail transcription factor is a known transcriptional repressor of E-cadherin and a well characterized inducer of EMT (Batlle et al.,2000; Cano et al.,2000; Nieto,2002).

The expression of Snail is critical for EMT during embryonic development (Sefton et al.,1998; Carver et al.,2001) and its overexpression in epithelial cells results in down-regulation of E-cadherin, conversion to a fibroblastic phenotype, and acquisition of tumorigenic and invasive properties (Batlle et al.,2000; Cano et al.,2000). High Snail expression is also observed in recurrent human breast carcinomas (Moody et al.,2005) and can be used as an independent marker for both tumor grade and mortality (De Craene and Berx,2006). Snail is transcriptionally silent in normal epithelial cells (Perez-Mancera et al.,2005) and its expression is regulated at the level of transcription by several cell signaling effectors, including Akt (Guaita et al.,2002), ET-1 (Rosano et al.,2005), Gli (Li et al.,2006) and Integrin Linked Kinase (ILK) (Tan et al.,2001; Guaita et al.,2002).

ILK is a multidomain protein that functions as a PI3-kinase (PI3K)-dependent serine/threonine protein kinase and a modular adaptor protein (Hannigan et al.,2005; Legate et al.,2006; McDonald et al.,2008). Importantly, ILK has been shown to induce EMT in some epithelial cell lines (Novak et al.,1998; Somasiri et al.,2001; Guaita et al.,2002). Overexpression of ILK in the Scp2 mouse mammary epithelial cell line, for example, results in the loss of E-cadherin, loss of polarity, and induction of EMT (Somasiri et al.,2001). Furthermore, introduction of PTEN, a tumor suppressor mutated in a variety of cancers (Simpson and Parsons,2001), into PTEN-null PC3 prostate cancer cells results in the re-expression of E-cadherin, probably by means of the inhibition of ILK activity (Persad et al.,2001). The mechanism by which ILK induces the loss of E-cadherin and the progression of EMT remains unclear, although current data suggest that ILK transcriptionally regulates Snail through an unknown mechanism (Tan et al.,2001; Peiro et al.,2006).

We have previously demonstrated that ILK regulates Snail transcription in the SW480 colon carcinoma cell line and that this regulation is partially mediated by a 65 base pair (bp) region in the 5′ promoter of Snail, termed the Snail ILK Responsive Element (SIRE) (Tan et al.,2001). In this study, we use a SIRE oligonucleotide as bait in an affinity chromatography assay to identify candidate proteins that reside downstream of ILK in the regulation of Snail and, ultimately, E-cadherin. Using this assay, coupled with mass spectrometry, we have identified several candidate proteins that bind differentially to the SIRE of PC3 prostate cancer cells subsequent to siRNA-mediated disruption of the ILK signaling pathway. One of the identified proteins is Poly(ADP-ribose) polymerase-1 (PARP-1), an enzyme that catalyzes the addition of ADP-ribose chains to itself and to several target proteins. We further characterize the PARP-1-SIRE interaction and show that, together with ILK, PARP-1 mediates the expression of E-cadherin through Snail and ZEB1. Our data indicate that PARP-1 is a bona fide SIRE-binding protein and suggest that it is an interesting and critical component of the E-cadherin regulatory axis in the process of EMT.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Overexpression of ILK in Scp2 Mouse Mammary Epithelial Cells Results in Up-regulation of Snail

It has been reported that stable overexpression of ILK in the mouse mammary epithelial Scp2 cell line results in the loss of E-cadherin protein and induction of EMT (Somasiri et al.,2001). In the present study, we observed that the stable overexpression of ILK in the Scp2 cell line (ILK-13-8) resulted not only in the loss of E-cadherin protein (Fig. 1A), but also mRNA (Fig. 1B). ILK overexpression also resulted in a substantial increase in the expression of Snail protein (Fig. 1A) and mRNA (Fig. 1B). In contrast, Snail mRNA and protein levels in parental Scp2 cells were found to be low or undetectable. Stable transfection of a control, noncoding (i.e., antisense orientation) ILK construct (ILK-14-1) phenocopied the attributes of the parental line and had no effect on the expression of either Snail or E-cadherin.

thumbnail image

Figure 1. Expression of E-cadherin and Snail in Scp2 mouse mammary epithelial cell lines stably overexpressing Integrin-Linked Kinase (ILK). A: Western blot analysis for protein expression. β-Actin was used as a loading control. B: Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of E-cadherin and Snail mRNA levels using SYBR Green methodology. Message levels for the genes of interest were normalized to β-actin mRNA levels and results are expressed as relative fold change compared with the parental Scp2 cell line.

Download figure to PowerPoint

siRNA-Mediated Knockdown of ILK, Akt, and Snail, but Not GSK-3β, Results in Up-regulation of E-Cadherin Expression in PC3 Cells

Next, we were interested in identifying a human cell model system that would allow us to elucidate the signaling pathways involved in the ILK-mediated control of Snail and E-cadherin. It has been shown previously that the ILK signaling pathway is constitutively active in the PC3 prostate cancer cell line due to the loss of PTEN expression, and that introduction of PTEN results in re-expression of E-cadherin (Persad et al.,2001). Using RNA interference (RNAi) as a strategy for targeted depletion of gene expression, we examined the role of the PI3K-ILK-Akt axis in regulating E-cadherin expression in PC3 cells. The ILK and Akt siRNA constructs were highly efficacious, resulting in substantial, specific reduction of both protein (Fig. 2A) and mRNA (data not shown). siRNA-mediated knockdown of ILK or Akt resulted in an increase in E-cadherin expression at the level of protein (Fig. 2A) and mRNA (Fig. 2B). siRNA-mediated knockdown of GSK-3β did not alter E-cadherin expression (Fig. 2A).

thumbnail image

Figure 2. Effect of siRNA-mediated depletion of ILK or its downstream targets on E-cadherin expression in the PC3 human prostate carcinoma cell line. A: Western blot analysis for protein expression. Samples were assessed for efficacy and specificity of protein knockdown and for the impact of target depletion on the expression of E-cadherin. β-actin was used as a loading control. B: qRT-PCR analysis using SYBR green methodology of the relative amounts of E-cadherin mRNA in PC3 cells transfected with the indicated siRNA constructs. Results were normalized to β-actin mRNA levels and are reported as fold change compared with cells transfected with control siRNA. C: Western blot analysis of Snail protein levels present in nuclear extracts of PC3 cells transfected with the indicated siRNA constructs. Lamin A/C was used as a loading control. Analysis of whole cell lysates is provided for the purposes of comparison. D: qRT-PCR analysis using SYBR green methodology of the relative amounts of Snail mRNA in PC3 cells transfected with Snail siRNA. Results were normalized to β-actin mRNA levels and are reported as fold change compared with cells transfected with control siRNA.

Download figure to PowerPoint

The expression of Snail in E-cadherin-negative PC3 cells (Fig. 2C) suggests the presence of Snail-mediated repression of E-cadherin in this model. Indeed, while siRNA-mediated knockdown of Snail resulted in a modest reduction in the levels of Snail expression (Fig. 2C,D), E-cadherin expression increased substantially (Fig. 2A,B), indicating that Snail is a sensitive regulator of E-cadherin in this system. Interestingly, siRNA-mediated knockdown of ILK and Akt did affect cellular distribution of Snail, substantially reducing its protein levels in the nucleus (Fig. 2C). Loss of Akt expression also resulted in a loss of Snail from the whole cell lysate (Fig. 2C).

Isolation and Identification of SIRE-interacting Proteins That Demonstrate Differential Binding Due to Loss of ILK Expression

We next designed a strategy to identify candidate SIRE-binding proteins in the PC3 cell model to elucidate the mechanism by which ILK regulates Snail and, ultimately, E-cadherin. To isolate candidate proteins that bind the SIRE sequence in an ILK-dependent manner, we used a synthetic SIRE oligonucleotide as bait in an affinity chromatography assay. The oligonucleotide was biotinylated on the 5′ end of the sense strand and immobilized on magnetic streptavidin beads. The beads were then exposed to nuclear extracts from either control siRNA-or ILK siRNA-treated PC3 cells. Protein fractions were eluted sequentially from the column using graded salt concentrations and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE; Fig. 3A). Candidate SIRE-binding proteins were selected based on differential banding in the control vs. the experimental sample. Selected bands were then excised and identified by mass spectrometry (Fig. 3B). Three candidate proteins bound to the SIRE sequence in the control siRNA-treated PC3 cells and demonstrated reduced binding in the absence of ILK expression (Fig. 3; Table 1). These proteins were identified as Methyl-CpG domain binding protein 5 (MDB-5), a chromodomain-helicase-DNA-binding protein 8/Helicase with SNF2 domain 1 (CHD-8/HELSNF1) fragment and Poly(ADP-ribose) polymerase-1 (PARP-1). Owing to limited availability of high quality tools and reagents, MBD-5 and the fragment of CHD-8 were not investigated further. The third protein, PARP-1, was validated and further characterized in this study.

thumbnail image

Figure 3. Identification of Snail ILK Responsive Element (SIRE) -binding proteins in PC3 cells transfected with Integrin-Linked Kinase (ILK) siRNA. A: Proteins binding the SIRE were isolated using a biotin/streptavidin chromatography column and eluted using an increasing salt gradient. Eluted proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (10%) and visualized with Sypro-Ruby stain on a Typhoon Scanner. Bands demonstrating patterns of differential staining intensity are highlighted in boxes. B: Inset showing the three proteins of interest based on differential banding patterns. These bands were excised and identified by mass spectrometry to be Methyl-CpG domain binding protein 5 (MDB-5), a fragment of chromodomain-helicase-DNA-binding protein 8 (CHD-8), and Poly(ADP-ribose) polymerase-1 (PARP-1).

Download figure to PowerPoint

Table 1. Sequence of Trypsin Digested Fragments Identified by Mass Spectrometry
Protein sizePeptide sequence determinedCorresponding position in:Reference sequence no.
120 kDa PARP-1NM_001618 P09874
 MAIMVQSPM34-42 
 TLGDFAAEY108-116 
 GFSLLATED182-190 
 ELLIFNK262-268 
 QQVPSGESA269-277 
 VVSEDFLQD452-460 
 MIFDVESMK674-682 
 AMVEYEIDL684-692 
 GGSDDSSKD779-787 
 TTNFAGILS865-873 
 IAPPEAPVT878-886 
 GIYFADMVS893-901 
162 kDa MBD-5NM_018328 Q9P267
 NLDHGKNVNEG1169-1179 
51 kDa CHD-8 (fragment)NM_020920 Q6P440
 VDGTLLVGEDA197-207 

ILK-Dependent Formation of a PARP-1–Containing Complex With SIRE

To further characterize PARP-1 as a SIRE-interacting protein, we performed a series of electromobility shift assays (EMSA) using the SIRE sequence and nuclear extracts from untreated and siRNA-treated PC3 cells. First, we showed that nuclear extracts from untreated PC3 cells resulted in an upward shift in the electrophoretic mobility of the labeled SIRE sequence (Fig. 4A). We further demonstrated that the binding of proteins present in the nuclear compartment to the SIRE sequence was specific by disengaging the labeled probe with an excess of cold SIRE competitor (Fig. 4A). Nonspecific cold competitor was used as a control. We were also able to disrupt the nuclear protein-SIRE interaction with a mutant cold SIRE competitor in which the E-box sequence was changed from CACCTG to AACCTA (Fig. 4A). Next, we used nuclear extracts from ILK siRNA-treated PC3 cells in the EMSA assay and observed a reduction in the signal of one of the shifted oligonucleotide bands (Fig. 4B). Finally, nuclear extracts from PARP-1 siRNA-treated cells were used and a reduction in signal intensity of the same band identified in cells depleted of ILK was observed (Fig. 4B). Other protein complexes were found to bind the SIRE oligonucleotide (Fig. 4B), but were not modulated by depletion of ILK or PARP-1, providing an internal control for specificity.

thumbnail image

Figure 4. Electromobility shift assay (EMSA) using nuclear extracts of PC3 cells and a Klenow 3′ 32P-ATP end-labeled Snail ILK Responsive Element (SIRE) oligonucleotide. A: PC3 nuclear extract (NE) resulted in the presence of a shifted band (arrow). The shifted bands were out-competed with a cold SIRE oligonucleotide and a cold mutated-SIRE, in which the E-box motif was mutated, but not a nonspecific oligonucleotide. B: EMSA conducted with nuclear extracts of PC3 cells depleted of Integrin-Linked Kinase (ILK) or Poly(ADP-ribose) polymerase-1 (PARP-1). The reduction of a shifted band (arrow) was observed due to siRNA-mediated depletion of ILK or PARP-1.

Download figure to PowerPoint

siRNA-Mediated Knockdown of PARP-1 or ILK Results in Suppression of E-Cadherin Transcriptional Repressors and Up-regulation of E-cadherin Expression

Next, we performed experiments to determine whether PARP-1 is involved in the regulation of E-cadherin. siRNA-mediated knockdown of PARP-1 in PC3 cells resulted in substantial reduction of PARP-1 protein and mRNA (Fig 5 Ai,Bi), and concomitant, significant up-regulation of E-cadherin expression compared with control cultures (Fig. 5 Ai,Bii). A similar pattern of expression was observed in cells depleted of ILK (Fig. 5 Aii,C). The dramatic increase in E-cadherin expression subsequent to depletion of PARP-1 or ILK was coupled with a significant decline in Snail mRNA (Fig. 5 Bi,Ci). It is interesting that the effect of PARP-1 knockdown on Snail mRNA levels in PC3 cells, while statistically significant compared with control cells (Fig. 5 Bi), was substantially less than that observed with depletion of ILK (Fig. 5 Ci). Furthermore, the mRNA level for ZEB1, another E-cadherin repressor, was reduced when PARP-1 or ILK expression was inhibited (Fig. 5 Bi,Ci). The loss of PARP-1 expression had little effect on ILK protein levels and loss of ILK expression had no effect on PARP-1 protein levels (Fig. 5A), demonstrating the target specificity of the siRNA. To confirm these findings, we knocked down PARP in the MDA-MB-435-LCC6 cell line, an aggressive mesenchymal cancer cell line with robust Snail expression. Depletion of PARP-1 in these cells resulted in significant down-regulation of Snail mRNA (Fig. 5 Di). siRNA-mediated depletion of Snail also resulted in dramatic inhibition of Snail mRNA levels, as expected (Fig. 5D). As a control, suppression of PARP-1 strongly inhibited PARP-1 mRNA expression, while siRNA-mediated knockdown of Snail did not affect levels of PARP (Fig. 5D).

thumbnail image

Figure 5. Effect of siRNA-mediated depletion of Poly(ADP-ribose) polymerase-1 (PARP-1) or Integrin-Linked Kinase (ILK) on E-cadherin and Snail expression in cancer cells. A: Western blot analysis for protein expression. Samples were assessed for efficacy and specificity of protein knockdown and for the impact of target depletion on the expression of E-cadherin. siRNA constructs were used at 100 nM. β-Actin is provided as a loading control. Knockdown of ILK (A, ii) is included as a control to demonstrate that the effects of PARP-1 (A, i) are not secondary to inhibition of ILK expression. B–D: Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of mRNA expression using Roche UPL technology. All samples were assessed for the effect of PARP or ILK knockdown on the regulation of Snail, ZEB1, and E-cadherin. Results were normalized to β-actin mRNA levels and are reported as fold change compared with siRNA-treated cells. The relative amounts of E-cadherin, Snail, and ZEB1 mRNA were assessed in PC3 cells transfected with either PARP-1 (B, i and ii) or ILK (C, i and ii) siRNA. D: MDA-MB-435-LCC6 cells transfected with either PARP (D, i) or Snail (D, ii) siRNA also show a marked decrease in Snail mRNA upon PARP inhibition. Statistical analysis was done using Student's t-test; *P ≤ 0.02, **P ≤ 0.002.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

The data presented in this study expand on the observation that overexpression of ILK in Scp2 mouse mammary epithelial cells results in the loss of E-cadherin expression and initiation of EMT (Somasiri et al.,2001). The loss of E-cadherin at the level of transcription and the up-regulation of Snail in the ILK overexpressing Scp2 cell line suggest that loss of E-cadherin transcription in these cells is mediated, at least in part, by Snail. These data provide evidence supporting the hypothesis that Snail is a major effector downstream of ILK in loss of E-cadherin and induction of EMT. We further identify PARP-1 as a SIRE-binding protein using an in vitro binding assay. Our data support the suggestion that PARP-1 binds the SIRE in an ILK-dependent manner. Finally, we find that inhibition of PARP-1 expression in PC3 cells results in a concomitant decrease in Snail and ZEB1 expression, leading to re-expression of E-cadherin.

The PI3K-ILK-Akt axis has an evidence-based role in the regulation of EMT (Novak et al.,1998; Tan et al.,2001; Guaita et al.,2002; Rosano et al.,2005) and ILK, in particular, is known to impact various signaling pathways important for the regulation of epithelial and mesenchymal genes (Troussard et al.,1999,2000; D'Amico et al.,2000; Persad et al.,2000; Tan et al.,2001,2004; Oloumi et al.,2006). Thus, we examined ILK-mediated control of Snail and E-cadherin in PC3 cells, a tumor cell model that has undergone EMT, and in which the PI3K-ILK-Akt signaling pathway is constitutively active. Importantly, PC3 cells are unable to form adherence junctions due to the loss of α-catenin (Ewing et al.,1995) as well as E-cadherin. As formation of adherence junctions alone can result in the modulation of epithelial and mesenchymal genes (Somasiri et al.,2001), these cells allow us to study the initial steps in reversion to an epithelial phenotype.

siRNA-mediated knockdown of ILK or Akt resulted in a transcriptionally regulated increase in E-cadherin protein expression in PC3 cells. These data demonstrate that, in the PC3 cell line, repression of E-cadherin expression is mediated, at least in part, by the ILK/Akt signaling axis. Furthermore, siRNA-mediated knockdown of Snail resulted in a moderate reduction in Snail mRNA and protein levels, but a substantial increase in E-cadherin mRNA and protein. These findings suggest that, in PC3 cells, Snail is partially responsible for the loss of E-cadherin expression and that even subtle modulation of Snail levels has a profound effect on E-cadherin. Indeed, recent findings indicate that Snail has a threshold effect. In transgenic mice, low levels of Snail expression cause a high rate of cancer development, but, unlike high levels of Snail expression, do not induce an EMT or migration in carcinomas (Perez-Mancera et al.,2005).

To interrogate the mechanism by which ILK may modulate Snail transcription, we developed a strategy to identify proteins capable of binding the SIRE sequence in an ILK-dependent manner. PARP-1 was a major interactor identified using this binding assay. PARP-1 has recently garnered a great deal of attention for its role in transcriptional regulation (Le Page et al.,1998; Kannan et al.,1999; Miyamoto et al.,1999; Andreone et al.,2003; Eberhart,2003; Ju et al.,2004; Idogawa et al.,2005; Pavri et al.,2005). We observed that PARP-1 binds the SIRE sequence in the presence, but not the absence of ILK. We were able to show that siRNA-mediated knockdown of PARP-1 expression results in an elevated level of E-cadherin expression, supporting a role for PARP-1 in the regulation of E-cadherin and as a bona fide ILK-regulated SIRE-binding protein.

The exposure of the SIRE probe to PC3 cell nuclear extracts resulted in the appearance of shifted bands in the EMSA assay. One of the shifted bands was reduced due to the siRNA-mediated knockdown of ILK, suggesting the presence of an ILK-regulated SIRE binding complex. This band corresponded to a band that was reduced due to the siRNA-mediated knockdown of PARP-1. Together, these data support the idea that ILK may regulate the binding of a complex of proteins to the SIRE fragment and that this complex contains PARP-1.

The SIRE sequence contains an E-box motif, which is completely conserved in humans, mice, and rats. Using a cold mutant SIRE in which the E-box sequence is mutated, we were able to demonstrate that it is not required for the binding of the ILK-regulated complex. However, this does not mean that the E-box motif is not important in modulating binding of the ILK-mediated protein complex or regulating Snail transcription. It is possible that the ILK-regulated complex is displaced from the SIRE by an E-box binding protein complex. Of interest, Snail has recently been shown to bind its own promoter by means of the E-box located in the SIRE and inhibit its own transcription (Peiro et al.,2006). In addition to the E-box motif, the SIRE sequence contains numerous CpG dinucleotides. The Snail promoter contains a 698 bp CpG island that is 25% CpG dinucleotides and spans the SIRE sequence. CpG islands are often associated with ubiquitously expressed housekeeping genes. It is surprising that Snail, a gene normally transcriptionally repressed, contains a CpG island in its promoter, suggesting that the numerous CpG dinucleotides may be important in PARP-1 binding. The role of the E-box sequence and CpG islands in ILK-mediated Snail transcription requires further study.

In addition to PARP-1, the SIRE-binding assay identified MBD-5 and the fragment of CHD-8 as candidate interactors. Although the tools required for validation of these proteins as specific SIRE-binding partners are not readily available, analysis of their proposed function and the function of known family members suggest that they are relevant interactors. MBD-5 contains a Methyl-CpG Binding Domain (MBD), which binds methylated CpG dinucleotides or is involved in protein–protein interactions (Roloff et al.,2003). The affinity column used a synthetic SIRE sequence that did not contain any methylated CpG dinucleotides, suggesting that MBD-5 interacts with unmethylated CpG dinucleotides or that its interaction with the SIRE sequence is not direct. The CHD-8 fragment constitutes the N-terminal portion of CHD-8, which lacks the Chromo and SNF2-related helicase domains of CHD-8. This fragment still contains the BRK domains and the binding sequence for CFTF (Ishihara et al.,2006). CFTF is a protein involved in imprinting, which has been shown to be regulated by poly-ADP-ribosylation (Yu et al.,2004; Torrano et al.,2006). Lastly, members of both the MBD and CHD families are part of the Mi-2/NuRD protein complex, which is a known regulator of Snail transcription (Fujita et al.,2003; Bowen et al.,2004). Further studies are required to determine whether MBD-5 and the fragment of CHD-8 are valid SIRE-binding partners and how ILK is able to regulate their functions.

Finally, the striking up-regulation of E-cadherin in PC3 cells depleted of PARP-1, together with data suggesting that PARP-1 is an ILK-dependent SIRE-interacting partner, provides strong evidence for a role of PARP-1 in mediating ILK-dependent regulation of E-cadherin expression. The regulation of E-cadherin expression by PARP-1 is likely dependent on transcriptional repression of the E-cadherin gene as depletion of PARP-1 suppresses mRNA for Snail, as well as another E-cadherin repressor, ZEB1. Importantly, depletion of PARP-1 results in an expression pattern of Snail, ZEB1, and E-cadherin similar to that observed when ILK, an upstream component of this regulatory pathway, is silenced.

In this study, we have identified PARP-1 as a novel SIRE-binding protein downstream of the ILK signaling pathway. Our data demonstrate a role for PARP-1 in the regulation of E-cadherin and implicates transcriptional repressors such as Snail in this process. We propose that ILK regulates PARP-1 to modulate its ability to bind the SIRE sequence of the Snail promoter. The presence of PARP-1 on the Snail promoter mediates Snail transcription and its subsequent repression of E-cadherin transcription. These data, together with the emerging co-factor role of PARP-1 in pathways known to be involved in EMT, suggest that further analysis of PARP-1 in the ILK-mediated regulation of E-cadherin and the process of EMT is needed.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Cell Culture

PC3 and Scp2 cells were obtained from ATCC (Manassas, VA). PC3 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal calf serum (FCS; Invitrogen, Burlington, ON, Canada), penicillin (100 units/ml), and streptomycin (100 mg/ml; Invitrogen). Scp2 ILK(14) and Scp2 ILK(13) cells were cultured in DMEM-F12 containing 5% FCS, penicillin (100 units/ml), streptomycin (100 mg/ml; Invitrogen), and 100 μg/ml G418 (Invitrogen). Parental Scp2 cells were cultured in DMEM-F12 containing 5% FCS, penicillin (100 units/ml) and streptomycin (100 mg/ml) (Invitrogen). Cells were cultured at 37°C in 5% CO2. All cells were routinely grown on tissue culture plastic. Cells were trypsinized at 90% confluence using trypsin:PBS/EDTA, diluted 1:4 in phosphate buffered saline (PBS), and resuspended in the appropriate media containing serum. Cells were re-plated at a ratio of 1:10.

Cell Lysis

Cell monolayers were harvested in cold PBS and lysed in 5× the cell pellet volume of RIPA lysis buffer. Soluble fractions were separated and protein concentrations were determined using the BCA Protein Assay (Pierce, Rockford, IL) according to the manufacturer's recommendations. Briefly, triplicate 5-μl samples of cleared cell lysate and 95 μl of BCA reagent were added per well and incubated 30 min at 37°C. Absorbance was measured using a standard protocol. Bovine serum albumin (BSA) was used to establish a protein concentration standard curve. Lysates were used immediately or stored at −80°C.

Nuclear Fractionation

Nuclear extracts were prepared by the mini-extraction method as described previously (Andrews and Faller,1991). Protein concentrations were determined using the Bradford Protein Assay (Bio-Rad, Mississauga, ON, Canada) according to the manufacturer's instructions. BSA was used to establish a protein concentration standard curve. Lysates were used immediately or stored at −80°C.

Western Blots

Samples to be analyzed were boiled in the appropriate volume of 4× sample buffer for 5 min and were resolved by 10% SDS-PAGE at 100 V per gel for approximately 1 hr. Samples were transferred onto PVDF membrane and blocked with 5% nonfat dry milk in TBS. The membrane was incubated overnight at 4°C with the appropriate primary antibody in 5% nonfat dry milk in TBS. The membrane was then incubated with the appropriate secondary HRP-conjugated antibody and visualized using ECL Western blotting detection reagents obtained from Amersham Pharmacia (Buckinghamshire, England, UK), or Supersignal detection reagents (Pierce) according to manufacturer's instructions. Blots were stripped and re-probed a maximum of 1× using Restore Western blot stripping buffer (Pierce). Images were obtained on a Bio-Rad Versadoc MP 5000 imager (Bio-Rad, Mississauga, ON, Canada) according to the manufacturer's instructions.

Antibodies

The following antibodies were used: anti-ILK (1:1,000 dilution), anti-E-cadherin (1:2,500 dilution), anti-Akt (1:1,000 dilution), anti-GSK3-β (1:1,000 dilution), anti-PARP-1 (1:1,000 dilution; all monoclonal antibodies from BD Biosciences, Mississauga, ON, Canada), monoclonal anti-β-actin (1:10,000 dilution; Sigma-Aldrich, Oakville, ON, Canada), polyclonal anti-lamin A/C (1:1,000 dilution; Cell Signaling Technologies, Danvers, MA), monoclonal anti-Snail (1:100 dilution; obtained as a gift from Dr. I. Virtanen), and polyclonal anti-Snail (1:1,000; Abcam Inc., Cambridge, MA).

siRNA Transfection

Transfections were conducted with Silentfect (Bio-Rad) in PC3 cells according to the manufacturer's directions. Briefly, cells were split into poly-L-lysine coated six-well cell culture plates and allowed to attach overnight. Poly-L-Lysine (Sigma-Aldrich) was diluted to 0.0001% w/v in PBS from a stock solution of 0.01% w/v, incubated on tissue culture plates for 1 hr at room temperature and washed with PBS. Transfection reagent and siRNA were combined in OptiMEM (Invitrogen), which was subsequently diluted with DMEM containing 10% FCS. Cells were incubated with transfection mixture overnight and refed with DMEM 10% containing FCS. Cells were split (typically into one 100 mm dish per well) 24 hr posttransfection and harvested 96 hr posttransfection.

siRNA Constructs

All siRNA constructs were purchased from Qiagen (Mississauga, ON, Canada) and reconstituted according to the manufacturer's instructions. Sequences used were as follows: ILK-A (AACCTGACGAAGCTCAACGAG), ILK-FSF (Troussard et al.,2003), ILK-H (Troussard et al.,2003), PARP-1 (Kameoka et al.,2004), AKT-1 (Katome et al.,2003), GSK3-β (Hsieh et al.,2004) and Snail (Olmeda et al.,2007). Control, nonsilencing siRNA (from Qiagen's database, 16-base overlap with Thermotoga maritima).

RNA Preparation

mRNA was prepared from cells using the Qiagen RNeasy mini-prep kit (Qiagen) according to the manufacturer's instructions. A DNase kit was used in conjunction with the mini-prep kit to ensure mRNA purity. cDNA was prepared from purified mRNA using Superscript II (Invitrogen). The 2 μg of mRNA was converted to cDNA using random hexamers as primers according to the manufacturer's instructions.

Quantitative Real-Time Polymerase Chain Reaction

Quantitative real-time polymerase chain reaction (qRT-PCR) was conducted using both intercalating dye-based (SYBR Green) as well as probe-based (Roche Universal Probe Library, UPL) (Roche Applied Science, Laval, Quebec, Canada) technologies on an Applied Biosystems (Foster City, CA) qRT-PCR instrument according to the manufacturer's instructions. Briefly, 1 μg of total RNA was used in a 40-μl reaction to make cDNA. Subsequently for the UPL system, 10 μl of qRT-PCR mixture containing 100 nM UPL probe, 200 nM of each primer and TaqMan PCR master mix (Applied Biosystems) was loaded into a 384-well plate. For the intercalating dye-based methodology, 1 μl cDNA was used per 25-μl reaction, which contained SYBR Green master mix and 0.5 μM of each primer. After a preliminary 95°C incubation the samples were read for 40 cycles (95°C : 30 sec, 60°C : 30 sec, 72°C : 60 sec). Samples were analyzed using Applied Biosystems analysis software to determine relative quantity. Control siRNA-treated cells were used as the reference. The values for mRNA expression were normalized using β-actin as the housekeeping gene. All qRT-PCR primers for the UPL system were designed using the Roche Applied Science online assay design centre. The primers used for the SYBR Green system were as follows: E-cadherin (Tang et al.,1994), Snail sense (5′-CCTCAAGATGCACATCCG-AAGCCA-3′) and antisense (5′-AGGAGAAGGGCTTCTCGCCAGTGT-3′), and β-actin (Patel et al.,2005). All primers were purchased from Invitrogen (Burlington, ON, Canada).

Resolution of Biotinylated Oligonucleotides

The single-stranded DNA oligonucleotides were purchased from Invitrogen. DNA oligonucleotides that corresponded to the SIRE sequence were designed with the 5′ end of the sense strand conjugated to a biotin molecule, allowing its immobilization on a streptavidin column. Complementary cDNA sequences were incubated together in Annealing Buffer at 90°C for 1 minute and allowed to cool to room temperature. The annealed oligonucleotides were then separated by 10% TBE-PAGE. Bands were visualized with ethidium bromide and ultraviolet light. The band corresponding to the dsDNA oligonucleotide was excised and resolubilized in ddH2O. Oligonucleotide concentration was quantified by spectrophotometry. The oligonucleotide probe was stored at −20°C.

Isolation of SIRE-Binding Proteins

Nuclear extracts were concentrated and dialyzed in binding buffer (20 mM HEPES-KOH pH 7.9, 100 mM KCl, 2.5 mM MgCl2, Glycerol 20%, 0.2 mM ethylenediaminetetraacetic acid [EDTA], 23 mM NaCl, 1% NP40, 1× Complete protease inhibitor cocktail [Santa Cruz Biotechnology, Santa Cruz, CA], 0.2 mM phenylmethyl sulfonyl fluoride [PMSF], 2 mM NaF, 50 mM β-glycerophosphate, and 1 mM Na3VO4) using a Millipore (England) 5 Da spin column. Concentrated nuclear extract was precleared with streptavidin-agarose (Sigma-Aldrich). Protein isolation was conducted with a μMACS streptavidin Kit (Miltenyl, Auburn, CA) in the presence of 50 μg/ml Poly(dI-dC) (Sigma-Aldrich) and sonicated with salmon sperm DNA (10 μl per ml of nuclear extract; Sigma-Aldrich), according to manufacturer's instructions. Binding proteins were eluted from the column with an increasing salt concentration (270 mM, 520 mM, 770 mM, and 1,020 mM). Proteins were resolved on 10% SDS-PAGE and visualized on the Typhoon Scanner (Amersham) using Sypro Ruby stain (Invitrogen) as per the manufacturer's instructions. Proteins with differential banding between the two experimental conditions were excised and identified by mass spectrometry.

Radioactive Labeling of DNA Probe

DNA probes were designed with a 5′ AAT overhang to allow for radioactive labeling. Single-stranded DNA sequences were purchased from Invitrogen. Complementary cDNA sequences were incubated together in Annealing Buffer at 90°C for 1 min and allowed to cool to room temperature. The 5′ overhang was end-filled by incubation with Klenow enzyme using dTTP and either dATP or 32P-dATP (Amersham, Piscataway, NJ). Specifically, oligonucleotide was incubated with an excess of dTTP and, dATP or 32Pa-dATP at 37°C for 2 hr. Unincorporated nucleic acids were removed using a G50 microspin column (Amersham) according to the manufacturer's instructions.

EMSA

EMSA were performed by incubating 10 μg of the nuclear extracts for 20 min at room temperature with a 32P-dATP end-labeled SIRE oligonucleotide. The reaction mixture was incubated in a binding buffer containing 20 mM Hepes–potassium hydroxide, pH 7.9, 2.5 mM MgCl2, 100 mM KCl, 0.2 mM EDTA, 1% NP40, 23 mM NaCl, 5% glycerol and 0.2 mM PMSF. Reaction products were analyzed on a nondenaturing 5% polyacrylamide gel (0.5% Tris-borate-EDTA, 2.5% glycerol). The specificity of the DNA–protein interaction was established by competition experiments using 100× cold competitor.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

We thank Dr. I. Virtanen for providing the Snail antibody. S.D. was funded by the Canadian Institutes of Health Research (CIHR), the National Cancer Institute of Canada (NCIC), with funds raised by the Canadian Cancer Society, and the Terry Fox Foundation Program Project in Prostate Cancer Progression.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  • Andreone TL, O'Connor M, Denenberg A, Hake PW, Zingarelli B. 2003. Poly(ADP-ribose) polymerase-1 regulates activation of activator protein-1 in murine fibroblasts. J Immunol 170: 21132120.
  • Andrews NC, Faller DV. 1991. A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res 19: 2499.
  • Batlle E, Sancho E, Franci C, Dominguez D, Monfar M, Baulida J, Garcia De Herreros A. 2000. The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol 2: 8489.
  • Bowen NJ, Fujita N, Kajita M, Wade PA. 2004. Mi-2/NuRD: multiple complexes for many purposes. Biochim Biophys Acta 1677: 5257.
  • Cano A, Perez-Moreno MA, Rodrigo I, Locascio A, Blanco MJ, del Barrio MG, Portillo F, Nieto MA. 2000. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol 2: 7683.
  • Carver EA, Jiang R, Lan Y, Oram KF, Gridley T. 2001. The mouse snail gene encodes a key regulator of the epithelial-mesenchymal transition. Mol Cell Biol 21: 81848188.
  • D'Amico M, Hulit J, Amanatullah DF, Zafonte BT, Albanese C, Bouzahzah B, Fu M, Augenlicht LH, Donehower LA, Takemaru K, Moon RT, Davis R, Lisanti MP, Shtutman M, Zhurinsky J, Ben-Ze'ev A, Troussard AA, Dedhar S, Pestell RG. 2000. The integrin-linked kinase regulates the cyclin D1 gene through glycogen synthase kinase 3beta and cAMP-responsive element-binding protein-dependent pathways. J Biol Chem 275: 3264932657.
  • De Craene B, Berx G. 2006. Snail in the frame of malignant tumor recurrence. Breast Cancer Res 8: 105.
  • Eberhart CG. 2003. Medulloblastoma in mice lacking p53 and PARP: all roads lead to Gli. Am J Pathol 162: 710.
  • Ewing CM, Ru N, Morton RA, Robinson JC, Wheelock MJ, Johnson KR, Barrett JC, Isaacs WB. 1995. Chromosome 5 suppresses tumorigenicity of PC3 prostate cancer cells: correlation with re-expression of alpha-catenin and restoration of E-cadherin function. Cancer Res 55: 48134817.
  • Fujita N, Jaye DL, Kajita M, Geigerman C, Moreno CS, Wade PA. 2003. MTA3, a Mi-2/NuRD complex subunit, regulates an invasive growth pathway in breast cancer. Cell 113: 207219.
  • Giroldi LA, Bringuier PP, de Weijert M, Jansen C, van Bokhoven A, Schalken JA. 1997. Role of E boxes in the repression of E-cadherin expression. Biochem Biophys Res Commun 241: 453458.
  • Guaita S, Puig I, Franci C, Garrido M, Dominguez D, Batlle E, Sancho E, Dedhar S, De Herreros AG, Baulida J. 2002. Snail induction of epithelial to mesenchymal transition in tumor cells is accompanied by MUC1 repression and ZEB1 expression. J Biol Chem 277: 3920939216.
  • Hannigan G, Troussard AA, Dedhar S. 2005. Integrin-linked kinase: a cancer therapeutic target unique among its ILK. Nat Rev Cancer 5: 5163.
  • Hennig G, Lowrick O, Birchmeier W, Behrens J. 1996. Mechanisms identified in the transcriptional control of epithelial gene expression. J Biol Chem 271: 595602.
  • Hsieh AC, Bo R, Manola J, Vazquez F, Bare O, Khvorova A, Scaringe S, Sellers WR. 2004. A library of siRNA duplexes targeting the phosphoinositide 3-kinase pathway: determinants of gene silencing for use in cell-based screens. Nucleic Acids Res 32: 893901.
  • Idogawa M, Yamada T, Honda K, Sato S, Imai K, Hirohashi S. 2005. Poly(ADP-ribose) polymerase-1 is a component of the oncogenic T-cell factor-4/beta-catenin complex. Gastroenterology 128: 19191936.
  • Ishihara K, Oshimura M, Nakao M. 2006. CTCF-dependent chromatin insulator is linked to epigenetic remodeling. Mol Cell 23: 733742.
  • Iwano M, Plieth D, Danoff TM, Xue C, Okada H, Neilson EG. 2002. Evidence that fibroblasts derive from epithelium during tissue fibrosis. J Clin Invest 110: 341350.
  • Ji X, Woodard AS, Rimm DL, Fearon ER. 1997. Transcriptional defects underlie loss of E-cadherin expression in breast cancer. Cell Growth Differ 8: 773778.
  • Ju BG, Solum D, Song EJ, Lee KJ, Rose DW, Glass CK, Rosenfeld MG. 2004. Activating the PARP-1 sensor component of the groucho/ TLE1 corepressor complex mediates a CaMKinase IIdelta-dependent neurogenic gene activation pathway. Cell 119: 815829.
  • Kameoka M, Nukuzuma S, Itaya A, Tanaka Y, Ota K, Ikuta K, Yoshihara K. 2004. RNA interference directed against Poly(ADP-Ribose) polymerase 1 efficiently suppresses human immunodeficiency virus type 1 replication in human cells. J Virol 78: 89318934.
  • Kannan P, Yu Y, Wankhade S, Tainsky MA. 1999. PolyADP-ribose polymerase is a coactivator for AP-2-mediated transcriptional activation. Nucleic Acids Res 27: 866874.
  • Katome T, Obata T, Matsushima R, Masuyama N, Cantley LC, Gotoh Y, Kishi K, Shiota H, Ebina Y. 2003. Use of RNA interference-mediated gene silencing and adenoviral overexpression to elucidate the roles of AKT/protein kinase B isoforms in insulin actions. J Biol Chem 278: 2831228323.
  • Le Page C, Sanceau J, Drapier JC, Wietzerbin J. 1998. Inhibitors of ADP-ribosylation impair inducible nitric oxide synthase gene transcription through inhibition of NF kappa B activation. Biochem Biophys Res Commun 243: 451457.
  • Legate KR, Montanez E, Kudlacek O, Fassler R. 2006. ILK, PINCH and parvin: the tIPP of integrin signalling. Nat Rev Mol Cell Biol 7: 2031.
  • Li X, Deng W, Nail CD, Bailey SK, Kraus MH, Ruppert JM, Lobo-Ruppert SM. 2006. Snail induction is an early response to Gli1 that determines the efficiency of epithelial transformation. Oncogene 25: 609621.
  • McDonald PC, Fielding AB, Dedhar S. 2008. Essential roles of integrin-linked kinase in physiology and cancer biology. J Cell Sci (in press).
  • Miyamoto T, Kakizawa T, Hashizume K. 1999. Inhibition of nuclear receptor signalling by poly(ADP-ribose) polymerase. Mol Cell Biol 19: 26442649.
  • Moody SE, Perez D, Pan TC, Sarkisian CJ, Portocarrero CP, Sterner CJ, Notorfrancesco KL, Cardiff RD, Chodosh LA. 2005. The transcriptional repressor Snail promotes mammary tumor recurrence. Cancer Cell 8: 197209.
  • Nieto MA. 2002. The snail superfamily of zinc-finger transcription factors. Nat Rev Mol Cell Biol 3: 155166.
  • Novak A, Hsu SC, Leung-Hagesteijn C, Radeva G, Papkoff J, Montesano R, Roskelley C, Grosschedl R, Dedhar S. 1998. Cell adhesion and the integrin-linked kinase regulate the LEF-1 and beta-catenin signaling pathways. Proc Natl Acad Sci U S A 95: 43744379.
  • Oloumi A, Syam S, Dedhar S. 2006. Modulation of Wnt3a-mediated nuclear beta-catenin accumulation and activation by integrin-linked kinase in mammalian cells. Oncogene 25: 77477757.
  • Olmeda D, Jorda M, Peinado H, Fabra A, Cano A. 2007. Snail silencing effectively suppresses tumour growth and invasiveness. Oncogene 26: 18621874.
  • Patel GP, Ma S, Bag J. 2005. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res 33: 70747089.
  • Pavri R, Lewis B, Kim TK, Dilworth FJ, Erdjument-Bromage H, Tempst P, de Murcia G, Evans R, Chambon P, Reinberg D. 2005. PARP-1 determines specificity in a retinoid signaling pathway via direct modulation of mediator. Mol Cell 18: 8396.
  • Peiro S, Escriva M, Puig I, Barbera MJ, Dave N, Herranz N, Larriba MJ, Takkunen M, Franci C, Munoz A, Virtanen I, Baulida J, Garcia de Herreros A. 2006. Snail1 transcriptional repressor binds to its own promoter and controls its expression. Nucleic Acids Res 34: 20772084.
  • Perez-Mancera PA, Perez-Caro M, Gonzalez-Herrero I, Flores T, Orfao A, de Herreros AG, Gutierrez-Adan A, Pintado B, Sagrera A, Sanchez-Martin M, Sanchez-Garcia I. 2005. Cancer development induced by graded expression of Snail in mice. Hum Mol Genet 14: 34493461.
  • Persad S, Attwell S, Gray V, Delcommenne M, Troussard A, Sanghera J, Dedhar S. 2000. Inhibition of integrin-linked kinase (ILK) suppresses activation of protein kinase B/Akt and induces cell cycle arrest and apoptosis of PTEN-mutant prostate cancer cells. Proc Natl Acad Sci U S A 97: 32073212.
  • Persad S, Troussard AA, McPhee TR, Mulholland DJ, Dedhar S. 2001. Tumor suppressor PTEN inhibits nuclear accumulation of beta-catenin and T cell/lymphoid enhancer factor 1-mediated transcriptional activation. J Cell Biol 153: 11611174.
  • Roloff TC, Ropers HH, Nuber UA. 2003. Comparative study of methyl-CpG-binding domain proteins. BMC Genomics 4: 1.
  • Rosano L, Spinella F, Di Castro V, Nicotra MR, Dedhar S, de Herreros AG, Natali PG, Bagnato A. 2005. Endothelin-1 promotes epithelial-to-mesenchymal transition in human ovarian cancer cells. Cancer Res 65: 1164911657.
  • Savagner P. 2001. Leaving the neighborhood: molecular mechanisms involved during epithelial-mesenchymal transition. Bioessays 23: 912923.
  • Sefton M, Sanchez S, Nieto MA. 1998. Conserved and divergent roles for members of the Snail family of transcription factors in the chick and mouse embryo. Development 125: 31113121.
  • Simpson L, Parsons R. 2001. PTEN: life as a tumor suppressor. Exp Cell Res 264: 2941.
  • Somasiri A, Howarth A, Goswami D, Dedhar S, Roskelley CD. 2001. Overexpression of the integrin-linked kinase mesenchymally transforms mammary epithelial cells. J Cell Sci 114: 11251136.
  • Tan C, Costello P, Sanghera J, Dominguez D, Baulida J, de Herreros AG, Dedhar S. 2001. Inhibition of integrin linked kinase (ILK) suppresses beta-catenin-Lef/Tcf-dependent transcription and expression of the E-cadherin repressor, snail, in APC-/-human colon carcinoma cells. Oncogene 20: 133140.
  • Tan C, Cruet-Hennequart S, Troussard A, Fazli L, Costello P, Sutton K, Wheeler J, Gleave M, Sanghera J, Dedhar S. 2004. Regulation of tumor angiogenesis by integrin-linked kinase (ILK). Cancer Cell 5: 7990.
  • Tang A, Eller MS, Hara M, Yaar M, Hirohashi S, Gilchrest BA. 1994. E-cadherin is the major mediator of human melanocyte adhesion to keratinocytes in vitro. J Cell Sci 107(Pt 4): 983992.
  • Thiery JP. 2002. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer 2: 442454.
  • Torrano V, Navascues J, Docquier F, Zhang R, Burke LJ, Chernukhin I, Farrar D, Leon J, Berciano MT, Renkawitz R, Klenova E, Lafarga M, Delgado MD. 2006. Targeting of CTCF to the nucleolus inhibits nucleolar transcription through a poly(ADP-ribosyl)ation-dependent mechanism. J Cell Sci 119: 17461759.
  • Troussard AA, Tan C, Yoganathan TN, Dedhar S. 1999. Cell-extracellular matrix interactions stimulate the AP-1 transcription factor in an integrin-linked kinase- and glycogen synthase kinase 3-dependent manner. Mol Cell Biol 19: 74207427.
  • Troussard AA, Costello P, Yoganathan TN, Kumagai S, Roskelley CD, Dedhar S. 2000. The integrin linked kinase (ILK) induces an invasive phenotype via AP-1 transcription factor-dependent upregulation of matrix metalloproteinase 9 (MMP-9). Oncogene 19: 54445452.
  • Troussard AA, Mawji NM, Ong C, Mui A, St -Arnaud R, Dedhar S. 2003. Conditional knock-out of integrin-linked kinase demonstrates an essential role in protein kinase B/Akt activation. J Biol Chem 278: 2237422378.
  • Umbas R, Isaacs WB, Bringuier PP, Schaafsma HE, Karthaus HF, Oosterhof GO, Debruyne FM, Schalken JA. 1994. Decreased E-cadherin expression is associated with poor prognosis in patients with prostate cancer. Cancer Res 54: 39293933.
  • Weigelt B, Peterse JL, van't Veer LJ. 2005. Breast cancer metastasis: markers and models. Nat Rev Cancer 5: 591602.
  • Yu W, Ginjala V, Pant V, Chernukhin I, Whitehead J, Docquier F, Farrar D, Tavoosidana G, Mukhopadhyay R, Kanduri C, Oshimura M, Feinberg AP, Lobanenkov V, Klenova E, Ohlsson R. 2004. Poly(ADP-ribosyl)ation regulates CTCF-dependent chromatin insulation. Nat Genet 36: 11051110.