SEARCH

SEARCH BY CITATION

Keywords:

  • non-coding RNA;
  • micro RNA;
  • skeletal development

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Dnm3os, a gene that is transcribed into a non-coding RNA (ncRNA), contains three micro RNAs (miRNAs), miR-199a, miR-199a*, and miR-214, whose functions remain unknown in mammals. In this study, we introduced the lacZ gene into the Dnm3os locus to recapitulate its expression pattern and disrupt its function. Dnm3os+/lacZ heterozygous embryos showed β-galactosidase activity, which reflected the authentic expression pattern of Dnm3os RNA. Most of the Dnm3oslacZ/lacZ homozygous pups died within one month of birth. After birth, Dnm3oslacZ/lacZ mice exhibited several skeletal abnormalities, including craniofacial hypoplasia, defects in dorsal neural arches and spinous processes of the vertebrae, and osteopenia. Importantly, the expression of miR-199a, miR-199a*, and miR-214 was significantly down-regulated in Dnm3oslacZ/lacZ embryos, supporting the assumption that Dnm3os serves as a precursor of these three miRNAs. Thus, Dnm3os has emerged as an miRNA-encoding gene that is indispensable for normal skeletal development and body growth in mammals. Developmental Dynamics 237:3738–3748, 2008. © 2008 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Analysis of the genomes of several higher eukaryotic organisms, including mice and humans, has reached the striking conclusion that the mammalian transcriptome is constituted in large part of non-protein coding transcripts. For instance, recent studies by the FANTOM3 consortium revealed that the number of transcripts far exceeds the number of protein-coding genes and recognized the contribution of a significant number of non-coding RNAs (ncRNAs), including antisense transcripts (Carninci et al.,2005; Katayama et al.,2005). Another analysis by Cheng et al. (2005b) showed that up to 99% of the human genome consists of non-coding genomic regions that are still to be explored. The ncRNAs consist of housekeeping RNAs, ribosomal RNAs, transfer RNAs, small nuclear RNAs, small nucleolar RNAs, and regulatory RNAs that have recently received attention. Now, a growing number of studies have reported the involvement of regulatory RNAs in a large variety of processes including genomic imprinting (Sleutels et al.,2002), X-chromosome inactivation (Lanz et al.,1999; Chureau et al.,2002), and eukaryotic mRNA transcription (Lanz et al.,1999; Willingham et al.,2005). Micro RNAs (miRNAs) are small single-stranded ∼22-nucleotide-long RNAs that are also regulatory ncRNAs. Recently, over 200 miRNAs in mice and humans have been registered and have been found to regulate a variety of physiological functions including development, hematopoiesis, cellular proliferation, and apoptosis (Rana,2007), and pathological conditions including oncogenesis (Zhang et al.,2007).

Dmn3os is a 7.9-kb antisense transcript, located within the 14th intron of the mouse dynamin-3(Dnm3) gene (Loebel et al.,2005). Although the mouse Dmn3os gene (GenBank: AB159607) has a potential open reading frame, a comparison of the sequences found in several higher vertebrates revealed that the predicted start site ATG of the mouse Dmn3os gene was not conserved in the human or chicken sequences despite the overall sequence conservation especially in the region of the 5′ end of the transcript. Therefore, Dnm3os is considered to be an ncRNA. Dnm3os RNA is expressed in the nasal process, pharyngeal arches, limb buds, and somites in a stage-dependent manner during development; however, the function of Dnm3os remains unknown.

To examine the function of Dnm3os in vivo, we generated Dnm3os mutant mice in which the 5′-region of Dnm3os was replaced with the lacZ gene. Homozygous mutant mice (Dnm3oslacZ/lacZ) were characterized by growth retardation, skeletal deformity including the absence of spinous processes, shortness of the dorsal part of neural arches in the cervical and thoracic vertebrae, and osteopenia in vertebrae and long bones. Bite overclosure was detected in some Dnm3oslacZ/lacZ pups. Moreover, it was suggested that Dnm3os serves as a precursor of three miRNAs that are located in the Dnm3os locus during mouse development. These data suggest that Dnm3os, an ncRNA, is indispensable for skeletal formation and body growth during embryonic development.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Generation of Dnm3os-lacZ Knock-in Mice

The Dnm3os gene lies in the 100-kbp 14th intron of the Dnm3 gene in an antisense orientation on chromosome 1. To knock-down Dnm3os, we replaced the 5′ 2.1-kbp portion of the gene just after the transcription start site with an nls-lacZ/PGKneo cassette, since Dnm3os is a single exon gene (Fig. 1A). Of the 330 ES cell clones screened, six clones were positive for the mutant Dnm3oslacZ allele. All six clones were injected into C57BL/6J blastocysts, and two of them gave rise to male germline chimeras, which were subsequently bred with ICR females to produce Dnm3os+/lacZ hemizygous mice. The hemizygous mice appeared normal and were fertile. Offspring from Dnm3os+/lacZ intercrosses were genotyped by Southern analysis of tail genomic DNA (Fig. 1B). The absence of Dnm3os transcripts in Dnm3oslacZ/lacZ mice was confirmed by Northern blotting (Fig. 1C). Since the Dnm3os locus has three miRNAs: miR-199a, miR-199a*, and miR-214 (Fig. 1A), we checked the expression of these three miRNAs. Consequently, it was shown that the expression of miR-199a and miR-199a* was down-regulated and that of miR-214 was not detected in the Dnm3oslacZ/lacZ mice (Fig. 1D).

thumbnail image

Figure 1. Gene targeting strategy of Dnm3os locus. A: Schematic representation of the Dnm3 and the corresponding Dnm3os locus, the gene targeting vector, and recombination at the Dnm3os locus. Vertical black bars represent exons of the Dnm3 gene. The Dnm3os gene is located in the complementary strand of the intron of Dnm3 as a single exon. The transcriptional start site of Dnm3os (arrow) and the location of three micro RNAs (asterisks) are indicated, respectively. Homologous recombination using the gene targeting vector carrying nls-lacZ, neomycin (neo), and TK genes yielded the targeted allele as shown. B: Southern blot analysis of DNA obtained from the mouse tail. The 17.6-kb XmnI fragment and the 4.3-kb SpeI fragment indicate successful 5′ and 3′ targeting of the Dnm3os locus. C: Northern blot analysis of total RNA from an E10.5 embryo hybridized with a Dnm3os probe (top). Ethidium bromide staining of 18S rRNA served as loading controls (bottom). The 7.9-kb Dnm3os transcript is not detected in homozygous animals. D: The miR-199a, miR-199a*, and miR-214 from homozygote, heterozygote, and wild-type littermates at E11.5 were probed with 32P-ATP-labeled antisense oligonucleotides corresponding to the sequence of each miRNA (top). Ethidium bromide staining of tRNAs served as loading controls (bottom).

Download figure to PowerPoint

To ascertain whether Dnm3os-directed lacZ expression reflects the pattern of authentic Dnm3os expression, we incubated Dnm3os+/lacZ embryos with X-gal. At E9.5, βgalactosidase (β-gal) activity was clearly detected in the pharyngeal arches and limb buds (data not shown). E10.5, hemizygous embryos showed intense β-gal activity in the pharyngeal arches, limb buds, nasal process, and somites (Fig. 2A), which was similar to authentic Dnm3os expression in wild-type embryos (Fig. 2B). A series of whole mount in situ hybridization (WISH) showed that authentic Dnm3os expression was weakly detected in head and pharyngeal regions in E9.0 mouse embryos, and then became clear in pharyngeal arch and limb buds in E9.5 mouse embryos (Fig. 2C) as previously reported (Loebel et al.,2005). Homogenous β-gal activity was observed in the pharyngeal arches, except in the endoderm and outermost layer. In dorsal portions of the E11.5 embryos, the surrounding mesenchymal cells were diffusely β-gal positive, in sharp contrast to neural tube and dorsal ganglion, which lacked β-gal activity (Fig. 2E). Thereafter, the expression expanded to regions including most of the surface of the body, the upper and lower extremities, the upper and lower jaw, the ears, and the tail at E13.5 (Fig. 2D). Taken together, the lacZ gene of Dnm3os+/lacZ embryos seemed to be mostly expressed in mesenchymal cells and was consistent with that of authentic Dnm3os RNA expression, as revealed by whole mount in situ hybridization.

thumbnail image

Figure 2. β-Gal expression in Dnm3os+/lacZ mouse embryos. A: β-Gal expression was detected in pharyngeal arches and limb buds at E10.5. B: Wild-type E10.5 embryo was hybridized with anti-sense Dnm3os probe to show the authentic Dnm3os RNA expression. C: Whole mount in situ hybridization of embryos by Dnm3os gene. E8.5, E9.0, E9.5, and E10.5 normal mouse embryos were hybridized with anti-sense Dnm3os probe. D: β-Gal expression was detected in ears, nasal process, and extremities at E13.5. EK: X-gal stained sections of E11.5 (E), E15.5 (F–J) and E17.5 (K) Dnm3os+/lacZ embryos. Neural tube and dorsal ganglion were surrounded by mesenchymal cells, which were β-gal-positive, in dorsal portions of the E11.5 embryos (E). Perichondrial cells in thoracic vertebrae (F), humerus (G) and rib (K), surrounding striated muscles, tracheal cartilages (H), and dermis (I) showed β-gal expression. β-Gal expression was detected in cardiac valves, pulmonary artery, aorta, and compact myocardium (J). Scale bars = 100 μm in F, H, and J; 200 μm in G, I, and K. dg, dorsal root ganglion; dm, dermomyotome; dr, dermis; epi, epidermis; eso, esophagus; hum, humerus; mus, muscle; nt, neural tube; pa, pulmonary artery; ra, right atrium; rib, costal bone; rv, right ventricle; tra, trachea.

Download figure to PowerPoint

The Expression Pattern of the lacZ Transgene at a Later Embryonic Stage

To explore the expression pattern of the Dnm3os gene at a later embryonic stage, when mesenchymal cells begin to integrate into diverse organs, we further incubated the sections from Dnm3os+/lacZ embryos at E15.5 or later with X-gal. With regard to skeletal formation, β-gal activity was observed in perichondrial cells and periarticular chondrocytes (Fig. 2F,G,K). Tracheal cartilage and bronchi also had intense β-gal activity (Fig. 2H). Although β-gal-positive cells were absent in the epithelial dermomyotomes at E11.5, all striated muscles (Fig. 2F,G,K) and smooth muscle of the great arteries were β-gal positive at E15.5. β-Gal activity was observed in the dermis, but not in the epidermis in the skin (Fig. 2I). Most tissues in the upper and lower jaw including the tongue were β-gal positive, whereas the epidermis and epithelium of glands were β-gal negative (data not shown). With respect to heart development, the cardiac cushions of both the atrio-ventricular canal and outflow tract contained β-gal-positive cells at E11.5. As development proceeded to E15.5, all cardiac valves became strongly β-gal positive, and some positive cells were observed sparsely in the compact layer of the myocardium but not in the trabecular layer (Fig. 2J).

Impairment of Postnatal Viability and Growth in Dnm3lacZ/lacZ Mice

Genotyping of the 160 live offspring from Dnm3os+/lacZ intercrosses at weaning identified 51 wild-type (32%), 95 heterozygous (59%), and 14 homozygous (9%) mice indicating that Dnm3oslacZ/lacZ mice comprised far less than one-fourth of the live pups at P30 (Table 1). At E18.5 and P0-1, the distribution of genotypes was close to 1:2:1, the Mendelian ratio (Table 1), suggesting that Dnm3oslacZ/lacZ embryos survived parturition. The body weight of Dnm3oslacZ/lacZ mice was less than that of wild-type mice just before birth; however, the milk spot in the homozygote was not smaller when compared with heterozygous or wild-type animals at P0 and P1 (data not shown). Along with the decreased neonatal viability, the body weight gain of Dnm3oslacZ/lacZ mice during the neonatal period was less than that of wild-type animals (Fig. 3). Dnm3oslacZ/lacZ mice that showed bite overclosure did not survive weaning (Fig. 4D). Since dead pups did not always have this phenotype, we postulated that Dnm3oslacZ/lacZ mice might be susceptible to competition for survival at the early postnatal stage. To test this possibility, a population of large pups was removed from the cage at P7, and food was put directly into the cage until weaning in some breeding cages. Intriguingly, in these cases where special care was given, more Dnm3oslacZ/lacZ pups survived until weaning (data not shown). Although the overall cause of death of Dnm3oslacZ/lacZ mice remains unclear, vulnerability to competition might partly contribute to the postnatal deaths of Dnm3oslacZ/lacZ mice. It is unknown whether cardiac abnormalities including valvular defects might be involved in the postnatal deaths of some mutant mice.

Table 1. Genotypic Analysis of Mice From Intercrossesa
MatingAgeNumber of mice with genotype:
+/++/−−/−
  • a

    +/+, wild type; +/−, heterozygote; −/−, homozygote.

+/−♀ vs +/−♂E18.55103014
 P0-17178
 P78276
 P30519514
thumbnail image

Figure 3. Decreased body weight gain of Dnm3oslacZ/lacZ mice. Body weight was measured at intervals from E18.5 to the age of 5 months. The number of mice examined at each interval is shown in brackets. Bars represent mean values with standard deviation. *P < 0.05 vs. homozygotes. **P < 0.01 vs homozygotes.

Download figure to PowerPoint

thumbnail image

Figure 4. Skeletal and craniofacial deformity in Dnm3oslacZ/lacZ mice. A,B: Alcian blue (cartilage) and alizarin red (bone) staining of the whole skeleton. A straight back was observed in E18.0 homozygous pups (−/−), which were slightly shorter than their wild-type littermates (+/+) (A). Dnm3oslacZ/lacZ mice (−/−) were also shorter than their wild-type littermates (+/+) at P14. A shortened head was also evident in Dnm3oslacZ/lacZ mice from this age (B). C: Skull X-rays at P60. The skull of Dnm3oslacZ/lacZ mice (−/−) demonstrates shortening of the sagittal axis. D: Some Dnm3oslacZ/lacZ mice that showed bite overclosure died within one month after birth.

Download figure to PowerPoint

Although Dnm3os is abundantly expressed in the gravid uterus, there were some female homozygotes that delivered normally. Male homozygotes were also fertile.

Skeletal Defects in Dnm3lacZ/lacZ Mice

To further investigate the abnormalities related to growth retardation, we performed skeletal examinations on Dnm3oslacZ/lacZ mice. All the examined Dnm3oslacZ/lacZ mice showed short stature, cranial deformity, hypoplasia of dorsal vertebrae, and osteopenia. Firstly, the Dnm3oslacZ/lacZ neonates were slightly shorter than their wild-type littermates from just before birth (Fig. 4A). Secondly, Dnm3oslacZ/lacZ mice became easily identifiable by a shortening of the naso-occipital length of the calvarium that was evident at P14 by visual inspection as well as in skeletal measurements (Fig. 4B). The decreased ratio of the naso-occipital length to interparietal distance revealed in skull X-rays suggested impaired endochondral ossification in Dnm3oslacZ/lacZ adult mice (Fig. 4C). Thirdly, with respect to the phenotypes of dorsal vertebrae, impaired ossification and elongation of cervical and thoracic vertebral arches were evident at E18, which subsequently led to defects in midline fusion of most neural arches of cervical vertebrae later in Dnm3oslacZ/lacZ mice at P14 (Fig. 5B). Adult Dnm3oslacZ/lacZ mice showed the loss of spinous processes in thoracic vertebrae (data not shown).

thumbnail image

Figure 5. Defects in the dorsal part of vertebrae. AD: Dorsal views (A, B) and lateral views (C, D) of skeletal preparations of cervical vertebrae from P14 mice. Samples were prepared from wild-type (A, C), and Dnm3oslacZ/lacZ (B, D) mice. Vertebral arches (yellow arrowheads in B) are not fused in Dnm3oslacZ/lacZ mice. at, atlas; ax, axis.

Download figure to PowerPoint

To evaluate bone mineral density, we performed X-rays of the femurs of P60 Dnm3oslacZ/lacZ mice. The distal femurs of Dnm3oslacZ/lacZ mice were more lucent compared with those of their wild-type littermates (Fig. 6A), indicating that the bone mineral density of Dnm3oslacZ/lacZ mice was decreased. To further analyze the structural changes in Dnm3oslacZ/lacZ mice, we performed μCT scanner analysis. The images of the distal femur provided by μCT revealed that the severe osteopenia observed in the femur of Dnm3oslacZ/lacZ mice was mainly due to the loss of trabecular bone (Fig. 6A). Histological analysis also confirmed that mineralization of the vertebral body of thoracic vertebrae was markedly reduced in P150 Dnm3oslacZ/lacZ mice (Fig. 6B,C). The delayed formation of ossification centers in vertebral bodies, which could already be observed during the late embryonic stage, might be associated with these abnormalities.

thumbnail image

Figure 6. Decreased bone mineral density in Dnm3oslacZ/lacZ mice. A: X-rays and μCT of the femur at P60. Three-dimensional CT images of the distal femur 0.5 mm proximal to the growth plate (dotted line in top panel) of wild-type and Dnm3oslacZ/lacZ mice are shown in the bottom panel. B, C: Histological examination of the thoracic vertebrae of wild-type (B) and Dnm3oslacZ/lacZ (C) mice at P150. Yellow arrowheads in C indicate reduced mineralization of the thoracic vertebral body. Scale bars = 100 μm. bm: bone marrow, min: bone mineralization, sc: spinal cord, tb: trabecular bone.

Download figure to PowerPoint

In addition to the above abnormalities, a small number of Dnm3oslacZ/lacZ mice exhibited signs of partial paralysis including an unsteady gait particularly involving the hindlimbs, although it remains to be determined whether the involved mechanism was derived from neurogenic or myogenic factors.

Soft Tissue Defects in Dnm3lacZ/lacZ Mice

As expression of the Dnm3os gene was observed in mesoderm-derived cells during embryonic development, we also examined mesoderm-derived tissues such as adipose tissue and muscle histologically. As regards adipose tissue, Dnm3os RNA is normally expressed in epididymal fat pads, but not in brown fat pads. Epididymal fat pads in Dnm3oslacZ/lacZ mice were smaller than those in wild-type mice (Fig. 7A), although adipocytes in brown fat pads in Dnm3oslacZ/lacZ mice were comparable in size to those in wild-type mice (data not shown). The muscle bundle of the back at the cervical level in Dnm3oslacZ/lacZ mice was also smaller than that in wild-type mice (Fig. 7B,C). Therefore, expression of the Dnm3os gene might play some role in the formation of adipose tissue and myogenesis.

thumbnail image

Figure 7. Smaller size of epididymal fat pads and muscles of the back. A: Epididymal fat pads from P60 Dnm3oslacZ/lacZ mice (−/−) and wild-type littermates (+/+). B, bladder; E, epididymis; F, fat pad; T, testis. B, C: Neck muscles in wild-type littermates (B) and Dnm3oslacZ/lacZ mice (C) at E18.5. In Dnm3oslacZ/lacZ mice, the muscles (mus; circled by dotted lines) and the vertebral arches (th) were hypoplastic (C). Scale bars = 100 μm.

Download figure to PowerPoint

Dnm3 Expression in Dnm3oslacZ/lacZ Mice

We analyzed Dnm3 expression in Dnm3oslacZ/lacZ mice, since Dnm3os lies in the 14th intron of the Dnm3 gene locus. During embryonic development, Dnm3 mRNA was barely detectable by PCR at E11.5. On the other hand, Dnm3os mRNA expression was most intense in pharyngeal arches and limb buds from E10.5 through E11.5 and gradually decreased thereafter during embryonic development (Loebel et al.,2005). The determination of the quantity by real-time PCR showed that Dnm3 mRNA was expressed in the homozygous embryos at a level comparable to that of their wild-type littermates at E11.5 and E15.5 (Fig. 8A). On the other hand, Western blotting showed that Dnm3 protein was strongly expressed in the brain and testis in adult mice, while the level of expression in the adult liver was much lower, as previously reported (Fig. 8B) (Loebel et al.,2005). The levels of Dnm3 mRNA expression in embryos at E15.5 or younger were at low levels, similar to its expression level in the adult liver (data not shown). Since a significant difference in the expression level was not detected between Dnm3oslacZ/lacZ mice and the wild-type mice, it is unlikely that Dnm3 expression was significantly affected by the loss of Dnm3os expression in Dnm3oslacZ/lacZ mice.

thumbnail image

Figure 8. The expression of Dnm3 RNA and Dnm3 protein in Dnm3oslacZ/lacZ mice. A: Total RNA was obtained from E11.5 whole embryos of wild-type (+/+, n = 3), Dnm3os+/lacZ (+/−, n = 5), and Dnm3oslacZ/lacZ (−/−, n = 3) mice, or E15.5 whole embryos of wild-type (+/+, n = 3) and Dnm3oslacZ/lacZ (−/−, n = 3) mice and was reverse-transcribed into cDNA and then subjected to real-time PCR using specific primers for Dnm3 and Dnm3os, respectively. The starting quantities were calculated and expressed as a ratio of each gene to that of Gapd. Values are shown as mean ± SD. B: Western blotting of the liver, testis, heart, and brain of adult Dnm3oslacZ/lacZ (−/−) and wild-type (+/+) mice by anti-Dnm3 antibody. Dnm3 protein is expressed abundantly in brain and testis, less abundantly in heart, but not in liver in Dnm3oslacZ/lacZ as well as wild-type adult mice.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

The ncRNA Dnm3os Is Required for Normal Skeletal Development

Recent novel approaches have identified more and more ncRNAs and their diverse functions (Goodrich and Kugel,2006; Morey and Avner,2004). In this study, we generated a mouse line in which Dnm3os, one of the ncRNAs, was knocked out, and have demonstrated that Dnm3os is indispensable for normal skeletal development. Most Dnm3oslacZ/lacZ mice died postnatally, possibly due to feeding problems. Growth retardation observed in Dnm3oslacZ/lacZ mice was not solely due to a problem of nourishment since E18.5 Dnm3oslacZ/lacZ mice were shorter than their wild-type littermates and showed hypoplastic dorsal neural arches of the cervical vertebrae.

Skeletal Defects in Dnm3os-Deficient Mice

Dnm3oslacZ/lacZ mice demonstrated a shortened head, bite overclosure, neural arch and spinous process defects, and osteopenia in addition to growth retardation. To our knowledge, a single mutation that shows all of these defects has not yet been reported, although each defect has been observed in several other mouse models separately. For example, bite overclosure together with growth retardation, skeletal dysplasia, joint contractures, and osteoporosis have been reported in diastrophic dysplasia sulfate transporter (SLC26A2) mutant mice (Forlino et al.,2005). These skeletal phenotypes that resemble those of Dnm3oslacZ/lacZ mice were derived from reduced cartilage formation and delayed the formation of secondary ossification centers mainly due to the impairment of inorganic sulfate uptake in chondrocytes (Forlino et al.,2005). However, an irregular and partially disrupted growth plate at P60, which is the most striking finding of SLC26A2 mutant mice, was not observed in Dnm3os mutant mice. Similarly, the hypoplastic dorsal vertebral arches observed in Dnm3os mutant mice were not reported in SLC26A2 mutant mice. The defects in spinous processes and dorsal neural arches in the cervical and thoracic vertebrae are observed in the mice with severe loss of BMP4 activity (Goldman et al.,2006) and also the mice with loss of the twisted gastrulation gene, which produces a small secreted protein associated with the BMP signaling pathway (Petryk et al.,2004) as well as Dnm3os mutant mice. However, bone mineralization of the vertebral body in mice lacking the twisted gastrulation gene was comparable to that in wild-type mice (Petryk et al.,2004). Small mandible and maxillary components and osteopenia in vertebrae and long bones were reported separately in many other mouse models. Diverse mutations affecting both craniofacial and limb development have also been reported (O'Rourke and Tam,2002). Therefore, it is important to note that impaired gene regulation in Dnm3oslacZ/lacZ mice might not be restricted to dorsal sclerotomes or neural arches, but might also extend to the broader network controlling skeletal development.

Dnm3os Is a Precursor of Three miRNAs

Three miRNAs, miR-199a, miR-199a*, and miR-214, are located in the Dnm3os transcribed locus. The counterparts of miR-199a and miR-199a* are located with an antisense orientation to Dnm2 in the 16th intron of Dnm2 on chromosome 9, in addition to the Dnm3os locus. The detectable level of expression of miR-199a and miR-199a* might be derived from these identical sequences located on chromosome 9. Our data showed that all of these were expressed during normal embryonic development. Most importantly, the expression of miR-214, whose locus was preserved in our construct, decreased to an undetectable level in Dnm3oslacZ/lacZ, suggesting that miR-214 was indeed produced from Dnm3os RNA. Therefore, our results are consistent with the view that Dnm3os gene is a primary miRNA (pri-miRNA) that is processed by Drosha and subsequently by Dicer to generate miRNAs (Fukuda et al.,2007).

There have been several reports concerning the expression pattern and levels of these three miRNAs (Babak et al.,2004; Cheng et al.,2007; Houbaviy et al.,2003; van Rooij et al.,2006; Wienholds et al.,2005; Yi et al.,2006). miR199a was expressed in undifferentiated embryonic stem cells but not in differentiated cells (Houbaviy et al.,2003). In mouse skin, all three miRNAs were expressed in hair follicles but not in the epidermis (Yi et al.,2006), which was consistent with our finding that Dnm3os was expressed in the dermis but not in the epidermis (Fig. 2J). In adult mouse hearts, all three miRNAs were induced after a hypertrophic response (Cheng et al.,2007; van Rooij et al.,2006). It would be intriguing to address whether the expression of Dnm3os observed in the compact layer of the myocardium at E15.5 was localized in cardiomyocytes or other cell types such as cardiac fibroblasts. In an in vitro functional study, miR-214 was implicated in apoptosis in HeLa cells (Cheng et al.,2005a). Most recently, zebrafish miR-214 was found to specify muscle cell types through direct inhibition of Su(fu) mRNA, which encodes a negative regulator of Hedgehog signaling (Flynt et al.,2007). Since the muscle bundle of Dnm3oslacZ/lacZ was smaller than that in wild-type mice as shown in Figure 7, the expression of Dnm3os in skeletal muscle might be involved in myogenesis during development. In this study, it is still unclear which miRNA in the Dnm3os locus or Dnm3os gene itself is required for normal skeletal development. To address this question, recombinase-mediated cassette exchange (RMCE)-mediated knock-in of miRNA-carrying cDNA into the Dnm3oslacZ allele will be most informative.

Expression of Dnm3 Is Not Dependent on Dnm3os

According to some estimates, more than half of the mRNA transcripts may have antisense correlates (Katayama et al.,2005; Siddiqui et al.,2005; Yelin et al.,2003). The abundance of these transcripts suggests that they may provide a prevalent mechanism for gene regulation. In fact, ncRNA transcription is frequently at loci associated with X chromatin inactivation as well as genomic imprinting (Lee et al.,1999; Sleutels et al.,2002). Dynamins are dynamic scaffolding proteins that function in membrane trafficking (Praefcke and McMahon,2004) or tubule-bulbar morphogenesis of the testis (Vaid et al.,2007). There are three dynamin isoforms, each encoded by a separate gene (Cao et al.,1998). Dnm3 is expressed in a variety of tissues including the testis, brain, heart, and lungs (Cao et al.,1998). It could be speculated that Dnm3os might function as an antisense ncRNA for Dnm3, since Dnm3os is transcribed with an antisense orientation to Dnm3 from the locus located in a 100-kb intron of Dnm3 (Loebel et al.,2005). However, both the protein and mRNA expression levels of Dnm3 in Dnm3os-null mutations were comparable to those in their wild-type littermates as far as they were examined. The PGK-neo cassette is known to cause phenotypic differences by the neighborhood effect within similar genetic knockouts when not removed (Olson et al.,1996). It is likely that the neighborhood of Dnm3os does not contain cis-acting elements or that the 100-kbp intron might be long enough to escape the neighborhood phenotypic effect of PGK-neo cassettes in the case of our Dnm3os-null mutation. Although it can not be denied that the dominant phenotypic effect might have some influence on the skeletal abnormality observed in Dnm3os mutants, the lack of change in Dnm3 expression in Dnm3oslacZ/lacZ led us to speculate that other genes could be under the regulation of Dnm3os.

In conclusion, we clarified that Dnm3os, an ncRNA, is indispensable for normal mouse skeletal development. In the locus of the Dnm3os gene, a cluster of miRNAs was present and regulated by Dnm3os. Further experiments are needed to clarify the function of each miRNA and ncRNA in normal mouse skeletal development.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Generation and Genotyping of Mutant Mice

A Dnm3os genomic clone was obtained by screening mouse genomic DNA by PCR and hybridizing it with a 32P-dCTP-labeled probe generated from an RsaI-digested cDNA fragment (7-2-A-8) that corresponded to nucleotides 1,535 through 2,460 of the 7.9-kbp Dnm3os transcript (GenBank: AB159607). The nls-lacZ/PGKneo cassette was made by placing the lacZ gene with a nuclear localization signal (nls-lacZ) adjacent to the PGKneo gene and by flanking it with lox71 at the 5′ end and lox2272 at the 3′ end, to allow RMCE. The pKO Scrambler NTKV-1904 plasmid (Stratagene) was used as a backbone vector. A 7-kbp NheI-XhoI fragment including the 5′ flanking region from a positive phage was subcloned into pBluescriptII KS+ to generate a plasmid (1CNX2). The 200-bp fragment containing the hypothetical start codon was PCR-amplified, and the stop codon and following SalI site were created just after the hypothetical start codon of Dnm3os. After sequencing, the stop codon–inserted fragment was ligated to the 6.6-kbp NheI-KpnI fragment from 1CNX2 to make the long arm. For the targeting construct, a 6.8-kbp fragment of the long arm and a 1.4-kbp HaeIII-PstI fragment from the exon (short arm) were placed on each side of the nls-lacZ/PGKneo cassette (Fig. 1A). The targeting vector was linearized and electroporated into a B6/129F1-derived embryonic stem (ES) cell line ATOM1 (Amano et al., unpublished data). The clones that survived positive-negative selection with neomycin and FIAU were screened for homologous recombination by PCR, and the Dnm3os-targeted clones were injected into ICR blastocysts to generate germline chimeras. Finally, two independent embryonic stem clones with a euploid karyotype were used to produce male chimeras. Germline transmission of the target allele was achieved for both clones when bred with ICR females. Mice homozygous for the Dnm3oslacZ allele were obtained by intercrossing F1 heterozygotes. The genotypes of offspring were determined by PCR or Southern blot analysis of tail-tip or amnion DNA. All animal experiments were performed in accordance with the guidelines of the University of Tokyo Animal Care and Use Committee.

In Situ Hybridization

Digoxigenin-labeled riboprobes were synthesized from the linealized plasmid with RNA polymerase using a DIG RNA Labeling Kit (Roche). A 0.9-kb riboprobe for Dnm3os was synthesized from the RsaI-digested Dnm3os cDNA fragment (7-2-A-8) in an antisense orientation and the sense probe served as a negative control. WISH was performed as described by Moorman et al. (2001), and then the probe bound to the embryos was immunologically detected using sheep anti-digoxigenin-AP, Fab fragment, and NBT/BCIP stock solution (Roche).

Total and Micro-RNA Preparation and Northern Analysis

Total RNA was extracted from the embryos using Trizol Reagent (Invitrogen) or Isogen (Wako Pure Chemical Industries, Ltd., Osaka, Japan). The noon on which a vaginal plug was detected was designated as E0.5. Fifteen micrograms of total RNA was electrophoresed on a 1.2% formaldehyde agarose gel and blotted onto Hybond XL nylon membrane (Amersham). The filters were hybridized with random-primed 32P-dCTP-labeled probes and autoradiographed. In the case of Northern blot analysis for miRNA, RNA was isolated from embryos of either homozygous, hemizygous, or wild-type littermate mice using a mirVana™ miRNA isolation kit (Ambion), before being separated on 15% denaturing polyacrylamide gel and transferred by electro-blotting to positively charged nylon membranes. The blots were hybridized overnight at 37°C with γ-32P-ATP)-labeled DNA oligo probes in hybridization buffer, washed three times with 2 × SSC and 0.1% SDS at room temperature, and autoradiographed. The sequences of the oligoprobes for each miRNA were as follows:

miR-199a: CTGAACAGGTAGTCTGAACACTGGGGC

miR-199a*: CTAACCAATGTGCAGACTACTGTACA

miR214: GACTGCCTGTCTGTGCCTGCTGTAC

β-Galactosidase Staining

The β-gal activity in mutant mice was traced by X-gal (5-bromo-4-chloro-3-indoyl β-D-galactoside) staining. Staining was performed as described by Yamamura et al. (1997) with minor modifications. Whole embryos were isolated in ice-cold PBS containing 2 mM MgCl2 and fixed in 0.1M phosphate buffer (pH 7.3) containing 0.2% glutaraldehyde, 5 mM EGTA, and 2 mM MgCl2. For preparation of the sections, the fixed embryos were frozen in OCT compound and then cut. The whole embryos or the sectioned samples were incubated for several hours to overnight at 37°C in 0.1M phosphate buffer containing 2 mM MgCl2, 0.02% NP-40, 0.01% sodium deoxycholate, and 5 mM EGTA (washing buffer) containing 10 mM potassium ferrocyanide, 10 mM potassium ferricyanide, and 2 mg/ml X-gal, followed by rinsing with washing buffer 3 times. Some sections were counterstained with 1% Orange G (SIGMA).

Skeletal Preparations and Histochemical Study

Skeletal preparations of mice ranging from E18.0 to P150 were made with an alcian blue–alizarin red method (Yoshikawa et al.,1998). Briefly, pups were skinned, dehydrated in 96% ethanol, and stained with alcian blue and alizarin red. The muscles were then removed with 1% KOH, and the preparations were stored in glycerol.

For the histochemical studies, whole embryos were fixed with 10% formaldehyde in phosphate buffer saline, wax embedded, and processed for light microscopy according to standard procedure. Five-micrometer sections were stained with hematoxylin and eosin.

Micro-Computed Tomography (μCT)

Bones fixed in 70% ethanol were analyzed by μCT at a 10-μm resolution and a 10-μm section-to-section distance with an inspeXio SMX-90CT scanner (SHIMADZU, Kyoto, Japan) and TRI/3D-VIE analysis software (RATOC, Tokyo, Japan). Analysis of the trabecular bone was carried out in a 0.2-mm-thick region of the femur that was 0.5 mm proximal to the growth plate of the knee joint. The software was used to reconstruct a 3D image of the regions of interest from the μCT sections.

Western Blotting

A rabbit polyclonal antibody against mouse Dnm3 was generously provided by Dr. MA McNiven. Aliquots of 15 μg protein extracts were separated on SDS-PAGE and transferred to Immobilon-P PVDF membrane (Millipore). After incubation of the membrane with the antibody, detection of the signal was performed using Amersham ECL™ Western Blotting Detection Reagents (GE Healthcare).

Real-Time PCR

Two hundred nanograms of RNA derived from the tissues of E11.5 or E15.5 embryos was reverse transcribed into cDNA using an iScript cDNA synthesis kit (Bio-Rad). Real-time PCR was carried out in an iCycler (Bio-Rad) at 95°C for 15 min to activate the HotStart Taq DNA polymerase, followed by 45 cycles of 94°C for 30 sec, 60°C for 30 sec, and 72°C for 30 sec using a QuantiTect SYBR green PCR kit (QIAGEN). The sequences of the primers are shown below. The expression level of each gene was normalized by that of glyceraldehyde-3-phosphate dehydrogenase (Gapd).

Dnm3os_forward: CAAGGCTCTC-ACTTGTCCTG

Dnm3os_reverse: CAGCTGGAAA-CTGACCAAAG

Dnm3_forward: AATCCGTCCACT-AGAATCCTCA

Dnm3_reverse: GGTCCATACATG-CGACTACTCA

Gapd_forward: CTTCCGTGTTCC-TACCC

Gapd_reverse: ACCTGGTCCTCA-GTGTAGCC

Statistical Analysis

Statistical analyses were performed using StatView 5.0 (SAS Institute Inc., Cary, NC) software. Values are expressed as mean ± SD. Data were analyzed by one-factor analysis of variance (ANOVA) followed by the Newman-Keuls multiple comparison test. Differences with a value of P < 0.05 were considered statistically significant.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

This work was supported by a grant-in-aid for scientific research from the Ministry of Education, Culture, Sports, Science, and Technology, Japan (18790703) and a grant-in-aid for scientific research from the Japan Heart Foundation Research Grant (Japan Heart Foundation Young Investigator's Research Grant). We thank Dr. Mark A. McNiven (Department of Biochemistry and Molecular Biology, Cell Biology Program Mayo Cancer Center) for donating an antibody against Dnm3 and Dr. Nobuyuki Kurosawa (Department of Material Systems Engineering and Life Science, Faculty of Engineering, Toyama University, Toyama 930-8555, Japan) for the mouse genomic library.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  • Babak T, Zhang W, Morris Q, Blencowe BJ, Hughes TR. 2004. Probing microRNAs with microarrays: tissue specificity and functional inference. Rna 10: 18131819.
  • Cao H, Garcia F, McNiven MA. 1998. Differential distribution of dynamin isoforms in mammalian cells. Mol Biol Cell 9: 25952609.
  • Carninci P, Kasukawa T, Katayama S, Gough J, Frith MC, Maeda N, Oyama R, Ravasi T, Lenhard B, Wells C, Kodzius R, Shimokawa K, Bajic VB, Brenner SE, Batalov S, Forrest AR, Zavolan M, Davis MJ, Wilming LG, Aidinis V, Allen JE, Ambesi-Impiombato A, Apweiler R, Aturaliya RN, Bailey TL, Bansal M, Baxter L, Beisel KW, Bersano T, Bono H, Chalk AM, Chiu KP, Choudhary V, Christoffels A, Clutterbuck DR, Crowe ML, Dalla E, Dalrymple BP, de Bono B, Della Gatta G, di Bernardo D, Down T, Engstrom P, Fagiolini M, Faulkner G, Fletcher CF, Fukushima T, Furuno M, Futaki S, Gariboldi M, Georgii-Hemming P, Gingeras TR, Gojobori T, Green RE, Gustincich S, Harbers M, Hayashi Y, Hensch TK, Hirokawa N, Hill D, Huminiecki L, Iacono M, Ikeo K, Iwama A, Ishikawa T, Jakt M, Kanapin A, Katoh M, Kawasawa Y, Kelso J, Kitamura H, Kitano H, Kollias G, Krishnan SP, Kruger A, Kummerfeld SK, Kurochkin IV, Lareau LF, Lazarevic D, Lipovich L, Liu J, Liuni S, McWilliam S, Madan Babu M, Madera M, Marchionni L, Matsuda H, Matsuzawa S, Miki H, Mignone F, Miyake S, Morris K, Mottagui-Tabar S, Mulder N, Nakano N, Nakauchi H, Ng P, Nilsson R, Nishiguchi S, Nishikawa S, Nori F, Ohara O, Okazaki Y, Orlando V, Pang KC, Pavan WJ, Pavesi G, Pesole G, Petrovsky N, Piazza S, Reed J, Reid JF, Ring BZ, Ringwald M, Rost B, Ruan Y, Salzberg SL, Sandelin A, Schneider C, Schonbach C, Sekiguchi K, Semple CA, Seno S, Sessa L, Sheng Y, Shibata Y, Shimada H, Shimada K, Silva D, Sinclair B, Sperling S, Stupka E, Sugiura K, Sultana R, Takenaka Y, Taki K, Tammoja K, Tan SL, Tang S, Taylor MS, Tegner J, Teichmann SA, Ueda HR, van Nimwegen E, Verardo R, Wei CL, Yagi K, Yamanishi H, Zabarovsky E, Zhu S, Zimmer A, Hide W, Bult C, Grimmond SM, Teasdale RD, Liu ET, Brusic V, Quackenbush J, Wahlestedt C, Mattick JS, Hume DA, Kai C, Sasaki D, Tomaru Y, Fukuda S, Kanamori-Katayama M, Suzuki M, Aoki J, Arakawa T, Iida J, Imamura K, Itoh M, Kato T, Kawaji H, Kawagashira N, Kawashima T, Kojima M, Kondo S, Konno H, Nakano K, Ninomiya N, Nishio T, Okada M, Plessy C, Shibata K, Shiraki T, Suzuki S, Tagami M, Waki K, Watahiki A, Okamura-Oho Y, Suzuki H, Kawai J, Hayashizaki Y. 2005. The transcriptional landscape of the mammalian genome. Science 309: 15591563.
  • Cheng AM, Byrom MW, Shelton J, Ford LP. 2005a. Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis. Nucleic Acids Res 33: 12901297.
  • Cheng J, Kapranov P, Drenkow J, Dike S, Brubaker S, Patel S, Long J, Stern D, Tammana H, Helt G, Sementchenko V, Piccolboni A, Bekiranov S, Bailey DK, Ganesh M, Ghosh S, Bell I, Gerhard DS, Gingeras TR. 2005b. Transcriptional maps of 10 human chromosomes at 5-nucleotide resolution. Science 308: 11491154.
  • Cheng Y, Ji R, Yue J, Yang J, Liu X, Chen H, Dean DB, Zhang C. 2007. MicroRNAs are aberrantly expressed in hypertrophic heart: do they play a role in cardiac hypertrophy? Am J Pathol 170: 18311840.
  • Chureau C, Prissette M, Bourdet A, Barbe V, Cattolico L, Jones L, Eggen A, Avner P, Duret L. 2002. Comparative sequence analysis of the X-inactivation center region in mouse, human, and bovine. Genome Res 12: 894908.
  • Flynt AS, Li N, Thatcher EJ, Solnica-Krezel L, Patton JG. 2007. Zebrafish miR-214 modulates Hedgehog signaling to specify muscle cell fate. Nat Genet 39: 259263.
  • Forlino A, Piazza R, Tiveron C, Della Torre S, Tatangelo L, Bonafe L, Gualeni B, Romano A, Pecora F, Superti-Furga A, Cetta G, Rossi A. 2005. A diastrophic dysplasia sulfate transporter (SLC26A2) mutant mouse: morphological and biochemical characterization of the resulting chondrodysplasia phenotype. Hum Mol Genet 14: 859871.
  • Fukuda T, Yamagata K, Fujiyama S, Matsumoto T, Koshida I, Yoshimura K, Mihara M, Naitou M, Endoh H, Nakamura T, Akimoto C, Yamamoto Y, Katagiri T, Foulds C, Takezawa S, Kitagawa H, Takeyama K, O'Malley BW, Kato S. 2007. DEAD-box RNA helicase subunits of the Drosha complex are required for processing of rRNA and a subset of microRNAs. Nat Cell Biol 9: 604611.
  • Goldman DC, Hackenmiller R, Nakayama T, Sopory S, Wong C, Kulessa H, Christian JL. 2006. Mutation of an upstream cleavage site in the BMP4 prodomain leads to tissue-specific loss of activity. Development 133: 19331942.
  • Goodrich JA, Kugel JF. 2006. Non-coding-RNA regulators of RNA polymerase II transcription. Nat Rev Mol Cell Biol 7: 612616.
  • Houbaviy HB, Murray MF, Sharp PA. 2003. Embryonic stem cell-specific MicroRNAs. Dev Cell 5: 351358.
  • Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, Suzuki M, Kawai J, Suzuki H, Carninci P, Hayashizaki Y, Wells C, Frith M, Ravasi T, Pang KC, Hallinan J, Mattick J, Hume DA, Lipovich L, Batalov S, Engstrom PG, Mizuno Y, Faghihi MA, Sandelin A, Chalk AM, Mottagui-Tabar S, Liang Z, Lenhard B, Wahlestedt C. 2005. Antisense transcription in the mammalian transcriptome. Science 309: 15641566.
  • Lanz RB, McKenna NJ, Onate SA, Albrecht U, Wong J, Tsai SY, Tsai MJ, O'Malley BW. 1999. A steroid receptor coactivator, SRA, functions as an RNA and is present in an SRC-1 complex. Cell 97: 177.
  • Lee JT, Davidow LS, Warshawsky D. 1999. Tsix, a gene antisense to Xist at the X-inactivation centre. Nat Genet 21: 400404.
  • Loebel DA, Tsoi B, Wong N, Tam PP. 2005. A conserved noncoding intronic transcript at the mouse Dnm3 locus. Genomics 85: 782789.
  • Moorman AF, Houweling AC, de Boer PA, Christoffels VM. 2001. Sensitive nonradioactive detection of mRNA in tissue sections: novel application of the whole-mount in situ hybridization protocol. J Histochem Cytochem 49: 18.
  • Morey C, Avner P. 2004. Employment opportunities for non-coding RNAs. FEBS Lett 567: 2734.
  • Olson EN, Arnold HH, Rigby PW, Wold BJ. 1996. Know your neighbors: three phenotypes in null mutants of the myogenic bHLH gene MRF4. Cell 85: 14.
  • O'Rourke MP, Tam PP. 2002. Twist functions in mouse development. Int J Dev Biol 46: 401413.
  • Petryk A, Anderson RM, Jarcho MP, Leaf I, Carlson CS, Klingensmith J, Shawlot W, O'Connor MB. 2004. The mammalian twisted gastrulation gene functions in foregut and craniofacial development. Dev Biol 267: 374386.
  • Praefcke GJ, McMahon HT. 2004. The dynamin superfamily: universal membrane tubulation and fission molecules? Nat Rev Mol Cell Biol 5: 133147.
  • Rana TM. 2007. Illuminating the silence: understanding the structure and function of small RNAs. Nat Rev Mol Cell Biol 8: 2336.
  • Siddiqui AS, Khattra J, Delaney AD, Zhao Y, Astell C, Asano J, Babakaiff R, Barber S, Beland J, Bohacec S, Brown-John M, Chand S, Charest D, Charters AM, Cullum R, Dhalla N, Featherstone R, Gerhard DS, Hoffman B, Holt RA, Hou J, Kuo BY, Lee LL, Lee S, Leung D, Ma K, Matsuo C, Mayo M, McDonald H, Prabhu AL, Pandoh P, Riggins GJ, de Algara TR, Rupert JL, Smailus D, Stott J, Tsai M, Varhol R, Vrljicak P, Wong D, Wu MK, Xie YY, Yang G, Zhang I, Hirst M, Jones SJ, Helgason CD, Simpson EM, Hoodless PA, Marra MA. 2005. A mouse atlas of gene expression: large-scale digital gene-expression profiles from precisely defined developing C57BL/6J mouse tissues and cells. Proc Natl Acad Sci USA 102: 1848518490.
  • Sleutels F, Zwart R, Barlow DP. 2002. The non-coding Air RNA is required for silencing autosomal imprinted genes. Nature 415: 810813.
  • Vaid KS, Guttman JA, Babyak N, Deng W, McNiven MA, Mochizuki N, Finlay BB, Vogl AW. 2007. The role of dynamin 3 in the testis. J Cell Physiol 210: 644654.
  • van Rooij E, Sutherland LB, Liu N, Williams AH, McAnally J, Gerard RD, Richardson JA, Olson EN. 2006. A signature pattern of stress-responsive microRNAs that can evoke cardiac hypertrophy and heart failure. Proc Natl Acad Sci U S A 103: 1825518260.
  • Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH. 2005. MicroRNA expression in zebrafish embryonic development. Science 309: 310311.
  • Willingham AT, Orth AP, Batalov S, Peters EC, Wen BG, Aza-Blanc P, Hogenesch JB, Schultz PG. 2005. A strategy for probing the function of noncoding RNAs finds a repressor of NFAT. Science 309: 15701573.
  • Yamamura H, Zhang M, Markwald RR, Mjaatvedt CH. 1997. A heart segmental defect in the anterior-posterior axis of a transgenic mutant mouse. Dev Biol 186: 5872.
  • Yelin R, Dahary D, Sorek R, Levanon EY, Goldstein O, Shoshan A, Diber A, Biton S, Tamir Y, Khosravi R, Nemzer S, Pinner E, Walach S, Bernstein J, Savitsky K, Rotman G. 2003. Widespread occurrence of antisense transcription in the human genome. Nat Biotechnol 21: 379386.
  • Yi R, O'Carroll D, Pasolli HA, Zhang Z, Dietrich FS, Tarakhovsky A, Fuchs E. 2006. Morphogenesis in skin is governed by discrete sets of differentially expressed microRNAs. Nat Genet 38: 356362.
  • Yoshikawa H, Taniguchi SI, Yamamura H, Mori S, Sugimoto M, Miyado K, Nakamura K, Nakao K, Katsuki M, Shibata N, Takahashi K. 1998. Mice lacking smooth muscle calponin display increased bone formation that is associated with enhancement of bone morphogenetic protein responses. Genes Cells 3: 685695.
  • Zhang B, Pan X, Cobb GP, Anderson TA. 2007. microRNAs as oncogenes and tumor suppressors. Dev Biol 302: 112.