SEARCH

SEARCH BY CITATION

Keywords:

  • somitogenesis;
  • muscular differentiation;
  • dystroglycan;
  • laminin;
  • Xenopus laevis

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Dystroglycan (Dg) is a cell adhesion receptor for laminin that has been reported to play a role in skeletal muscle cell stability, cytoskeletal organization, cell polarity, and signaling. Here we show that Dg is expressed at both the notochord/somite and the intersomitic boundaries, where laminin and fibronectin are accumulated during somitogenesis. Inhibition of Dg function with morpholino antisense oligonucleotides or a dominant negative mutant results in the normal segmentation of the presomitic mesoderm but affects the number, the size, and the integrity of somites. Depletion of Dg disrupts proliferation and alignment of myoblasts without affecting XMyoD and XMRF4 expression. It also leads to defects in laminin deposition at the intersomitic junctions, whereas expression of integrin β1 subunits and fibronectin assembly occur normally. Our results show that Dg is critical for both proliferation and elongation of somitic cells and that the Dg-cytoplasmic domain is required for the laminin assembly at the intersomitic boundaries. Developmental Dynamics 238:1332–1345, 2009. © 2008 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Dystroglycan (Dg) is a membrane-spanning cell adhesion receptor encoded by a single gene whose product is cleaved posttranslationally to yield the mature two-chain form, α-Dg and β-Dg (Ibraghimov-Beskrovnaya et al.,1992). The β-Dg modulates signal transduction, acting as a scaffold for the extracellular-signal-related kinase–mitogen-activated protein (ERK-MAP) kinase cascade (Spence et al.,2004). It has also been shown that β-Dg sequesters proteins in separate cellular locations to regulate their adhesion-dependent activation (Spence et al.,2004), and modulates actin reorganization by means of Cdc42 (Batchelor et al.,2007). The α-Dg contains a large mucin-like domain with potential sites for O-glycosylation and binds extracellular matrix (ECM) molecules, such as laminins, perlecan, agrin, and neurexin (Michele and Campbell,2003).

In adult tissue, mutations in the O-glycosylation pathway decrease ligand-binding activity, which leads to dystroglycanopathies (Barresi and Campbell,2006). Dg was found to be aberrantly expressed in a variety of human cancers including oral squamous cell carcinoma, breast, colon, and prostate cancers (Sgambato and Brancaccio,2005). During development, Dg appears to be essential for the formation of the Reichert's membrane that separates the rodent embryo from the maternal circulation (Williamson et al.,1997). In mice, targeted disruption of the Dg gene in peripheral nerve revealed decreased nerve conduction velocity, reduced sodium channel density, and abnormal myelin sheath folding, suggesting a unique role of Dg for both myelination and nodal architecture (Colognato et al.,2007). Dg has been implicated in branching morphogenesis of lung and salivary glands (Durbeej et al.,2001). In vivo, depletion of Dg affects kidney morphogenesis and can lead to renal agenesis (Bello et al.,2008). In Drosophila, Dg has been reported to play a fundamental role for polarizing the epithelial cells and the oocytes in the ovaries (Deng et al.,2003). In larval body wall muscles, errors in muscle attachment, muscle contraction, and muscle membrane resistance have been associated with Dg mutant alleles and RNAi mediated reduction of Dg (Haines et al.,2007). Originally, Dg was isolated from skeletal muscle membranes and was found to be an essential component of the dystrophin–glycoprotein complex, which links the ECM surrounding myofibers to the actin cytoskeleton. Disruption of Dg–dystrophin interaction has been described in Duchenne-type or limb-girdle-type muscular dystrophy (Deconinck and Dan,2007). It has been proposed that Dg forms a continuous link from the ECM to the actin cytoskeleton, providing structural integrity and perhaps transduction signals (Winder,2001). Whereas its role is well established in muscles, much less is known about its implication in early skeletal myogenesis, in particular during somitogenesis in vertebrates.

In vertebrate embryos, somites are regular transient structures repeated along the anterior/posterior axis of the embryo, which then differentiate into a part of the dermis, bone, cartilage, tendon-cell lineages, and skeletal muscles. Somitogenesis in Xenopus laevis displays several unique features characterized by the orchestrated rotation of blocks of cells. During gastrulation, presomitic cells of the paraxial mesoderm intercalate radially and mediolaterally, separate from the rest of the mesoderm, establish the notochord/somite boundary and finally form blocks of 7–9 cells width (Danker et al.,1992). In those blocks, cells change shape, lengthen along their mediolateral axis and narrow along their anteroposterior axis (Wilson et al.,1989; Afonin et al.,2006). At the onset of somitogenesis, the presomitic cells bend anteriorly and undergo a 90° rotation relative to the anteroposterior axis of the embryo to form mono-nucleate muscle cells that are aligned parallel to the notochord (Keller,2000). These observations suggest a complex process depending on a series of coordinated changes in cell shape, cell–cell, and cell–matrix adhesion. Yet little is known about the molecular pathways that coordinate these changes and adhesion during somitogenesis. Type I cadherins are required for cell–cell adhesion during rotation and protocadherin for somite boundary formation (Kim et al.,2000; Giacomello et al.,2002). The α5β1 integrin is expressed during somitogenesis and a dominant negative form of β1 integrin subunit alters somite formation (Marsden and DeSimone,2003). Moreover, a laminin- and fibronectin-containing ECM is localized at notochord/somite boundaries and intersomitic junctions (Wedlich et al.,1989; Fey and Hausen,1990). We have previously reported that Dg transcripts were present in Xenopus presomitic mesoderm (PSM) and persisted in somites upon their formation (Moreau et al.,2003), suggesting that Dg proteins might play a role in somitogenesis.

Our results show that Dg is localized at notochord/somite boundaries and enriched at the intersomitic junctions. Using targeted depletion of the protein, we demonstrate that Dg is not required for the segmentation of the PSM and that Dg does not interfere with the myogenic signaling pathway but may have a central role in somitic cell proliferation and in the setting of contractile proteins that characterize muscular cells. We demonstrate that the presence of Dg is crucial for the laminin deposition in the extracellular matrix, for anchoring cells to laminin, and consequently for cell alignment and elongation within somites. Our data show that Dg depletion does not affect integrin β1 subunit expression and fibronectin fibrillogenesis at intersomitic junctions. Finally, we establish by using dominant negative mutant that the cytoplasmic domain of Dg is required for the laminin assembly at the intersomitic boundaries. Together, these data provide new in vivo insights into Dg function in the developing vertebrate somites.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Dystroglycan Is Localized to the Intersomitic and the Notochord/Somite Boundaries

We have previously cloned the full-length cDNA of Dg from Xenopus laevis and described the mRNA expression pattern during early development (Moreau et al.,2003). To better characterize its expression pattern, whole-mount in situ hybridizations were performed at different developmental stages using digoxigenin (DIG) -labeled αDg RNA antisense probes. Dg mRNAs were detected in the dorsal region, in the paraxial mesoderm in a series of stripes and posteriorly in the PSM where new somites are forming (Fig. 1A–C). Transcripts were also detected at the brain level, the visceral arches, the otic vesicle, the pronephros, and the duct (Fig. 1A–C). At stage 45, when all the somite pairs are formed, the transcripts remained present in somites. A sense αDg control probe showed no staining pattern in embryos at any stage (data not shown). To carry this study further, we examined the Dg protein expression in time and space using the monoclonal antibody 43DAG/8D5 raised against the human β-Dg carboxy-terminus. By whole-mount immunolocalization the protein was progressively detected from the onset of somitogenesis (stage 17). It was localized at both the notochord/somite and intersomitic boundaries during somite formation (data not shown). As development proceeds, Dg was found to be enriched at intersomitic junctions, and later at intermyotomal junctions in tadpoles (Fig. 1D).

thumbnail image

Figure 1. Dystroglycan transcript and protein expressions. A–C: Lateral view, whole-mount in situ hybridization at stage 21 (A), 23 (B), and 27 (C). Dg mRNAs are detected in the dorsal region, posteriorly in the presomitic mesoderm and in the mesoderm in a series of stripes. D: Stage 40, lateral view, in toto immunodetection. The staining of the Dg protein is associated with the intersomitic junctions and the notochord (white arrow). μm; b, brain; ov, otic vesicle; psm, presomitic mesoderm; s, somites; va, visceral arches; p, pronephros and duct. Scale bar = 400 μm.

Download figure to PowerPoint

Taken together these data show that Dg transcripts are present in the PSM and both the Dg transcripts and the proteins persist in somites upon their segmentation and maturation. An obvious question is whether Dg is involved during somitogenesis. To address this issue, we used loss-of-function experiments using Dg antisense morpholinos and mRNA encoding a mutated Dg missing the β-C-terminus tail.

Dystroglycan Depletion Causes a Disorganization of the Paraxial Mesoderm

Because Xenopus laevis is allotetraploid, several pseudoalleles of Dg exist. The nucleotides sequence of the allele that we have cloned (Moreau et al.,2003) was too divergent around the translational start site with others alleles identified in the expressed sequence tag (EST) databases to be targeted by one morpholino. Therefore, we have used two Dg antisense morpholinos (Dg-MO) to examine the Dg function in Xenopus laevis somitogenesis. Their efficiency has been demonstrated previously (Bello et al.,2008). However, to verify the depletion of the Dg protein in paraxial mesoderm and somites with the Dg-MO mixture, increasing concentrations were injected bilaterally in two-cell stage embryos. At stage 24, dorsal explants containing somites were dissected and proteins were analyzed by Western blotting to establish the presence of Dg. In control embryos, a band at 43 kDa representing β-Dg was identified while in Dg-MO injected embryos, the 43-kDa band was greatly reduced or absent in a dose-dependent manner (Fig. 2A). To further control the depletion of Dg at the somite level, 28 ng of the Dg-MO mixture were unilaterally injected at the two-cell stage and the localization of Dg was analyzed by indirect immunofluorescence. On frontal sections, the Dg protein was present at the intersomitic junctions on the control side, whereas no staining was observed on the MO-injected side (Fig. 2B). Because both Western blotting and immunostaining showed drastically reduced levels of Dg in somites, subsequent knockdown experiments were made with a 28-ng mixture of MO.

thumbnail image

Figure 2. Immunodetection of dystroglycan in the dorsal region of morpholino (MO) treated embryos. A: Protein extracts of dorsal explants dissected at stage 24 embryos. (1) Noninjected embryos, a 43-kDa band corresponding to β-Dg is detected. (2–4) Embryos injected with 12 ng (2), 20 ng (3) and 28 ng (4) of Dg MO per blastomere. A dose dependent reduction of the band corresponding to β-Dg is highlighted. B: Stage 40, frontal section. Embryo was unilaterally injected at the two-cell stage with 28 ng of Dg MO. The immunodetection shows that the Dg protein is present in the control side whereas no staining is observed in the MO-injected side. WT, wild-type; Mo, injected side. Scale bar = 100 μm.

Download figure to PowerPoint

To determine the requirement of Dg protein during somitogenesis, unilateral injections of Dg-MO were performed at the two-cell stage. Injected embryos developed normally through cleavage, gastrulation, and early neurulation. At the beginning of somitogenesis (stage 17), the morphology of embryos appears normal except that a bend appears along the anterior/posterior axis of injected embryos suggesting a shortening of the axis (Fig. 3A–D). Ninety-eight percent of the Dg-MO injected embryos (n = 180) show this phenotype. The bend was maintained as the development progressed, and was more pronounced at the tail bud stages, with the concave side corresponding to the injected side. Such curved embryos had never been observed when injected with the standard MO (data not shown), a five-nucleotide mismatch Dg-MO or a mixture of Dg mRNA and Dg-MO (Fig. 5Q,R). At older stages, the embryos exhibited jerky movements and a disturbed stroke characterized by a circular trajectory suggesting defective and/or less muscles in the injected sides. Somites were counted at different stages in both the injected and control sides (n = 35). Between stages 24 and 41, there was a reduction of 2 to 3 somites on the injected side compared with the control side (Fig. 3E). These phenotypes could be the consequence of a developmental delay provoked by either the MO injection itself or the Dg depletion. The first suggestion seems unlikely because the injection of a five-nucleotide mismatch Dg-MO or a mixture of Dg mRNA and Dg-MO had no effects on somite number and development (not shown, see Fig. 5Q,R).

thumbnail image

Figure 3. Somites are disorganized and reduced when dystroglycan is depleted. A–E: Embryos were injected with 28 ng of Dg morpholino (MO) into the left side at the two-cell stage and stained with the 12/101 antibodies. A–D: Dorsal views of stage 24 (A), 28 (B), 32 (C), and 45 (D). E: Statistical analysis of the somite number at different developmental stages. Bars indicate SE (t-test: Pstage24 = 0.0004; Pstage28 = 0.0014; Pstage32 = 0.005; Pstage41 = 0.047). F–I: An embryo at stage 24. F,G: Lateral view of the control side. The segmentation of the paraxial mesoderm is clearly visible. H,I: Lateral view of the injected side. The repetitive units often lack their characteristic chevron pattern. J–L: Stage 24, transversal section (injected side on the right). J: Hoechst (blue). K: Immunodetection with the 12/101 antibodies (red). L: Merge. The injected sides show a reduction of the somite size. M: Stage 24, frontal section, immunodetection with the 12/101 antibodies (injected side at the right). The segmentation is not affected; the somites are less compact and less cohesive. WT, wild-type; Mo, injected side. Scale bar = 200 μm.

Download figure to PowerPoint

thumbnail image

Figure 5. Dystroglycan depletion disrupts myotome cells alignment and intersomitic cohesion. A,B–C: Stage 24. Control embryo sectioned and stained with Hoechst (blue, A), and immunostained with the 12/101 antibodies (red, B); merged image (C). Arrows show cells undergoing their rotation. D–L: Embryos were unilaterally injected at the two-cell stage with 28 ng of Dg morpholino (MO). At stage 24, embryos were fixed, sectioned and double stained with the 12/101 antibodies (red) and Hoechst (blue). D–F: Frontal section. The nuclei are randomly distributed on the injected side (lower part of the panel). G–I: Para-sagittal section, control side of the embryo. G: The nuclei exhibit a typical oval/elongated shape and are aligned in each somite. H: The somites are strongly cohesive the ones with the others. The 12/101 staining is concentrated at the intersomitic junctions (white arrows). I: Merge. J–L: Para-sagittal section of the injected side. J: The nuclei are randomly distributed. K: The somites are less compact and less cohesive; the 12/101 staining is absent at the intersomitic junctions (white arrows); within somites, the cell alignment appears affected. L: Merge. M–P: Embryos were unilaterally injected at the two-cell stage with Dg MO and mRNAs encoding a membrane-tagged green fluorescent protein (GFP). M: Stage 24, frontal section, control side. Cells are aligned parallel to the notochord and somite boundaries are well delimited (white arrows). N: Stage 24, frontal section, injected side. The somites are disorganized. Cells fail to extend and align within each somite. The intersomitic junctions fail to form correctly (white arrows). O: Stage 24, para-sagittal section, control side. Cells are aligned. Somite boundaries exhibit their characteristic chevron pattern (white arrows). P: Stage 24, para-sagittal section, injected side. Cells fail to align and boundaries are not well delimited (white arrows). Q: Frontal section of a rescued embryo stained with Hoechst (blue) and the 12/101 antibodies (red). R: Frontal section of an embryo injected with a five-nucleotide mismatch Dg-MO and stained with Hoechst (blue) and the 12/101 antibodies (red). The somite morphology and their number are not affected. Cells are aligned parallel to the notochord. WT, wild-type; Mo, injected side. Scale bar = 70 μm.

Download figure to PowerPoint

To investigate the consequence of the Dg depletion, patterning and morphology of somites were analyzed by whole-mount immunostaining with the 12/101 antibodies, a myotome and skeletal muscular tissue-specific monoclonal antibody (Kintner and Brockes,1984). When the dorsal region of the embryos was observed, an extensive disorganization of the somitic tissue and a weaker intensity of the labeling on the injected side were noticed (Fig. 3F–M). On the Dg depleted side, the somite region was significantly reduced when compared with the noninjected side (Fig. 3F–I). On the injected side, repetitive units were observed (Fig. 3A–D). These units appeared reduced in number. For example, at stage 28, thirteen somite-like structures were observed on the injected side whereas sixteen were detected in the uninjected side (Fig. 3B). Moreover in the Dg-depleted side, the repetitive units were observed but their characteristic chevron pattern was often affected (compare Fig. 3F,G and Fig. 3H,I). To further analyze these phenotypes, selected affected embryos were fixed, sectioned and stained with Hoechst and the 12/101 antibodies (Fig. 3J–L). On transversal sections of the truncal region of the embryos, somites of the injected side appeared smaller along the dorsoventral and mediolateral axes than somites of the control side (Fig. 3J–L). On frontal sections throughout the embryo, we observed that the 12/101 antibody staining was weaker on the Dg depleted side (Fig. 3M). Blocks of somitic cells were discernable in the Dg-MO injected side, but they appeared less compact and less cohesive with each other (Fig. 3M). Moreover, the cell organization within each somite appeared affected (Fig. 3M, see also Fig. 5D–F). Altogether, these observations indicate that depletion of Dg does not affect the segmentation of the PSM but reduces the number, the size and the organization of the somites.

Dystroglycan Depletion Decreases Cell Proliferation in Somites

Several steps characterize somitogenesis. After the muscular determination of somitic cells, the premyoblasts proliferate before aligning themselves. Embryos injected with Dg-MO exhibited a reduction of the number and the size of somites suggesting that Dg depletion could promote apoptosis or alter cell proliferation. To identify the apoptosis pattern in Dg depleted somites, embryos (n = 10) were fixed at stage 24, sectioned by a cryostat at a 14μm thickness and terminal deoxynucleotidyl transferase–mediated deoxyuridinetriphosphate nick end-labeling (TUNEL) stained. TUNEL-positive cells were counted on 10 frontal sections of 11 somitic blocks per embryo in both the control and the injected sides. On all sections, no statistically significant differences in the number of apoptotic cells were found between the two sides of the embryos.

To compare the rate of proliferation of myoblast cell progenitors in control and Dg-MO injected sides, the phosphorylated-Histone H3 (P-H3) was used as a mitosis marker. Immunodetections were performed with the anti–phospho-Histone H3 antibodies on cryostat sections of stage 24 embryos (n = 8). The number of P-H3 positive cells was determined in both the control and the injected sides as described above. The average of positive cells per somite is presented on Figure 4. The data indicate that cell proliferation in somites was reduced by 38% in the Dg depleted side compared with the control side (Fig. 4). These results suggest that the reduction of the number and the size of somites observed in Dg-MO injected embryos could be correlated to a decrease in myoblast cell proliferation.

thumbnail image

Figure 4. Dystroglycan depletion reduces the cell proliferation in somites. Stage 24 embryos injected unilaterally were sectioned (n = 8). Then sections were stained with the phospho-Histone H3 antibodies (mitosis marker). Positive cells were counted in somite areas in both the injected and control sides. The average number of positive cells per somite on the control and the injected sides is compared on the graph. Bars indicate SE. The difference (38%) between the control and the injected side is significant (t-test: P = 0.045). WT, wild-type; MO, injected side.

Download figure to PowerPoint

Dystroglycan Depletion Disrupts Myotome Cells Alignment and Intersomitic Cohesion

During somite formation, somitic cells are stacked in blocks and undergo a 90° rotation relative to the anteroposterior axis of the embryo to form myotome fibers that are aligned parallel to the notochord (Keller,2000). On frontal section, we have observed that during somite rotation, the morphology of nuclei changed. From a round shape before the rotation (Fig. 5A,C), they progressively adopted an oval/elongated shape (Fig. 5A,C,G,J) that could be correlated to the elongation of cells. Moreover, nuclei curved and aligned along the dorsoventral and proximodistal axes within each block (Fig. 5A,C). Thus at the end of rotation, nuclei are arranged in regularly ordered stripes so that one stripe corresponds to one somite (Fig. 5A,C). To analyze somite formation, selected Dg depleted embryos were fixed, sectioned and double stained with the 12/101 antibodies and Hoechst. The mRNA encoding a membrane-tagged green fluorescent protein (GFP) was also used to identify cell plasma membrane.

On frontal sections, nuclei were aligned within each somite on the control side, whereas they were randomly distributed on the injected side (Fig. 5D–F). Once again we noticed that the 12/101 antibodies staining appeared weaker on the injected side of embryos (Fig. 5E). On para-sagittal sections (Fig. 5G–L), we observed a dramatic disorganization of cells within the Dg depleted somites (Fig. 5J–L) compared with the control side (Fig. 5G–I). Nuclei were not arranged in regularly spaced stripes (compare Figs. 5G and 5J). Moreover, nuclei adopted a round shape instead of a typical oval/elongated shape (compare Figs. 5G and 5J), suggesting that cells failed to elongate and to align parallel to the notochord. We also observed that somites were less cohesive to each other (Fig. 5K) and that the somite boundaries were less reactive to the 12/101 antibodies than those detected in the control side (compare Figs. 5H and 5K). On frontal and para-sagittal sections of embryos expressing the membrane-tagged GFP, somites were correctly arranged in the control side (Fig. 5M,O). Cells that had rotated were aligned parallel to the notochord and showed the characteristic chevron pattern (Fig. 5M,O). In the Dg depleted side, somites were disorganized and cells were randomly arranged (compare Fig. 5M and 5N and Fig. 5O and 5P). They were not able to anteroposteriorly extend and to align within each somite (compare Fig. 5M and 5N and Fig. 5O and 5P). Moreover, the intersomitic junctions failed to form correctly (Fig. 5N,P). These phenotypes suggest that myoblasts have initiated their rotation but fail to align, to extend and to establish a correct anchoring at intersomitic junctions.

To check the specificity of observed phenotypes, co-injections of 400 pg of Xenopus full-length Dg mRNA with the Dg-MO were performed. Embryos were fixed, sectioned and double stained with the 12/101 antibodies and Hoechst (Fig. 5Q). Experiments were also done with the standard MO (data not shown) and a five-nucleotide mismatch Dg-MO (Fig. 5R). In these three cases, no obvious morphological and cell arrangements abnormalities were observed in somites. These knockdown, control and rescue experiments show that Dg depletion results in somite defects including misorientation of cells and impairment of intersomitic boundary formation.

Dystroglycan Depletion Does Not Disrupt the Myogenic Signaling Pathway in Somites

The above observations (Fig. 3K,M, 5E) show that the 12/101 antibodies labeling is reduced in myotome cells of the Dg-MO injected side. To verify these observations, we have used the in vitro system to induce muscle tissue in explants derived from the animal region of the blastula, so-called animal caps (Okabayashi and Asashima,2003). Dg-MO was injected at the two-cell stage into animal pole of both cells and animal caps were isolated from the blastula (stage 9). After incubation with activin, animal caps were grown until stage 24 equivalent. Then, explants were fixed, sectioned and double stained with the 12/101 antibodies and Hoechst. In controls (nWT = 45), explants were organized in elongated structures (data not shown), and contractions of explants were observed, suggesting the presence of contractile proteins, characteristic of muscular fibers. By contrast, Dg-depleted explants (nMo = 60) were spherical and not able to contract. Sections of control explants showed a large block of muscle cells presents in the center and the immunostaining revealed that these cells were reactive to the 12/101 antibodies (Fig. 6A). The Hoechst staining indicated that some nuclei were aligned within the structure but they were never arranged in regular spaced stripes like in somites (Fig. 6B). In contrast, the fluorescence was absent on sections of MO-treated explants (Fig. 6D–F), and nuclei were not aligned within the structure (Fig. 6E,F). These observations suggest that muscle cell differentiation did not occur in Dg depleted explants (Fig. 6D–F).

thumbnail image

Figure 6. Dystroglycan depletion does not disrupt the myogenic signaling pathway. A–C: Sections of control explant at stage 24 equivalent. A: Immunostaining with the 12/101 antibodies. B: Hoechst. Some nuclei are aligned. C: Merge. D–F: Sections of morpholino (MO) -injected explant at stage 24 equivalent. D: Immunodetection with the 12/101 antibodies. No staining is observed. E: Hoechst. F: Merge. G–H′: Whole-mount in situ hybridization of XMyoD. G: Stage 24, dorsal view of unilaterally injected embryo (injected side on the right). H: Stage 28, lateral view of the control side. H′: Stage 28, lateral view of the injected side. The intersomitic junctions are disorganized (white arrows). I: Stage 24, frontal section, immunodetection of the XMyoD protein (injected side at the right). J,K: Stage 24 equivalent, whole-mount in situ hybridization of XMyoD. J: Control explant. K: MO-injected explant. L,M: Stage 24 equivalent, immunodetection of the MyoD protein. L: Control explant. M: MO-injected explant. N–N′: Stage 28, whole-mount in situ hybridization of XMRF4. N: Lateral view of the control side. N′: Lateral view of the injected side. O–P′: Stage 28, immunodetection of the MRF4 protein. O: Frontal section (injected side on the right). P: Control explant. P′: MO-injected explant. WT, wild-type; Mo, injected side. Scale bar = 70 μm.

Download figure to PowerPoint

Because the expression of the 12/101 muscle marker was weaker or absent in MO-injected embryos or explants, it is possible that Dg depletion could affect the somitic fate by inhibiting the expression of genes involved in the muscle cell differentiation. Therefore, we investigated whether the Dg interfered with the myogenic signaling pathway by analyzing the expression pattern of XMyoD and XMRF4, respectively the earliest and a late marker of muscle cell differentiation (Hopwood et al.,1992; Della Gaspera et al.,2006). The expression of these specific genes was analyzed in Dg-MO injected embryos and explants, by whole-mount in situ hybridization and immunostaining of sections.

In embryos, the comparison between the MO-injected side and the control side did not reveal significant difference in the expression of XMyoD at any stage. At stage 28, blocks of somites were apparent but boundaries were disorganized (Fig. 6H,H′). On frontal section, indirect immunofluorescence with an anti-XMyoD antibody revealed a nuclear staining in both the control and the injected sides (Fig. 6I). In control and Dg-MO explants, the XMyoD transcript (Fig. 6J,K) and protein (Fig. 6L,M) were detected, suggesting that the muscular induction took place, notably in MO injected tissues that were not reactive to the 12/101 antibodies (Fig. 6D–F).

To analyze the late cell differentiation, we investigated the expression pattern of XMRF4, a late myogenic transcription factor. Whole-mount in situ hybridization revealed that transcripts were expressed in both the control and the Dg depleted sides although the somites structure was disrupted (Fig. 6N,N′). On frontal section, immunostaining with the anti-XMRF4 antibodies revealed a nuclear localization of this factor in both the control and the injected sides of embryos (Fig. 6O). This result was confirmed on sections of control and Dg-MO explants (Fig. 6P–P′).

Together, these data show that Dg depletion does not disturb the XMyoD and XMRF4 expression pattern and suggest that the Dg does not interfere with the myogenic signaling pathway in somites but with somite morphogenesis.

Dystroglycan Depletion Prevents the Laminin Deposition at the Somite Boundaries

Dg is one of the known laminin receptors. Previous data in mice suggest that it plays a critical role in the formation of basement membrane during early development by anchoring this matrix component to the cell surface (Williamson et al.,1997). Because laminin is present in Xenopus around the notochord and at the intersomitic junctions (Fig. 7A), we investigated the possibility that the alignment defect of myoblasts within somites was due to a disrupted laminin organization at the intersomitic boundaries. Dg-MO were injected at the two-cell stage into one or both blastomeres (see the Experimental Procedures section), embryos and explants were fixed, sectioned and stained with the anti-laminin antibodies. Both sides of the embryo displayed a laminin distribution around the notochord; however, laminin was absent at the intersomitic junctions where Dg was depleted (Fig. 7B,C). In MO-treated explants, no laminin deposition was detected (compared Fig. 7D with 7E). Together, these findings demonstrate that the Dg is required to deposit the laminin in the extracellular matrix, at the intersomitic boundaries. They support the possibility that the cell disorganization within somites, in Dg depleted embryos, could be the consequence of the absence of laminin at the intersomitic junctions.

thumbnail image

Figure 7. Dg depletion and Dg without the cytoplasmic domain prevents laminin deposition at the somite boundaries. A–E: Immunodetection of the laminin. A: Frontal section of control embryo, stage 24. The laminin is present around the notochord, the neural tube, and at the intersomitic junctions. B: Frontal section of the ventral region of a unilaterally morpholino (MO) -injected embryo, stage 24. Laminin is detected at the intersomitic boundaries in the uninjected side (left) and absent in the injected side (right). C: Frontal section of the dorsal region of a unilaterally Mo-injected embryo, stage 28. The laminin is absent in the injected side (right) but present at the intersomitic junctions of the control side. D,E: Immunodetection of the laminin in explants. D: Laminin is deposited in control explant. E: MO-treated explant. Laminin was not detected. F: Frontal section, stage 28. Immunodetection of the integrins (injected side on the right). The integrins are localized at the intersomitic junctions in both the control and injected sides. G: Frontal section, stage 28. Immunodetection of the fibronectin (injected side on the right). The fibronectin is detected at the somite boundaries and around the notochord. H,I: MO-injected explants. H: Immunodetection of the integrins. I: Immunodetection of the fibronectin. J–N: Dg-ΔCyto mRNA was delivered unilaterally and effects of the overexpression of the Dg-cytoplasmic mutant was analyzed at stage 24 on frontal section. J–L: Immunochemistry with Hoechst (blue) and the anti-laminin antibodies (red). J: Laminin is detected around the notochord and at the intersomitic boundaries in the control side (left). Laminin is absent at the intersomitic junctions in the injected side (right). K: Magnification of the control side. The nuclei exhibit a typical oval/elongated shape and are aligned in each somite. The laminin is present at both the somite/notochord and intersomitic boundaries. Somites are cohesives. L: Magnification of the Dg-ΔCyto mRNA-injected side. The nuclei are randomly distributed. The laminin is present at the somite/notochord boundaries, but its deposition at the intersomitic junctions is severely disrupted. The fluorescence appears sparse within the putative somites (white arrows). M,N: Immunodetection of the green fluorescent protein (GFP) -tagged Dg-ΔCyto (green) and the laminin (red). M: The Dg-ΔCyto proteins are detected at the surface of somitic cells (white arrows). N: Magnification of one cell expressing the Dg-ΔCyto protein. Somitic cells expressing the Dg-Δcyto proteins (white arrows) were also stained by the anti-laminin antibodies (blue arrows) and both proteins are co-localized at the level of the plasma membrane. Ch, notochord; TN, neural tube; WT, wild-type; Mo, injected side. Scale bar = 100 μm.

Download figure to PowerPoint

Integrins are also known to function as receptors for laminin (Henry et al.,2001). To verify the organization in the somitic tissue of the beta1 integrins, we used the 8C8 monoclonal antibody. On frontal sections, the indirect immunofluorescence indicated that integrin β1 subunits were concentrated at both the intersomitic and the notochord/somite boundaries in both the injected and the control sides (Fig. 7F). Integrins can also bind fibronectin and have been shown to be essential for the formation of somites (Rifes et al.,2007). To analyze the organization of this other matrix component in the absence of Dg, we used an anti-fibronectin antibody. On frontal sections, this protein is distributed around the notochord and at the intersomitic boundaries in both the control and injected sides (Fig. 7G). The in vitro experiments support these results because both integrin β1 subunits and fibronectin were detected in the Dg depleted structures (Fig. 7H,I).

The above results show that the Dg depletion in somites affects interaction between cells and the extracellular matrix containing laminin at intersomitic boundaries. Dg is known to interact with adaptors and signaling molecules such as Grb2, ERK, and MAPK (Spence et al.,2004). To determine whether the cytoplasmic domain of Dg was required during somitogenesis, a construct coding for a GFP-tagged Dg missing the β-C-terminus tail (Dg-ΔCyto) was used. At the eight-cell stage, embryos were unilaterally injected into the presumptive somite region with Dg-ΔCyto mRNA. Similarly to the MO-injected embryos, the Dg-ΔCyto mRNA injected embryos developed normally until tail bud stage when a bend appeared along the anterior/posterior axis. Immunohistochemistry using the 12/101 antibodies and Hoechst revealed a similar phenotype to the Dg-MO injected embryos: a weaker 12/101 staining, a defective cohesion between somites, a dramatic disorganization of cells and nuclei (Fig. 7J–L). As expected, immunohistochemistry using the anti-laminin antibodies showed a positive staining at both the somite/notochord and intersomitic boundaries in the control side of embryos (Fig. 7J,K). In the Dg-ΔCyto mRNA-injected side, the laminin was present at the somite/notochord boundaries, but its deposition at the intersomitic junctions was severely disrupted (Fig. 7J,L). Interestingly, the fluorescence appeared sparse and discontinuous within the putative somites (Fig. 7L). Using an antibody to GFP to detect mutant Dg-ΔCyto proteins, we showed that somitic cells expressing the Dg-ΔCyto proteins were also stained by the anti-laminin antibodies (Fig. 7M,N). This result indicated that cells expressing the Dg-ΔCyto were able to bind the laminin on their surface but the polymerization of this extracellular matrix component was disrupted when the cytoplasmic domain of Dg was absent.

Together, these findings demonstrate that Dg depletion severely disrupts the extracellular laminin deposition at the intersomitic boundaries but it does not alter the localization of fibronectin and integrins of the β1 family. They also show that β1 family integrins cannot compensate for the lack of Dg and cannot accumulate the laminin at the intersomitic boundaries. Finally, they show that somitic cells expressing a cytoplasmic mutant of Dg are able to bind laminin but the correct assembly of this extracellular matrix component at the intersomitic junctions is severely compromised.

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

In this in vivo and in vitro study, we provide several lines of evidence for a fundamental role of Dg in Xenopus laevis somitogenesis. First, inhibition of Dg synthesis or overexpression of the Dg construct lacking the cytoplasmic domain, affected the size, the integrity and the cellular organization within somites, independently of the PSM segmentation. Second, Dg depletion decreased cell proliferation in somites, affected myotome cell elongation, did not disrupt the somitic fate but interfered with the muscular differentiation. Third, somitic cells expressing the cytoplasmic mutant of Dg were able to bind laminin on their surface but the correct laminin assembly at the intersomitic junctions was severely compromised. Finally, the depletion of Dg prevented the laminin deposition without disturbing integrin β1 subunit distribution and fibronectin organization in the extracellular matrix, at the intersomitic boundaries. These data demonstrate that Dg/laminin interactions ensure the matrix laminin deposition at the intersomitic junctions and the cell elongation within somites, two successive steps required for cell orientation, somite organization, and muscle cell differentiation. They also demonstrate that the cytoplasmic domain of Dg is required for the laminin assembly at the intersomitic boundaries.

Dg transcripts are expressed in the Xenopus PSM and persist in somites upon their formation (this study and Moreau et al.,2003). Here, we show that the protein is detected from the onset of somitogenesis and is enriched at intersomitic junctions and at the notochord/somite boundaries. Somitogenesis requires the mediolateral elongation of presomitic cells, the formation of filopodia protrusions at the onset of rotation, the break of adhesive interactions with the ECM at the notochord/somite boundary, the bending of cells around the dorsoventral axis and finally the elongation and alignment of cells parallel to the notochord (Afonin et al.,2006). Dg is present during these events suggesting that Dg/ECM interactions might govern adhesive properties of cells during somitogenesis and muscle formation. To address this question, we carried out loss-of-function experiments with Dg morpholino antisense oligonucleotides and overexpression of a Dg construct that lacks the cytoplasmic domain.

Two oligonucleotides known for targeting the translation of Dg were used (Bello et al.,2008). We tested their specificity in MO-injected embryos by Western blotting of proteins extracted from somites and by indirect immunofluorescence. These two methods showed a specific depletion of Dg with 28 ng of MO. This MO amount was injected into one side of the embryos in the region that will become somites. During the development, embryos exhibited a bend along the anterior/posterior axis with the concave side corresponding to the Dg depleted side. Older embryos had difficulties to swim and presented a circular trajectory. These observations reflect a right/left asymmetry of the dorsal region of the embryos, suggesting that either the segmentation of the PSM or the somitogenesis were affected. We found that the depletion of Dg leads to a normal segmentation of the PSM, because repetitive units have been observed. As development occurs, the repetitive units give rise to abnormal somites, reduced in number and smaller in sizes. Abnormal somite boundary formation was also observed with a later loss of the canonical chevron-like conformation. Because the proliferation of premyoblasts is known to be an early step of the myogenesis, one hypothesis was that the depletion of Dg could increase apoptosis during the somites development. We did not observe fragmented nuclei or pycnotic cells after MO injections making this possibility rather unlikely. However, we cannot exclude that apoptosis occurs before the stages that we have analyzed, for instance in younger embryos, during the segregation between the notochord and the paraxial mesoderm at neurulation. Another possibility would be that the depletion of Dg affects cell proliferation in developing somites. In agreement with this hypothesis, we showed a correlation between Dg depletion and a reduction of 38% of cell proliferation, leading to a reduction of the somitic tissue and the muscle mass among older embryos. This suggests that Dg function influences intracellular signaling processes involved in the cell cycle regulation. Previous studies have provided evidence that Dg influences the function of the intracellular phosphatase PTEN, a key molecule regulating several signaling cascades such as the PI3-K/AKT cell survival pathway (Muschler et al.,2002; Sgambato and Brancaccio,2005). Of interest, in cell cultures, Dg has been shown to modulate the cell cycle by affecting extracellular signal-regulated kinase levels (Higginson et al.,2008). Although further studies are required, our results are consistent with those describing the role of Dg in Xenopus kidney development (Bello et al.,2008) and with the hypothesis that Dg is a component of the signaling cascade regulating cell proliferation during early development.

We found that treatment with MO induced changes in somite morphology. One possibility was that it could be the consequence of a disruption of somite specification. We, therefore, investigated whether the PSM was appropriately specified. The data obtained in vivo and in vitro show that, in absence of Dg, the transcript and protein expression patterns of both MyoD and MRF4, the earliest and late markers of muscle cell fate, were not disturbed. Both markers showed appropriate temporal and spatial expression patterns all along somitogenesis suggesting that somitic specifications do not require Dg/ECM interactions. This is in agreement with similar phenotypes and conclusions that have been previously reported in inhibition experiments of the integrin α5 and β1 subunits and of the fibronectin in Xenopus as well as in mice and Zebrafish, in which MyoD expression is not affected (Drake et al.,1992; George et al.,1993; Giacomello et al.,2002; Marsden and DeSimone,2003; Kragtorp and Miller,2007). These data contrast with phenotypes obtained with inhibition of type I cadherins where MyoD is down-regulated (Giacomello et al.,2002). One potential explanation would be that cell–cell interactions have a central role in muscle cell fate, whereas cell–ECM interactions are required in somite formation and maintenance. This would suggest that the observed phenotypes are due to an alteration in the morphological processes during somitogenesis, which may be attributed to an incorrect modulation of interactions between somitic cells and the extracellular matrix.

We have observed that the 12/101 monoclonal antibodies that specifically recognize a not yet identified epitope of the differentiated muscle cells (Kintner and Brockes,1984), appeared weaker on the injected side of embryos and was absent in MO-injected explants, although MyoD and MRF4 are expressed. This apparent discrepancy between in vivo and in vitro data might be due to artifacts of the immunfluorescence analysis. However, we observed the same weaker staining in dominant negative experiments and we did not observe differences in 12/101 staining in both the rescue and the five-nucleotide mismatch MO experiments (see Figs. 5Q and 5R, respectively), making this possibility rather unlikely. It appears more likely that, in Dg depleted cells, differences in 12/101 staining in both in vivo and in vitro conditions might result from changes in tissue environment. Indeed the patterning and the fate determination of somitic cells occur in response to extrinsic signals, produced and secreted from the adjacent tissues in particular the neural tube, the notochord, the surface ectoderm, and the somitic compartment themselves. Candidate molecules for these signaling activities include Sonic Hedgehog, the Wnt proteins, Noggin, and BMP-4 (Yusuf and Brand-Saberi,2006). It is possible that in MO-treated explants, one or more of these proteins are absent or misexpressed leading to an incomplete muscle cell differentiation in synergy with the depletion of Dg and explaining the lack of 12/101 staining that is specific of differentiated muscle cells. This possibility is supported by the fact that control explants are able to contract whereas MO-treated explants do not. On the contrary, in MO treated embryos, the adjacent tissues are present and may provide sufficient signaling molecules to activate the 12/101 epitope expression. However, the depletion of Dg could induce a depletion of a scaffold to which the protein recognized by the 12/101 antibodies could bind and thus localized at the intersomitic junctions. This hypothesis is consistent with reports showing that Dg is required to target proteins to membrane ruffles in fibroblast cells or to the subsarcolemmal compartment of muscle fibers (Spence et al.,2004). Nevertheless, it remains to be determined if this is a direct or an indirect consequence of the Dg loss of function, caused for example by the loss of intersomitic junctions and the subsequent lack of specialization of myoblast cell extremities. The observed difficulties of MO treated embryos to swim may be due to the loss of this somite structural integrity.

Dg depletion and overexpression of the Dg deleted of the cytoplasmic domain results in a dramatic disorganization of the myotome and a misorientation of cells within somites. Nuclei adopted a round shape instead of a typical oval/elongated shape and nuclei were not arranged in regularly spaced stripes suggesting that cells were unable to elongate and to extend parallel to the notochord. Tracing MO-depleted cells with a membrane targeted GFP confirm these results. It is established that the Dg is required in the Drosophila to organize the cytoskeleton and to ensure the cellular polarity of epithelial cells and oocytes in the ovary (Deng et al.,2003). Moreover, the cytoplasmic domain of β-DG interacts with ezrin, a protein able to modulate the actin reorganization and to induce the formation of filopodia at the periphery of cells (Batchelor et al.,2007). Therefore, we propose that cells depleted in Dg rotate but exhibit difficulties to orient within each block because they are unable to anchor to the intersomitic ECM. So, they cannot provide the traction required to extend during their alignment leading to a random distribution of cells in the myotome. In agreement with this possibility, we have observed that the depletion of Dg affects the intersomitic cohesion and the organization of somitic boundaries.

Dg binds by means of its α-subunit to laminin-1 (Ervasti and Campbell,1993), laminin-2 (Talts et al.,1999), and laminin-10/11 (Yu and Talts,2003). In laminin-1, laminin-2, and laminin-10/11, the association with Dg has been mapped within the LG4, LG1-3 plus LG4-5, and LG4-5 regions of their α-chains, respectively (Talts et al.,1999; Yu and Talts,2003). The polyclonal antibody L9393 recognized the laminin β1 or γ1 chains in addition to the isoform specific laminin α1 chain. Laminin isoforms prevalent during Xenopus somitogenesis have not yet been elucidated. During mouse somitogenesis, laminin α1 has been detected in dermomyotome (Tiger and Gullberg,1997) and it has been shown to be expressed in somite/notochord area in Zebrafish (Pollard et al.,2006). Therefore, one possibility is that Dg might bind laminin-1 during Xenopus somitogenesis. Because other laminin chains like the α2, α4, and α5 have overlapping functions with laminin α1 chain (Pollard et al.,2006), we cannot exclude that these chains participate also to Dg binding. Although further studies are needed, our results demonstrate that Dg expressed by myoblasts has a pivotal role in laminin deposition at somite boundaries but not at somite/notochord junction.

In this study, we have shown that laminin is present around the notochord in both the Dg-depleted embryos and Dg-cytoplasmic mutants but it is absent at the intersomitic junctions. We observed that laminin is absent in both MO-treated embryos and explants but somitic cells expressing the Dg-cytoplasmic mutant bind laminin to their cell surfaces. Moreover, our data show that fibronectin is deposited in the ECM at both the somite/notochord and the intersomitic junctions, in MO treated embryos. They also show that the integrin β1 subunit is expressed on Dg-depleted cells but that they do not accumulate laminin. Integrins are required in mice, chick, and Zebrafish for somite boundary formation (Yang et al.,1999, Zagris et al.,2004; Koshida et al.,2005; Bajanca et al.,2006). In mouse embryonic stem cells, Dg-laminin interaction have been shown to be essential for the initial binding of laminin to cell surface, whereas β1-integrins were required for subsequent laminin–matrix assembly (Henry et al.,2001). In Xenopus laevis, an ECM containing fibronectin and laminin is deposited at the somitic boundaries throughout somitogenesis (Wedlich et al.,1989; Fey and Hausen,1990; Danker et al.,1992; this work). Fibronectin appears in the first steps of somitogenesis, during rotation, whereas laminin occurs after somites have already been formed (Wedlich et al.,1989). A dominant negative form of integrin β1 subunit alters somite formation (Marsden and DeSimone,2003). Knockdown of the α5 integrin prevents fibronectin deposition in the matrix and cell rotation within somites (Kragtorp and Miller,2007). Together these findings suggest that Dg and β1-integrin functions are nonoverlapping during somitogenesis and support the following model for integrins and Dg functions during Xenopus laevis somitogenesis (Fig. 8). In this model, integrin/fibronectin interactions allow fibronectin fibrillogenesis at the intersomitic junctions and rotation of somitic cells (Wedlich et al.,1989; Danker et al.,1992; Kragtorp and Miller,2007), whereas Dg/laminin interactions ensure the deposition of laminin in the intersomitic matrix and the elongation of cells within somites. These two steps are required for cell orientation, intersomitic cohesion and organization, and then muscle cell differentiation. Later in development, both Dg and integrin/ECM interactions are involved in the maintenance of somite boundaries and then in somite cohesion and integrity.

thumbnail image

Figure 8. Model of dystroglycan function during Xenopus somitogenesis. Diagram illustrating how Dg may contribute to somitogenesis. During gastrulation, presomitic cells of the paraxial mesoderm intercalate radially and mediolaterally and separate from the rest of the mesoderm (Keller,2000). They establish interactions with the extracellular matrix (ECM) at the notochord/somite boundaries. Interactions between α5 integrins and fibronectin allow cells to bend anteriorly and to undergo a 90° rotation relative to the anteroposterior axis (Kragtorp and Miller,2007). The model predicts that after their rotation the somitic cells expressing Dg assemble laminin in the ECM at the intersomitic boundaries. Then, cells anchor to the fibronectin/laminin matrix, elongate and align parallel to the notochord. Finally, both integrin/fibronectin and Dg/laminin systems function cooperatively in maintaining somite boundaries and later somite cohesion and integrity. (Adapted from Alfonin et al.,2006.)

Download figure to PowerPoint

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Xenopus laevis Embryos and Animal Cap Assays

Xenopus laevis embryos were obtained as previously described (Bello et al.,2008). At stage 9 (Nieuwkoop and Faber,1967), the presumptive ectoderm explants (animal cap) were isolated in 1× MBS (Modified Barth's Saline) and induction of muscle was obtained by incubation for 1 hr in 10 ng/ml of activin (A4941 Sigma). Then explants were cultured in 1× MBS until the appropriate stage.

Morpholino and Microinjections

Two specific antisense morpholino oligomers (Dg-MO1 and Dg-MO2) were used in this study, and the sequences were 5′ CAGCACACCTAATATCCATTTTGGC 3′ (Dg-MO1) and 5′TGTTACAGCGTAGGAGGCA 3′ (Dg-MO2). GenBank searches failed to detect significant homologies of the two morpholinos elsewhere in the Xenopus genome. Gene Tools MO-standard (5′ CCTCTTACCTCAGTTACAATTTATA 3′) and a five-nucleotide mismatch Dg-MO (5′ TcTTAgAGCcTAGcAGGgA 3′) were used for control morpholino injections. The morpholinos were suspended in sterile water to a concentration of 1 mM. Morpholino oligos were injected at the two- or four-cell stage into one or both blastomeres depending on the experiment.

Plasmid Constructs and mRNA Injection Experiments

Two constructs were engineered from Dg cDNA cloned into the EcoRI and XhoI sites of the polylinker of the pBluescript II SK (+) vector (Moreau et al.,2003): the wild-type dystroglycan (Dg-wt), and a construct, which the β-cytoplasmic domain was deleted (Dg-Δcyto). The constructs were amplified by polymerase chain reaction (PCR), subcloned in the pcR II-TOPO vector (Invitrogen), and sequenced. The dystroglycan constructs were then cloned into the pCS2 mycGFP vector as described previously (Bello et al.,2008). A GFP-expression plasmid in the pCS2 vector was also used. Synthetic capped mRNAs were made by in vitro transcription as described in Djiane et al. (2000). Embryos were injected at the two, four or eight-cell stage with Dg-wt, Dg-Δcyto mRNAs or membrane-tagged GFP mRNA into the mediolateral zone of blastomeres to target the region that will give rise to the paraxial mesoderm.

Western Blot Analysis

At stage 24, dorsal regions were removed in 1X MMR and explants were homogenized in lysis buffer (1% Triton X100, 150 mM NaCl, pH 7.5, 10 mM Tris, 1 mM ethylenediaminetetraacetic acid [EDTA], 1 mM ethyleneglycoltetraacetic acid [EGTA], 0.5% NP40, 0.2 mM phenylmethyl sulfonyl fluoride [PMSF]) supplemented with protease inhibitors. Protein samples, separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, were transferred onto nitrocellulose (Hybond) as described by Towbin (Towbin et al.,1979). The membrane blocked in 1% bovine serum albumin was incubated with the mouse anti-β dystroglycan antibody (43DAG1/8D5, Novacastra, Newcastle-upon-Tyne, UK, 1:25), and then with the anti-mouse antibody conjugated with biotin (Jackson ImmunoResarch 715-065-150, 1:20,000) and streptavidin coupled to peroxidase (Immunotech 016-030-084, 1:10,000). The revelation was made by chemiluminescence (kit super signal West Pico Chemioluminescent substrate, Pierce).

Synthesis of Probes and Whole-Mount In Situ Hybridization

Plasmids were incubated with the appropriate restriction enzyme, BamHI or ApaI. Transcription was realized using Sp6 RNA polymerase and probes were synthesized with a DIG labeling kit (Roche). Embryos were fixed in MEMFA (0.5 M MOPS, pH 7.4, 100 mM EGTA, 1 mM MgSO4, 4% formaldehyde) for 1 hr and stored in methanol until used. Whole-mount in situ hybridizations were carried out as described by Harland (Harland,1991). Probes were visualized with anti-DIG antibody coupled to alkaline phosphatase (Roche 11093274910, 1:2,000) and 5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium (BCIP/NBT; Sigma) for the color reaction.

Immunochemistry

Whole-mount immunostaining.

Embryos fixed in MEMFA were incubated with a muscle specific 12/101 antibody (DSHB I9393, 1:1,000) and with the anti-mouse secondary antibody alkaline phosphatase-conjugated (Jackson Immunoresearch 115-056-062, 1:40,000). BCIP/NBT was used for the color reaction.

Immunostaining of frozen sections.

Embryos were embedded with 15% cold-water fish gelatin (FLUKA, biochemika) and 15% sucrose. Tissues were sectioned at 14-μm thickness by a cryostat (Leica CM 3050S). Sections were blocked in 20% goat serum and the following primary antibodies were used: mouse anti-β dystroglycan (43DAG1/8D5, Novacastra, Newcastle-upon-Tyne, UK, 1:50), mouse monoclonal 12/101 (DSHB I9393, 1:2,000), rabbit anti-laminin (Sigma L9393, 1:25), mouse anti-MyoD (D7F2, DSHB), guinea pig anti-MRF4 (kindly provided by Dr. B. Della Gaspera, Université Paris 5, France, 1:50), mouse anti-β1 integrin (8C8, kindly provided by Dr. D. Alfandari, University of Massachusetts, Lowell, MA; 1:400), mouse anti-fibronectin (4H2, kindly provided by Dr. D. DeSimone, University of Virginia, Charlottesville, VA; 1:100). After washing they were incubated with the appropriate secondary antibodies: anti-mouse CY3 conjugated (Sigma C2181, 1:100), anti-rabbit fluorescein isothiocyanate (FITC) conjugated (Jackson Immunoresearch 111-095-144, 1:40), anti-guinea pig Alexa 488 conjugated (Invitrogen A11073, 1:500). Nuclei were stained with Hoechst H33258 (Sigma, 1:1,000). Sections were washed and mounted in Immunomount (Thermo electron corporation).

All imaging was done at room temperature. Light micrographs were taken using a stereoscopic microscope Nikon SM2 1500 equipped with a digital camera Nikon DMX1200 and the image acquisition software LUCIA. Immunofluorescent staining was imaged using a Nikon Eclipse E800 microscope equipped with a QEi Evolution camera (Media Cybernetics; ARC N° 7867). A ×4 (Plan 0.1 NA), ×10 (Plan-apochromat 0.45 NA), ×20 (Plan-apochromat 0.75 NA), or ×40 (Plan-apochromat 0.95 NA) were used and the image acquisition software was Image-Pro Plus. The figures were created using Photoshop CS2 software (Adobe) and when the brightness and contrast of the whole image needed adjustment, the brightness/contrast adjustment function was used.

TUNEL Staining and Proliferation Assays

Embryos (n = 10) were fixed and sectioned. TUNEL staining was carried out following the protocol as previously described (Bello et al.,2008). Sections were mounted in Immunomount (Thermo electron corporation), and positive cells were counted in somite areas in both the control and the injected sides.

Proliferation assays were performed in myotome sections of embryos (n = 8) stained with the rabbit anti-human phospho-Histone H3 antibody (Ser 10, mitosis marker, Euromedex H5110-14B, 1:500) and the anti-rabbit alkaline phosphatase-conjugated (Jackson Immunoresearch 111-055-144, 1:5,000). Positive cells were counted in both the injected and the uninjected sides through the microscope at a magnification of 100 and in nonoverlapping fields.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

We thank Dr. D. Alfandari (funding NIH DE016289, Department of Veterinary and Animal Sciences, University of Massachusetts, Lowell, MA) for providing reagents (the anti-β1 integrin subunit antibody) and helpful comments during this project and for critical comments on the manuscript. We also thank M. Brockop and Dr. A. Gaultier (UCSD, Department of Pathology, La Jolla, CA) for reading and comments on the manuscript. We also thank Dr. B. Della Gaspera (Université Paris 5, France) for providing the XMRF4 plasmid and antibody. We thank Dr. D. DeSimone (University of Virginia, Charlottesville, VA) for providing the anti-fibronectin antibody. We thank Dr. F. Broders (Institut Curie, CNRS-UMR 144, Paris, France) for the XMyoD probe. The Anti-MyoD antibody developed by J. Gurdon and H. J. Standley, and the 12/101 antibody developed by J. P. Brockes were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, IA 52242. M.H. received a predoctoral fellowship from P13 University.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES