SEARCH

SEARCH BY CITATION

Keywords:

  • somatic cell nuclear transfer (scNT);
  • pig;
  • depigmentation;
  • Waardenburg syndrome-related genes;
  • Methylation;
  • Kit gene

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. REFERENCES

Previously, we have successfully produced nine cloned piglets using Duroc donor cells. Among these clones, one showed distinct depigmentation of the skin and hair color during puberty. In this study, we selected a clone with depigmentation to investigate the etiology of the anomaly in somatic cell nuclear transfer. We hypothesized that genes related to Waardenburg syndrome (Mitf, Pax-3, Sox-10, Slug, and Kit) are closely associated with the depigmentation of pig, which was derived from somatic cell nuclear transfer (scNT). Total RNA was extracted from the ear tissue of affected and unaffected scNT-derived pigs, and the transcripts encoding Mitf, Pax-3, Sox-10, and Slug, together with the Kit gene, were amplified by reverse transcription-polymerase chain reaction, sequenced, and analyzed. The cDNA sequences from the scNT pig that showed progressive depigmentation did not reveal a mutation in these genes. Although we did not find any mutations in these genes, expression of the genes implicated in Waardenburg syndrome was severely down-regulated in the affected scNT pig when compared with unaffected scNT pigs. This down-regulation of gene expression may result in a previously undescribed phenotype that shows melanocyte instability, leading to progressive loss of pigmentation. Developmental Dynamics 238:1701–1708, 2009. © 2009 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. REFERENCES

Nuclear transfer (NT) technology can be used to clone desirable adult genotypes and phenotypes, and thus is a valuable tool for agricultural and biomedical purposes (Schnieke et al,1997; Betthauser et al.,2000; Onishi et al.,2000; Polejaeva et al.,2000; Bondioli et al.,2001; Lai et al.,2002; Wilmut and Paterson,2003). However, a growing number of studies have suggested that even those somatic cell NT (scNT) -derived clones that survive to adulthood may carry subtle genetic abnormalities that could cause medical problems in later life (Humpherys et al.,2002; Park et al.,2004,2005; Cho et al.,2007).

The pigment for the hair shaft is generated solely by the follicular melanocytes, which reside above the dermal papillae and adjacent to the keratinocytes. The keratinocytes take up pigment from the melanocytes and incorporate it into the growing hair shaft (Tobin et al.,1999). During early anlagen, stem cell factor (SCF) and its receptor Kit signaling is vitally important for both melanocyte proliferation/differentiation and proper pigment production. Without SCF/Kit signaling during anlagen, melanocytes are absent or are unable to pass melanin to the growing keratinocytes (Botchkareva et al.,1999,2001). The result is the development of hair follicles that are partially or completely devoid of color. In mammals, many white spotted or banded coat color patterns have been traced to loss-of-function mutations in the dominant genetic loci white spotting (W) and steel (Sl), which encode, respectively, Kit and SCF (Chabot et al.,1988; Zsebo et al.,1990; Halaban and Moellmann,1993). Specifically, gene duplication and splice mutations in W are responsible for the white coat color of Large White pigs, whereas an inversion mutation in W causes the rump white color pattern in mice (Stephenson et al.1994; Marklund et al.,1998).

Similarly, Waardenburg syndrome (WS, which is manifest by deafness with pigmentary abnormalities) is a congenital disorder of humans that is caused by defective function of the embryonic neural crest (Sánchez-Martín et al.,2002). Depending on the presence of additional symptoms, WS is classified into four types: WS1, WS2, WS3, and WS4. The WS1 and WS3 forms are caused by mutations in PAX3, whereas WS2 is heterogeneous and is caused by mutations in the microphthalmia (MITF) gene in some but not all affected families (Tassabehji et al.,1992,1994; Semenza,1994; Latchman,1996). The WS4 phenotype can result from mutations in the endothelin-B receptor gene (EDNRB), in the gene for its ligand, endothelin-3 (EDN3), or in the SOX10 gene (Bondurand et al.,2000). The identification of Slug, a zinc-finger transcription factor expressed in migratory neural crest cells, as the gene responsible for pigmentary disturbances in mice prompted us to analyze the role of its human homolog, SLUG, in neural crest defects. Slug is a downstream molecular target of the Kit-signaling pathway, suggesting that some patients with human piebaldism may likewise have abnormalities in the SLUG gene (Pérez-Losada et al.,2002). In the present study, to gain more insight into the genetics of the depigmented scNT pig, we assessed gene expression and methylation patterns by comparing depigmented scNT cloned pigs with normal scNT cloned pigs used as controls.

RESULTS AND DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. REFERENCES

Production of scNT Piglets

NT was performed according to one of our established protocols (Yin et al.,2003, Park et al.,2004, Cho et al.,2007, Lee et al.,2007), and 1- to 2-cell stage embryos derived from the reconstructed embryos were surgically transferred into the oviducts of 10 synchronized recipient gilts. Pregnancy was determined by ultrasound visualization of fetuses between days 34 and 42 of gestation. Of the 10 recipients, 2 became pregnant: 1 produced 2 live piglets and 1 dead fetus, and the other produced 6 live piglets by means of vaginal delivery, one of which died during the initial suckling period (Yin et al.,2003). Among the piglets, one clone showed distinct depigmentation of skin and hair during puberty (Fig. 1). Four of the cloned pigs, including the depigmented clone, are still alive 5 years after birth.

thumbnail image

Figure 1. Depigmentation of somatic cell nuclear transfer (scNT) cloned pig. A cloned pig showed gradual depigmentation during puberty. A,B: One- and 5-month-old cloned pigs: the insert in (A) shows the pigs at postnatal 3 days. C,D: The coat color of one piglet changed from dark brown to white from 120 days after birth, but areas of the brown coat color (arrows) remained in the depigmented scNT pig.

Download figure to PowerPoint

Copy Number Variations (CNV) and Genotyping Tests Using a Combination of qOLA-CNV and Pyro-Splice in the scNT Pigs

The Kit gene that controls the dominant white phenotype occurs in the pig genome in single or duplicate forms. The two copies are distinguished by a C-to-G base substitution at the 3′-end of the duplicate or normal copy of the gene (Giuffra et al.,2002). This information allows the genotypes to be defined by the ratio of duplicate to duplicate + normal copies of Kit (Pielberg et al.,2003). The copy number test, which is based on pyrosequencing, was applied in combination with the quantitative splice test (Pielberg et al.,2002; Seo et al.,2007; Kasamatsu et al.,2008) to determine the Kit genotypes of depigmented and normal scNT Duroc piglets. As shown in Figure 2A,B, the PCR-OLA test and the Kit RFLP PCR analysis, performed to detect the ratio of duplicate to duplicate + normal Kit copies, demonstrated that the scNT-derived piglets were homozygous (i/i), and were derived from the Duroc breed. Collectively, these observations suggest that the depigmented scNT clone was indeed derived from Duroc donor cell.

thumbnail image

Figure 2. A,B: The genotype was analyzed using Kit RFLP PCR (A) and the PCR-OLA test (B). Peak (a) is from duplicate copies and b is from normal copies of the Kit gene. SM, L, D, and NT indicate size marker, Landrace, Duroc, and somatic cell nuclear transfer-derived cloned pigs, respectively.

Download figure to PowerPoint

Progressive Depigmentation of Hair and Skin Color

Skin samples were taken from unaffected and depigmented cloned pigs for histological evaluation. As shown in Figure 3, histological and immunohistochemical analyses were undertaken using a range of stains and antibodies, including hematoxylin–eosin for general histopathology, Masson-Fontana for melanin, and gp100 (HMB-45) for melanocytes. Mature melanocytes were seen in the hair bulbs of the hair follicles in the unaffected scNT-derived Duroc piglets; the melanocytes were filled with melanin granules, which is characteristic of fully matured melanocytes (Fig. 3, right). In contrast, no melanocytes were seen in the epidermis of the depigmented scNT cloned pig (Fig. 3, left). The cells in the epidermis and hair bulb of the depigmented pig lacked both melanocytes and their precursors, including cells exhibiting intermediate vesicles, premelanosomes, and melanosomes. Furthermore, ultrastructural analysis showed that no pigment granules in the depigmented scNT cloned pig were present in the truly white hair shaft, and that no melanin granules could be detected within the epidermis and dermis.

thumbnail image

Figure 3. Absence of melanocytes in the depigmented somatic cell nuclear transfer (scNT)-Duroc pig. Histological sections of skin tissue from normal (N)- and depigmented (D)-scNT cloned pigs examined for the presence of melanocytes by immunohistochemistry with primary human HMB45 polyclonal antibody (Dako) and Masson-Fontana stain. Arrowhead indicates melanocytes. Ultrastructural analysis (TEM) showed that the melanocytes in the N-scNT cloned pigs were filled with melanin granules (arrow), characteristic of fully matured melanocytes. In contrast, no melanocytes were seen in the epidermis of the D-scNT cloned pig. The insert in the TEM figure demonstrates the location of melanin in the N-scNT Duroc, whereas the D-scNT pig lacks melanin.

Download figure to PowerPoint

Cloning and Differential Expression Profiles of Porcine Genes Related to Waardenburg Syndrome in the Depigmented scNT Pig

It is well known that hair pigmentation is tightly regulated by the genes related to Waardenburg syndrome, such as the genes encoding Mitf, pax-3, Sox-10, and Slug (Tassabehji et al.,1992,1994; Semenza,1994; Latchman,1996; Sánchez-Martín et al.,2002). To determine whether these genes are closely associated with the depigmentation of scNT-derived pig, each gene was amplified using degenerative reverse transcription-polymerase chain reaction (RT-PCR primers; Table 1). These DNA fragments were inserted into the pGEM T easy vector, sequenced, and deposited in GenBank (AY579429 for Mitf; AY579428 for Sox-10; DQ198158 for Slug; AY579430 for Pax-3; Table 1; Fig. 4A). Production of the mRNA of these genes was significantly down-regulated in the depigmented scNT pig compared with that of the control scNT Duroc, as shown by real-time RT-PCR (Fig. 4B). These observations suggest that changes associated with the genes related to Waardenburg syndrome in the depigmented scNT clone may have resulted in the loss of skin and hair color.

Table 1. Primer Sets Used for Cloning, RT-PCR, and Methylation Profilea
GenesPrimer sequencesProducts sizes (bp)GenBank accession no.
  • a

    Abbreviations: W, A or T; R, A or G; Y, C or T; M, A or C; RT-PCR, reverse transcription-polymerase chain reaction.

  • b

    Aligned from human.

  • c

    Aligned from murine.

  • d

    Aligned from bovine.

Degenerative primers for cloning of pig Waardenburg syndrome-related genes
MitfForward5′- GGTGAATCGGATCATCAAGCAAGA -3′229AB006909b & AF222344c AF398689d
 Reverse5′- TACTGCTCCTCCGGCTGCTTGTTTT -3′  
Sox10Forward5′- GATGCCAAAGCCCAGGTGAAGACA -3′339BC018808b & AF047043c
 Reverse5′- TAWTGTCGTATATACTGGCTGCTCC -3′  
SlugForward5′- ACACCTCCTCCAARGAYCACAGYG-3′317R608999b & MMU79550c
 Reverse5′- CCAGGGTCTGGAAAAMGCCTTGCC -3′  
Pax3Forward5′- GCTGGRGCCAATCAACTGATGGCT -3′342U02368b & BC048699c
 Reverse5′- CTGAGGTGARAGGCCATTGCCGAT -3′  
Primers for real-time RT-PCR
MitfForward5′-ACCCTGGATCTCACAGATGG-3′169AY579429
 Reverse5′-CCGAAGAAAGAAGTGGGTCA-3′  
Sox10Forward5′-CCCAGGTGAAGACAGAGACC-3′173AY579428
 Reverse5′-ATAGGGTCCTGAGGGCTGAT-3′  
SlugForward5′-ATCACAGTGGCTCCGAAAGT-3′180DQ198158
 Reverse5′-ACTTCCTAGACTGGGCGTCA-3′  
Pax3Forward5′-TGGCTTTCAACCATCTCATTC-3′168AY579430
 Reverse5′-GTACAGTGCTCGGAGGAAGC-3′  
KitForward5′-TCAGGGAGAACAGCCAGACT-3′173AB250963
 Reverse5′-GGTGGTTGTGACATTTGCAG-3′  
GAPDHForward5′-ATCACCATCTTCCAGGAGC-3′284AF017079
 Reverse5′-AAGTTGTCATGGATGACCTTG-3′  
Primers for cloning of Kit gene promoter after bisulfite treatment
KitForward5′-GAATGTTGGGGATTAATTTTAGTTATTT-3′267AB293553
 Reverse5′-CTCCACCTCTTCTCCCCTATAATATA  
thumbnail image

Figure 4. Cloning and expression of pig Waardenburg syndrome-related genes. A: Each gene was amplified using degenerative reverse transcription-polymerase chain reaction (RT-PCR) primers, inserted into the pGEM T easy vector, sequenced, and deposited in GenBank. B: Differential expression profiles of genes related to Waardenburg syndrome in somatic cell nuclear transfer (scNT) -normal and scNT-depigmented cloned pigs. Bars indicated by different letters differ significantly from each other (P < 0.05).

Download figure to PowerPoint

Methylation Profile of the Kit Gene Promoter in the Depigmented scNT Pig

The signaling of the SCF and its receptor, Kit (membrane-bound Kit; m-Kit), plays an important role in the development, survival, and proliferation of melanocytes, and in melanogenesis. It has been demonstrated in other systems that a soluble form of m-Kit released from the cell surface (s-Kit) regulates SCF signaling, although there have been no reports pertaining to the existence and biological role of s-Kit in melanocytes (Sánchez-Martín et al.,2002). To reconfirm the relationship between low expression of the Kit gene and aberrant DNA methylation, we analyzed both the methylation status and the expression of the Kit gene (Fig. 5). Real-time RT-PCR analysis revealed that the depigmented scNT Duroc pig showed significant down-regulation of Kit production in its skin tissue. As shown in Figure 5, we determined the methylation status of the Kit gene promoter, including exon 1, in the depigmented scNT pig. The depigmented scNT pig exhibited hypermethylation (27.59 ± 3.62%), compared with the amount of methylation of the promoter (20.02 ± 3.01%) shown by control scNT clones. It has been proposed that DNA methylation can influence transcription by directly impeding the binding of transcription factors to their target genes or indirectly by altering chromatin structure following histone modification and nucleosome occupancy within the gene promoter regions (Miranda and Jones,2007). Next, we searched for the transcription factor that acts as a master factor to regulate the expression of the Kit gene. Especially informative was the hypermethylation (53/100) of Sp1 binding sites in the Kit gene promoter sequence (Fig. 5B) in the depigmented scNT pig. In the skin tissue from a normal scNT pig, however, the Sp1 binding sites of the Kit gene promoter sequence were more demethylated (27/100). Compared with the methylation patterns seen in seven different binding sites (sp1, olf-1, GATA-1, USF, AhR, Ik-2, and c-Myb) of the Kit gene promoter in the normal scNT pig, the depigmented scNT pig exhibited very different patterns of methylation. This high heterogeneity may be the result of incomplete epigenetic reprogramming, which resulted in a mosaic-type of methylation status in the depigmented scNT pig. As a result, the expression of Kit in the depigmented scNT pig may be down-regulated compared with that of the normal scNT pig (Fig. 5).

thumbnail image

Figure 5. Methylation profile of the porcine Kit gene promoter and comparative Kit gene expression between control and depigmented somatic cell nuclear transfer (scNT) pig. A: Porcine Kit gene promoter sequence. B: Lollipops represent all examined CG dinucleotides. Black and white circles represent methylated and unmethylated CpGs, respectively. Each line represents a separate clone and each CpG site is shown by its position in the GenBank sequence (AB293553). C: Methylation profile of the porcine Kit gene promoter and comparison of the expression of the Kit gene between control and depigmented scNT pig.

Download figure to PowerPoint

Concluding Remarks

A previous study has reported that white color-derived pigs lack mature melanocytes in the skin as well as precursor stages of melanocytes, as would be anticipated for a Kit mutation (Sánchez-Martín et al.,2002). However, we could not find any association between depigmentation and a mutation in the Kit gene (data not shown). Disorders of pigmentation in mice and humans are in fact attributable to various Kit mutations and/or chromosomal rearrangements. Our data are in contrast to those obtained from mice and humans, in which the findings result from a lesion in the tyrosinase gene. The absence of causative mutations in the depigmented cloned pig is striking. There are several possible reasons for the absence of Kit mutations in the depigmented cloned pig. The PCR-based analysis of genomic DNA used in this study does not detect defects in Kit gene promoter and/or complete or partial gene duplication. Also, somatic mutations were overlooked using our approach. Even though the scNT Duroc pig showed depigmentation of skin and hair without mutations in Kit, it grew to adulthood and showed reasonably good health. Cloned animals are never perfect copies of the original animal, as far as the methylation status and gene duplication are concerned.

After the completion of this manuscript, we received evidence to verify our data. A report described the production of seven second-generation cloned cats from a G1 cloned cat that was initially derived from an odd-eyed cat (the G0 donor cat). Six of the cloned cats have two blue eyes, and only one cat showed odd eyes (Yin et al.,2008). Even though the underlying cause of the depigmentation is unclear, it is possible to suggest that the donor cells may have experienced incomplete reprogramming during cell division in vivo, or during their in vitro propagation and during the cloning process.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. REFERENCES

The animals were maintained and experiments were conducted in accordance with the Kon-Kuk University Guide for the Care and Use of Laboratory Animals.

Isolation and Culture of Porcine Somatic Cells

Fetal fibroblast cells were obtained from an inbred porcine fetus of the Duroc strain (7.5 cm in length). The cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) under 5% CO2 in air at 37°C. After reaching confluence, the cells were passaged. Donor cells were used for nuclear transfer between passages 8 and 15 of culture. The cells were used for nuclear transfer within 3 days of reaching confluence.

In Vitro Maturation of Oocytes

Ovaries were collected from prepubertal gilts at a local slaughterhouse and transported to the laboratory at 25°C–35°C. Antral follicles (2–6 mm in diameter) were aspirated with an 18-gauge needle. Aspirated oocytes that had an evenly granulated cytoplasm and were surrounded by at least three uniform layers of compact cumulus cells were selected and washed three times in Hepes-buffered NCSU-37 with 0.1% PVA. Oocytes were cultured for 20 hr in four-well plates (Nunc, Roskilde, Denmark), each well of which contained 500 μl of NCSU-37 medium supplemented with 10% porcine follicular fluid, 0.6 mmol/L cysteine, 1 mmol/L dibutyryl cyclic adenosine monophosphate (dbcAMP, Sigma, St. Louis, MO), and 0.1 IU/ml human menopausal gonadotropin (hMG, Teikokuzoki, Tokyo, Japan). The oocytes were then cultured without dbcAMP and hMG for another 18–24 hr as previously reported (Yin et al.,2003).

Nuclear Transfer

Nuclear transfer was carried out as described previously (Yin et al.,2003; Park et al.,2004,2005; Cho et al.,2007; Lee et al.,2007). Briefly, the matured eggs with the first polar body were cultured in NCSU 23 medium supplemented with 0.4 mg/ml demecolcine (Sigma) and 0.05 mol/L sucrose for 1 hr. The sucrose was used to enlarge the perivitelline space of the eggs. Treated eggs with a protruding membrane were moved to medium supplemented with 5 mg/ml cytochalasin B (CB) and 0.4 mg/ml demecolcine, and the protrusion was removed with a beveled pipette. A single donor cell was injected into the perivitelline space of each egg and electrically fused by using two direct current pulses of 150 V/mm for 50 μsec in 0.28 mol/L mannitol supplemented with 0.1mM MgSO4 and 0.01% polyvinyl alcohol. The fused eggs were cultured in medium with 0.4 mg/ml colcemid for 1 hr before activation, and then cultured in 5 mg/ml of CB-supplemented medium for 4 hr. The reconstructed oocytes were activated by 2 direct current pulses of 100 V/mm for 20 msec in 0.28 mol/L mannitol supplemented with 0.1 mmol/L MgSO4, and 0.05 mmol/L CaCl2 (Yin et al.,2003, Park et al.,2004). To obtain simultaneously activated oocytes, a group of oocytes was fused and activated with two 50-μsec pulses of 1.5 kv/cm. The activated eggs were then cultured in NCSU-23 medium for 1 or 2 days in an atmosphere of 5% CO2 and 95% air at 39°C.

Estrus Synchronization and Embryo Transfer

Gilts (Duroc x Yorkshire) that were at least 8 months of age served as recipients. Estrus synchronization of the recipients was established as reported previously (Onishi et al.,2000). One or two cells of scNT embryos were then surgically transferred into the oviducts of the synchronized recipients. The pregnancy status of the recipients was determined by ultrasound between days 25 and 30.

Copy Number Variations (CNV) and Genotyping Tests using a Combination of qOLA-CNV and Pyro-Splice in the scNT Pigs

The PCR-OLA test, used to detect the ratio of duplicate versus duplicate + normal Kit copies, was performed as described previously (Giuffra et al.,2002; Pielberg et al.,2002). A PCR was performed in a total 50-μl reaction volume containing 20 ng of genomic DNA, 5 pmol of forward primer (5′-5′-CAA CTA TGC TAC ATC CAG GC-3′), 0.5 pmol of two-tailed reverse primers (5′-GTA ACC GTT CGT ACG AGA ATC GCT GTG GCT CTT TTG AGG TCA G-3′ and 5′-GTA ACC GTT CGT ACG AGA ATC GCT CTG TCT CCA TGG TTT TGC C-3′), 5 pmol of tail reverse primer (5′-CGT TCG TAC GAG AAT CGC T-3′), 2 mM of dNTPs, and 1 unit of Taq DNA polymerase. Forty cycles, which were composed of 30 sec denaturation at 94°C, 30 sec annealing at 55°C, and 30 sec extension at 72°C, were applied. Each 10-μl OLA reaction contained 0.5 pmol of the two allele-specific probes (5′ phosphate-GGGTCATGGCTTGAAAAAGAAAAAAAAAAA, 5′ phosphate-CGATATGACATTCTGGAAATAAAA AAAA- AAAAAAA) and the fluorescent-labeled common probe (5′ fluorescein-GGCTACATACTG TATGATTCCAA), 1.5 units of thermostable Ampligase and reaction buffer (Epicentre Technologies, Madison, WI), and 0.5 μl of the PCR product. After an initial incubation at 95°C for 5 min, the thermocycle profile was repeated 10 times as follows: denaturation at 94°C for 30 sec and probe annealing and ligation at 55°C for 90 sec. After OLA cycling, 1 μl of the resulting product was heat-denatured at 94°C for 3 min, cooled on ice, and loaded onto a sequencing gel. The PCR and pyrosequencing reactions for the analysis of Kit duplication were performed according to a previously published protocol (Pielberg et al.,2003) using PyroMark MD (Biotage, Uppsala, Sweden).

Cloning of Genes Related to Waardenburg Syndrome by Degenerative RT-PCR

To clone and sequence genes related to Waardenburg syndrome, such as Mitf, Pax-3, Sox-10, and Slug, degenerate primers were designed using alignment of known genes from several species. Briefly, total RNA was extracted from ear tissues using TRIZOL reagent (Gibco BRL, Gaithersburg, MD) following the manufacturer's instructions. The obtained RNAs were subjected to RT-PCR using oligo (dT) primer and M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA). The degenerate primer sequences used for RT-PCR are shown in Table 1. The PCR conditions were as follows: (i) denaturation at 95°C for 1 min, (ii) primer annealing at 55°C for 1 min, and (iii) extension at 72°C for 1 min, for 35 cycles. The PCR products have been cloned and deposited in GenBank (accession nos. AY579429, AY579428, DQ198158, and AY579430). All sequencing analyses were performed using an ABI automated sequencer (ABI377 DNA Sequence, Applied Biosystems, Foster City, CA) according to the manufacturer's protocols. To specifically detect the expression of each transcript, real-time RT-PCR was performed with specific primers using a Peltier Thermal Cycler 200 (MJ Research, Reno, NV).

Tissue Analysis

The immunohistochemical staining was conducted according to our previous methods (Park et al.,2003; Cho et al.,2007). Briefly, paraffin section tissue for immunostaining was cleared in histoclear for approximately 10 min and dehydrated in decreasing concentrations of ethanol. Immunohistochemistry was performed according to standard procedures provided by the manufacturer (Oncogene Science Inc., Mouse, Rabbit and Rat UniTect Immunohistochemistry System). Sections were placed in 3% peroxide in pure methanol and 0.1% of pepsin in 0.05 N HCl (pH 2.25) for 30 min to reduce background staining. Sections were washed twice (5 min each) in TBS (0.05 M Tris-HCl, pH 7.4 and 0.85% NaCl) and blocked with normal horse serum diluted in TBS (1:5; NSS-TBS). Sections were incubated overnight with primary human HMB45 polyclonal antibody (Dako) diluted at a concentration of 1:500 in NHS:TBS. One drop of horse serum from ABC Kit was used as a negative control. Excess antibody was removed by washing twice for 5 min with TBS, and then biotinylated secondary IgG was added for 30 min, with a rinsing with 3 changes of TBS for 5 min. Sections were incubated with ABC reagent for 30 min and washed extensively with TBS, and rinsed in 1% Triton-X–phosphate buffered saline for 30 sec. The color reaction was developed with a solution of 0.5% diaminobenzidine in 0.05 M Tris-HCl (pH 7.6) containing 0.01% hydrogen peroxide. After development of the color reaction, sections were washed in water, dehydrated, and mounted with a coverslip.

For transmission electron microscopy, samples were fixed in 2.5% glutaraldehyde in 0.1 M phosphate buffer (pH 6.9), post-fixed in 2% osmium tetroxide in the same buffer, and embedded in a plastic resin according to our previous procedure (Choi et al.,2005). Sections were stained with 5% uranyl acetate in methanol followed by lead citrate and specimens were examined using a JEM-100CX transmission electron microscope (JEOL, Tokyo, Japan) operated at an accelerating voltage of 60 kV.

Genomic DNA Isolation, Bisulfite Treatment, and Analysis of Methylation Profile

Genomic DNA was extracted from ear punches of scNT-derived normal and depigmented piglets and subjected to bisulfite treatment. For amplification of the proximal region of the Kit gene promoter (GenBank AB293553), PCR was performed three times, each time with 3μl of the bisulfite-converted genomic DNA as a template. The primer sets used are shown in Table 1.

Statistics

Data were expressed as median (range) or mean ± standard deviation. Comparisons among groups were tested by one-way analysis of variance to investigate the bivariate correlation. At least three independent experiments were performed, and P < 0.05 was considered statistically significant.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. REFERENCES
  • Betthauser J, Forsberg E, Augenstein M, Childs L, Eilertsen K, Enos J, Forsythe T, Golueke P, Jurgella G, Koppang R, Lesmeister T, Mallon K, Mell G, Misica P, Pace M, Pfister-Genskow M, Strelchenko N, Voelker G, Watt S, Thompson S, Bishop M. 2000. Production of cloned pigs from in vitro systems. Nat Biotechnol 18: 10551059.
  • Bondioli K, Ramsoondar J, Williams B, Costa C, Fodor W. 2001. Cloned pigs generated from cultured skin fibroblasts derived from a H-transferase transgenic boar. Mol Reprod Dev 60: 189195.
  • Bondurand N, Pingault V, Goerich DE, Lemort N, Sock E, Caignec CL, Wegner M, Goosens M. 2000. Interaction among SOX10, PAX3, and MITF, three genes altered in Waardenburg syndrome. Hum Molec Genet 9: 19071917.
  • Botchkareva NV, Botchkarev VA, Chen LH, Lindner G, Paus R. 1999. A role for p75 neurotrophin receptor in the control of hair follicle morphogenesis. Dev Biol 216: 135153.
  • Botchkareva NV, Khlgatian M, Longley BJ, Botchkarev VA, Gilchrest BA. 2001. SCF/c-kit signaling is required for cyclic regeneration of the hair pigmentation unit. FASEB J 15: 645658.
  • Chabot B, Stephenson DA, Chapman VM, Besmer P, Bernstein A. 1988. The proto-oncogene c-kit encoding a transmembrane tyrosine kinase receptor maps to the mouse W locus. Nature 335: 8889.
  • Cho SK, Kim JH, Park JY, Choi YJ, Bang JI, Hwang KC, Cho EJ, Sohn SH, Uhm SJ, Koo DB, Lee KK, Kim T, Kim JH. 2007. Serial cloning of pigs by somatic cell nuclear transfer: restoration of phenotypic normality during serial cloning. Dev Dyn 236: 33693382.
  • Choi YJ, Song H, Kwon DN, Cho SK, Kang SJ, Yoe SM, Kim HC, Lee HT, Park C, Kim JH. 2005. Significant IgG-immunoreactivity of the spermatogonia of the germ cell-depleted testis after busulfan treatment. Anim Reprod Sci 91: 317335.
  • Giuffra E, Tornsten A, Marklund S, Bongcam-Rudloff E, Chardon P, Kijas JM, Anderson SI, Archibald AL, Andersson L. 2002. A large duplication associated with dominant white color in pigs originated by homologous recombination between LINE elements flanking KIT. Mamm Genome 13: 569577.
  • Halaban R, Moellmann G. 1993. White mutants in mice shedding light on humans. J Invest Dermatol 100: 176185.
  • Humpherys D, Eggan K, Akutsu H, Friedman A, Hochedlinger K, Yanagimachi R, Lander ES, Golub TR, Jaenisch R. 2002. Abnormal gene expression in cloned mice derived from embryonic stem cell and cumulus cell nuclei. Proc Natl Acad Sci U S A 99: 1288912894.
  • Kasamatsu S, Hachiya A, Higuchi K, Ohuchi A, Kitahara T, Boissy RE. 2008. Production of the soluble form of KIT, s-KIT, abolishes stem cell factor-induced melanogenesis in human melanocytes. J Invest Dermatol 128: 17631772.
  • Lai L, Kolber-Simonds D, Park KW, Cheong HT, Greenstein JL, Im GS, Samuel M, Bonk A, Rieke A, Day BN, Murphy CN, Carter DB, Hawley RJ, Prather RS. 2002. Production of alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science 295: 10891092.
  • Latchman DS. 1996. Transcrption-factor mutations and disease. N Engl J Med 334: 2833.
  • Lee SY, Park JY, Choi YJ, Cho SK, Ahn JD, Kwon DN, Hwang KC, Kang SJ, Paik SS, Seo HG, Lee HT, Kim JH. 2007. Comparative proteomic analysis associated with term placental insufficiency in cloned pig. Proteomics 7: 13031315.
  • Marklund S, Kijas J, Rodriguez-Martinez H, Ronnstrand L, Funa K, Moller M, Lange D, Edfors-Lilja I, Andersson L. 1998. Molecular basis for the dominant white phenotype in the domestic pig. Genome Res 8: 826833.
  • Miranda TB, Jones PA. 2007. DNA methylation: the nuts and bolts of repression. J Cell Physiol 213: 384390.
  • Onishi A, Iwamoto M, Akita T, Mikawa S, Takeda K, Awata T, Hanada H, Perry AC. 2000. Pig cloning by microinjection of fetal fibroblast nuclei. Science 289: 11881190.
  • Park MR, Cho SK, Park JY, Lee SY, Choi YJ, Kwon DN, Son WJ, Seo HG, Kim JH. 2004. Detection of rare Leydig cell hypoplasia in somatic cell cloned male piglets. Zygote 12: 305331.
  • Park MR, Cho SK, Lee SY, Choi YJ, Park JY, Kwon DN, Son WJ, Paik SS, Kim T, Han YM, Kim JH. 2005. A rare and often unrecognized cerebromeningitis and hemodynamic disorder: a major cause of sudden death in somatic cell cloned piglets. Proteomics 5: 19281939.
  • Pérez-Losada J, Sánchez-Martín M, Rodríguez-García A, Sánchez ML, Orfao A, Flores T, Sánchez-García I. 2002. Zinc-finger transcription factor Slug contributes to the function of the stem cell factor c-kit signaling pathway. Blood 100: 12741286.
  • Pielberg G, Olsson C, Syvanen AC, Andersson L. 2002. Unexpectedly high allelic diversity at the KIT locus causing dominant white color in the domestic pig. Genetics 160: 305311.
  • Pielberg G, Day AE, Plastow GS, Andersson L. 2003. A sensitive method for detecting variation in copy numbers of duplicated genes. Genome Res 13: 21712177.
  • Polejaeva IA, Chen SH, Vaught TD, Page RL, Mullins J, Ball S, Dai Y, Boone J, Walker S, Ayares DL, Colman A, Campbell KH. 2000. Cloned pigs produced by nuclear transfer from adult somatic cells. Nature 407: 8690.
  • Sánchez-Martín M, Rodríguez-García A, Pérez-Losada J, Sagrera A, Read AP, Sánchez-García I. 2002. SLUG (SNAI2) deletions in patients with Waardenburg disease. Hum Mol Genet 11: 32313236.
  • Schnieke AE, Kind AJ, Ritchie WA, Mycock K, Scott AR, Ritchie M, Wilmut I, Colman A, Campbell KH. 1997. Human factor IX transgenic sheep produced by transfer of nuclei from transfected fetal fibroblasts. Science 278: 21302133.
  • Semenza GL. 1994. Transcriptional regulation of gene expression: mechanisms and pathophysiology. Hum Mutat 3: 180194.
  • Seo BY, Park EW, Ahn SJ, Lee SH, Kim JH, Im HT, Lee JH, Cho IC, Kong IK, Jeon JT. 2007. An accurate method for quantifying and analyzing copy number variation in porcine KIT by an oligonucleotide ligation assay. BMC Genet 23: 8191.
  • Stephenson DA, Lee KH, Nagle DL, Yen CH, Morrow A, Miller D, Chapman VM, Bucan M. 1994. Mouse rump-white mutation associated with an inversion of chromosome 5. Mamm Genome 5: 342348.
  • Tassabehji M, Read AP, Newton VE, Hanus R, Balling R, Gruss P, Strachan T. 1992. Waardenburg's syndrome patients have mutations in the human homologue of the Pax-3 paired box gene. Nature 355: 635636.
  • Tassabehji M, Newton VE, Read AP. 1994. Waardenburg syndrome type 2 caused by mutations in the human microphthalmia (MITF) gene. Nat Genet 8: 251255.
  • Tobin DJ, Slominski A, Botchkarev V, Paus R. 1999. The fate of hair follicle melanocytes during the hair growth cycle. J Investig Dermatol Symp Proc 4: 323332.
  • Wilmut I, Paterson L. 2003. Somatic cell nuclear transfer. Oncol Res 13: 303307.
  • Yin XJ, Cho SK, Park MR, Im YJ, Park JJ, Bhak JS, Kwon DN, Jun SH, Kim NH, Kim JH. 2003. Nuclear remodeling and the developmental potential of nuclear transferred porcine oocytes under delayed-activated conditions. Zygote 11: 167174.
  • Yin XJ, Lee HS, Yu XF, Kim LH, Shin HD, Cho SJ, Choi EG, Kong IK. 2008. Production of second-generation cloned cats by somatic cell nuclear transfer. Theriogenology 69: 10011006.
  • Zsebo KM, Williams DA, Geissler EN, Broudy VC, Martin FH, Atkins HL, Hsu RY, Birkett NC, Okino KH, Murdock DC. 1990. Stem cell factor is encoded at the Sl locus of the mouse and is the ligand for the c-kit tyrosine kinase receptor. Cell 63: 213224.