SEARCH

SEARCH BY CITATION

Additional Supporting information may be found in the online version of this article.

FilenameFormatSizeDescription
DVDY_22040_sm_SuppFigS1.tif16KSupp. Fig. S1. Reverse transcriptase-polymerase chain reaction (RT-PCR amplifies Hoxa2 gene from palate at embryonic day (E) 13.5. RT-PCR was performed on RNA isolated from wild-type and Hoxa2 null palate shelves at E13.5. The PCR primers specifically detected Hoxa2 in the wild-type embryos but no signal was observed in the null palates. Forward primer: 5′ ctggatgaaggagaagaaggc and reverse primer: 5′ cggttctgaaaccacactttc.
DVDY_22040_sm_SuppFigS2.tif12950KSupp. Fig. S2. Histological analysis of the palatal shelves (coronal sections) A–H: Sections A,C,E,G are from wild-type embryonic mice embryonic day (E) 12 to E15, and sections B,D,F,H are from Hoxa2−/− E12 to E15 mice. All sections are stained with hematoxylin and eosin.
DVDY_22040_sm_SuppFigS3.tif338KSupp. Fig. S3. Apoptosis is not altered in Hoxa2 null palates. A–F: Wild-type and Hoxa2 null palates at embryonic day (E) 12.5 (A,B), E13.5 (C,D), and E14.5 (E,F) (n = 3) were analyzed by TUNEL to compare the level of apoptosis. Loss of Hoxa2 expression did not lead to altered levels of apoptosis. Representative medial sections are shown. G: Control section is from an E13.5 hindlimb where apoptotic cells are visible.
DVDY_22040_sm_SuppFigS4.tif35151KSupp. Fig. S4. Histological analysis of the hyoid regions of newborn mice with different Hoxa2 genotypes. A–D: Parasagittal sections (A,C) and frontal sections (B,D) of newborn mice stained with hematoxylin and eosin. In both wild-type newborn mouse without a cleft palate (A,B) and Hoxa2 mutant mouse (C,D) with a cleft palate, the hyoglossus (hg) is observed attached to the greater horn of hyoid (Gh).
DVDY_22040_sm_SuppFigS5.tif39KSupp. Fig. S5. Knock down of Hoxa2 expression in palatal explants. a,b: Relative quantity of Hoxa2 mRNA expression (A) and protein expression (B) in palate shelf explants (n = 3) exposed to control retroviral particles and Hoxa2 antisense retroviral particles. Palatal explants were exposed to retroviral particles at E12.5 and E13.5 and grown to stage E15.5.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.