SEARCH

SEARCH BY CITATION

Keywords:

  • zebrafish;
  • brain development;
  • strawberry notch;
  • gene expression

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Our previous study suggested a possible role for Sbno1, a mouse homologue of strawberry notch gene during brain development. In this report, we cloned the zebrafish homologues of sbno, and examined their expression pattern during embryogenesis by whole-mount in situ hybridization. Zebrafish have three sbno genes: one Sbno1 homologue and two Sbno2 homologues, sbno2a and sbno2b. We observed that the expression of sbno1 and sbno2a was initially ubiquitous and gradually became predominant in the central nervous system as development progressed. The expression of sbno2b was observed in non-neural tissues in contrast to the other two genes. sbno1 and sbno2a exhibited higher expression in distinct regions within the nervous system of pharyngula-stage embryos, suggesting possible differing roles for sbno1 and sbno2a during later stages of embryogenesis. Together, the observed gene expression patterns suggest an important role of sbno-family genes during development of the vertebrate central nervous system. Developmental Dynamics 239:1789–1796, 2010. © 2010 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Although vertebrates and invertebrates exhibit different modes of embryogenesis, common gene-families and signaling cascades are used to regulate this process. One well-characterized example is the Notch signaling pathway. Notch is a transmembrane protein that functions as a receptor for the ligands Delta/Serrate. Drosophila notch mutants display several developmental defects, including the notched wing and neurogenic phenotypes. Screening for mutants with notch-related phenotypes in Drosophila identified several molecular components that function in Notch signaling pathway. Among these components, the strawberry notch (sbno) gene is an enigmatic factor (Coyle-Thompson and Banerjee,1993; Majumdar et al.,1997). Drosophila sbno mutants exhibit morphological phenotypes similar to other notch-related mutants in the adult eyes, wings, and legs, and these abnormalities can be rescued by the transgenenic expression of an extra copy of the notch gene (Coyle-Thompson and Banerjee,1993). Although genetic defects of Notch signaling components lead to increase or decrease in neurons through disruption of Notch-mediated lateral inhibition (Beatus and Lendahl,1998; Pavlopoulos et al.,2001; Deblandre et al.,2001; Lai et al.,2001; Ramain et al.,2001; Itoh et al.,2003), lateral inhibition in the ventral neuroectoderm occurs normally and the number of postmitotic neurons remains unchanged in sbno mutants (Coyle-Thompson and Banerjee,1993). Additionally, the lethality and generation of extra-photoreceptor cells in sbno mutants was not rescued by the overexpression of Notch (Coyle-Thompson and Banerjee,1993). These observations suggested that sbno might have a context-dependent function during Notch signaling along with additional roles in other signaling pathways. Consistent with this hypothesis, sbno was recently shown to be involved in EGF signal-dependent regulation of Delta gene expression during differentiation of retinal cells in Drosophila (Tsuda et al.,2002). Although the roles of sbno in Drosophila development are relatively well studied, the function of Sbno-family genes during vertebrate development remains poorly deciphered.

Our previous study suggested that Sbno1 (previously designated to mSno1), a mouse strawberry notch homologue, may be involved in vertebrate brain development (Baba et al.,2006). Within the developing mouse brain, Sbno1 was observed to be expressed throughout the embryonic day (E) 11.5 brain at low levels, predominantly in the striatum and the ventricular zone of the cerebral cortex at E15.5, in the olfactory bulb and the rostral migratory stream at E18.5, and strongly in the olfactory bulb, the hippocampus, and cerebellum of the adult brain (Baba et al.,2006). Although these data hint to a possible role for Sbno1 during brain morphogenesis, a detailed analysis of the embryonic expression of this gene family within other vertebrate species has not been reported to date. In this study, we report the cloning and analysis of the expression pattern of strawberry notch family genes during zebrafish development. Here, we show the presence of three sbno genes, sbno1, sbno2a, and sbno2b, within the zebrafish genome, and further uncover that sbno1 and sbno2a are predominantly expressed in the developing nervous system.

RESULTS AND DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Zebrafish Has Three Strawberry Notch Family Genes

We previously examined the expression pattern of Sbno1 (previously designated mSno1) within the developing mouse brain (Baba et al.,2006). To gain insights into the expression pattern of strawberry notch family genes during zebrafish development, we first sought to identify and clone zebrafish strawberry notch. To identify possible strawberry notch genes, we carried out a blast search using murine strawberry notch sequence and the zebrafish genomic database at Ensembl.org (http://www.ensembl. org) and identified three hypothetical genes (ENSDARG00000027195, ENSDARG00000003882, and ENSDARG00000016188). A comparison of the putative protein sequence (Fig. 1) and generation of a molecular phylogenetic tree (Fig. 2A) revealed that one of these hypothetical genes was the ortholog of Sbno1, and the other two genes were orthologs of a second murine strawberry notch family gene Sbno2 (or tentatively named as KIAA0963). Thus, we designated these genes as sbno1, sbno2a, and sbno2b (Figs. 1, 2). We used rapid amplification of cDNA ends (cRACE) and identified the full-length cDNA sequences of sbno1(accession no. AB540171) and sbno2a (accession no. AB540172) as composed of 4,790 and 4,542 base pairs encoding 1,386 and 1,350 amino acids proteins, respectively. Subsequent searches for sbno-related sequences in databases found a zebrafish putative transcript LOC100005813 (also designated as ENSDARG00000076925), but we found that this is a partial fragment of sbno1. As indicated in Figure 1, two highly conserved regions in this protein family had been defined composed of a DECHx box domain (underlined by blue in Fig. 1) and a helicase C-terminal conserved domain (underlined by red in Fig. 1) corresponding to the SH1 and SH2 regions as described in Tsuda et al. (2002). The presence of these two domains suggests that the strawberry notch family proteins likely have an RNA helicase activity. Sequence conservation within strawberry notch family proteins stretches to vicinities of these defined domains (Fig. 1).

thumbnail image

Figure 1. Amino acid sequence comparison of Strawberry notch (Sbno) family proteins of zebrafish (Danio), mouse (Mus), and fruit fly (Drosophila). Sequence alignment was carried out using MULTALIN web software (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_multalin.html). Red letters indicate identical residues among all six proteins. Green letters indicate residues conserved in more than three proteins. Blue letters indicate NDQEBZ conserved positions (Corpet, 1988). The black underline indicates the amino acid sequence used for the immunoprecipitation assay, and the blue and red lines indicate the DECHx box domain (dark blue indicates DECHx box) and helicase C-terminal conserved domain, respectively, which are conserved regions registered at the NCBI database (http://www.ncbi.nlm.nih.gov/Database/).

Download figure to PowerPoint

thumbnail image

Figure 2. Phylogenetic analysis of Strawberry Notch family proteins and genomic organization of sbno2 genes of vertebrates. A: Phylogenetic Neighbor-Joining (NJ) method tree reconstruction depicting the evolutionary relationships of Strawberry notch family genes and related genes generated by using CLUSTALW (http://align.genome.jp/). Protein sequences used for this analysis are BC019206 (Sbno2), NP_001074672 (Sbno1), AAB54001 (the strawberry notch protein of Drosophila), CG3491-PA (unpublished sbno family protein of Drosophila), BAD02983 (the sbno homologue of Oryza), NP_178053 (the sbno homologue of Arabidopsis), YP_665786 (sbno family protein of Mesorhizobium), Xaut_0720 (sbno family protein of Xanthobacter), NP_085124 (human DICER1), and NP_006819 (human ASC-1 complex subunit 3). B: Representation of the synteny between sbno2 loci on zebrafish chromosome 2 (hosting sbno2a), zebrafish chromosome 22 (hosting sbno2b), chromosome 1 of Tetraodon nigroviridis (which has the smallest known genome within vertebrates), and human chromosome 19.

Download figure to PowerPoint

During additional blast searches, we were able to identify an sbno-related Drosophila gene and also similar genes in plants and bacteria (Fig. 2A). Amino acid sequences of DECHx box domain and helicase C-terminal domain were highly conserved among the animal, plant, and bacterial proteins, suggesting a distinct protein family. These proteins exhibit a close relationship within a molecular phylogenetic tree that includes the outer group proteins that contain both the DECHx box domain and helicase C-terminal domains, including Dicer1 (Fig. 2A).

Because a duplication of the sbno2 gene was not observed in the genome of other teleosts, such as Tetraodon (Fig. 2B) and Fugu (data not shown), we were interested in this unique feature of the zebrafish genome and compared the genomic organization of the sbno2 gene between zebrafish, Tetraodon, and human. A conserved set of genes surrounding the SBNO2 gene in the human and Tetraodon genome (Fig. 2B) indicated an archetypal organization of this region within the vertebrate genome. During zebrafish evolution, it is likely that the genomic region between gpx4 and fgf22 was duplicated, and the genomic sequence between gatad2a and fgf22 was subsequently eliminated from the sbno2a-surrounding region.

Similar Embryonic Expression Pattern of sbno1 and sbno2a

We next examined expression of sbno genes during zebrafish development using whole-mount in situ hybridization (Figs. 3–6). When sbno1 or sbno2a anti-sense RNA, but not negative control probes, were hybridized to fertilized eggs, we observed staining indicating the presence of maternal transcripts, and a similar intensity of staining was obtained in embryos at cell cleavage and blastula stages (Figs. 3A,B, 4A,B). The anterior–ventral region of 90% epiboly-stage embryos termed the evacuation zone (Kimmel et al.,1995) was devoid of sbno1 and sbno2a expression. Following cell movement toward the embryonic axis during gastrulation, the spatial expression of sbno1 and sbno2a became narrowed dorsally (Figs. 3C–E,G, 4C–E) and was then predominant in the central nervous system at the late segmentation stage (Figs. 3E,G,J, 4C,E,H). Expression of sbno1 in the developing eyes was evident from the early segmentation stage (Fig. 3I). Regional differences of the expression levels of sbno1 and sbno2a along the anterior–posterior axis of the neural tube became evident as segmentation progressed (Figs. 3K, 4I), uncovering a spatial difference between the expression of sbno1 and sbno2a. Subsequently in pharyngula-stage embryos (24 hours postfertilization [hpf]), the expression of sbno1 was strong within the eyes and midbrain (Figs. 5A–C, 6B,C), whereas predominant expression of sbno2a was observed within the forebrain (Figs. 5D,F, 6C,D). The otic vesicle expressed both sbno1 and sbno2a during the pharyngula stage (Fig. 5B,E). Within sections of pharyngula-stage embryos (24 hpf), the expression of sbno genes were higher in the cells close to the ventricle and became weaker along the radial axis of the neural tube (Fig. 6B,C,E,F). Expression of sbno1 and sbno2a was strong basically in the dorsal aspect of the neural tube (Fig. 6 B,C,E,F). A similar staining pattern was reported on proliferating cell nuclear antigen (PCNA) expression (Wullimann and Knipp,2000), suggesting that sbno1 and sbno2a are expressed stronger in proliferating cells and down-regulated gradually as neuronal differentiation went on. Consistent to this possibility, early neuron markers, delta A and HuC, are expressed roughly in a pattern complementary (Fig. 6I,L) to that of sbno in the posterior midbrain (Fig. 6C,F) and the hindbrain (data not shown) regions. Significant staining of sbno1 and sbno2a was not observed in the spinal cord of the pharyngulae (Fig. 5C,F). In the eyes of 3 days postfertilization (dpf) embryos, weak but specific expression of sbno genes was observed within the ganglion cell layer and the inner cell layer (Fig. 6M,N). Within the serial sections of in situ hybridization specimens of 3 dpf larvae, weak expression of sbno1 and sbno2a was detected throughout the brain, and we could not observe any distinct region or cell type specificity in their expression (Fig. 6M,N; data not shown). In the developing mouse brain, higher expression of Sbno1 was observed in the ventricular zone of the embryonic neural tube, and weak expression of Sbno1 was also observed throughout the postnatal brain (Baba et al.,2006). Thus, the expression pattern of sbno1 and sbno2a in the developing zebrafish brain was similar to that of Sbno1 in mouse brain at an embryonic and a postembryonic stages.

thumbnail image

Figure 3. Expression pattern of sbno1 during zebrafish embryogenesis detected by whole-mount in situ hybridization. A: A lateral view of early cleavage stage (2 hours postfertilization [hpf]) embryo. B: A lateral view of 50% epiboly stage (5 hpf) embryo. C,D: A 90% epiboly stage (9 hpf) embryo. E,F: A bud stage (10 hpf) embryo. G,H: A 3-somite stage (11 hpf) embryo. I: A 10-somite stage (15 hpf) embryo. J,K: A 18-somite (18 hpf) stage embryo. C,E,G,J are views from animal pole of the in situ specimen. In D,F,H,I,K, lateral views of in situ specimen is shown with ventral to the left.

Download figure to PowerPoint

thumbnail image

Figure 4. The embryonic expression pattern of sbno2a is similar to that of sbno1. A: A lateral view of early cleavage stage (1 hour postfertilization [hpf]) embryo. B: A lateral view of 50% epiboly stage (5 hpf) embryo. C,D: A 90% epiboly stage (9 hpf) embryo. E,F: A bud stage (10 hpf) embryo. G: An eight-somite stage embryo. H,I: An 18-somite (18 hpf) stage embryo. C,E,G, and I are views from animal pole of the embryo. In D, F, G, and I, lateral views of the embryo showing ventral to the left.

Download figure to PowerPoint

thumbnail image

Figure 5. Comparison of expression pattern of sbno1 and sbno2a at pharyngula (24 hours postfertilization [hpf]) stage. A–C: Strong expression of sbno1 was observed in the midbrain (presumptive tectal region) and the eyes at this stage. D–F: Expression of sbno2a is relatively high in the forebrain region at this stage. A and D are focusing on the forebrain region. B and E focus on the hindbrain region. C and F are lateral views of embryos with ventral to the left. fb, forebrain; hb, hindbrain; mb, midbrain; ov, otic vesicle.

Download figure to PowerPoint

thumbnail image

Figure 6. Serial sections of the whole-mount in situ hybridization specimens. A–L: The coronal sections of 24 hours postfertilization (hpf) embryos hybridized to sbno1 (A–C), sbno2a (D–F), delta A (G–I), or HuC (J–L) probes. A,D,G,J: The section 20 to 40 micrometers in depth from the anterior top of the embryos. B,E,H,K: The sections at the anterior midbrain level. C,F,I,L: The sections at the hindbrain level. M,N: The coronal sections of 3 days postfertilization (dpf) larvae at midbrain level hybridized to sbno1 (M) or sbno2a (N) probes. Whole-mount in situ hybridization specimens were embedded in the plastic resin and cut at 10-micrometer thickness. The sections were counterstained by 4′,6-diamidine-2-phenylidole-dihydrochloride (DAPI), and the bright field image showing in situ staining (yellow) and fluorescent image showing DAPI staining (blue) of the same sections were merged. Scale bars = 0.1 mm.

Download figure to PowerPoint

Expression of sbno2b Is Distinct From That of Other sbno Genes

A distinct expression of sbno2b was not detected in early cleavage stage embryos (data not shown), but was observed from the 90% epiboly stage starting in the prepolster region at the animal pole of embryos (Fig. 7A). The prepolster becomes the polster that then differentiates into the hatching gland (Gardiner et al.,2005). However, sbno2b expression within this region became progressively weaker as development went on and it was not detected in the hatching gland (Fig. 7G,H). During gastrulation, expression of sbno2b became stronger in the ventral mesoderm (Fig. 7A,D,E,F). In the pharygula stage embryos, sbno2b expression was observed in the rostral blood island and the intermediate cell mass (Fig. 7G,H). The differentiation of blood cells takes place in cell populations arising from within this region (for review, see Chen and Zon,2009). Expression of sbno2b was also observed in posterior aspects of the notochord of 18-somite stage embryos, but sbno2b expression in these regions was fainter during later stages (24 hpf embryo, Fig. 7H). Expression of sbno2b was also detected in the proctodeum of the pharyngulae (Fig. 7G,H). Thus, while the expression pattern of sbno1 and sbno2a were similar, the expression pattern of sbno2b was quite distinct from that of sbno1 and sbno2a.

thumbnail image

Figure 7. Embryonic expression pattern of sbno2b. A–C: A 90% epiboly stage (9 hpf) embryo. D–F: A bud stage (10 hpf) embryo. G: A 18-somite (18 hpf) stage embryo. H: A pharyngula (24 hpf) stage embryo. A and D are views from animal pole of the embryos. B, E, G, and H are lateral views with ventral to the left. C and F are views from the vegetal pole. Expression of sbno2b was detected in non-neural tissues of embryos, which is distinct from that of the other zebrafish sbno genes. icm, intermediate cell mass; nt, notochord; pd, proctodeum; pp, prepolster; rbi, rostral blood island.

Download figure to PowerPoint

Possible Functions and Transcriptional Regulation of Vertebrate Strawberry Notch Genes

sbno1 is expressed in the developing brain of mouse (Baba et al.,2006), whereas expressed sequence tag (EST) databases, such as UniGene (http://www.ncbi.nlm.nih.gov/UniGene/ESTProfileViewer.cgi?uglist=Mm. 262102), suggest that the embryonic expression of Sbno2 is low. The same databases further suggest that within the adult mouse, Sbno1 expression is high in neural tissues and the genital organs, consistent to our previous results (Baba et al.,2006), whereas the adult expression of Sbno2 is predominantly in blood cells and bone. A similar gene-expression profile is observed between Sbno2 and sbno2b. An additional Sbno2 homologue in zebrafish, sbno2a exhibited a completely different embryonic expression pattern highly indicative of a divergence of gene promoter function. An examination of synteny within the sbno2 loci (Fig. 2B) did not provide any information concerning possible conservation or divergence of transcriptional regulation. sbno1 and sbno2a share an early embryonic gene expression pattern, whereas some differences were also observed as described above. At the pharyngula stage, sbno1 expression was continuously observed higher in the brain, whereas sbno2a expression became weaker (Fig. 5A,B,D,E). It is possible that an evolution of difference in gene expression may confer functional importance to sbno2a in zebrafish. Drosophilastrawberry notch mutants share some phenotypes with that of Notch, implicating sbno as a downstream factor of the signaling pathway (Coyle-Thompson and Banerjee,1993). Consistent with a recent study in Drosophila (Tsuda et al.,2002), we isolated the zebrafish homoloue of Su(H), a transcription factor whose activity is regulated by Notch signaling, in a yeast two-hybrid screen using zebrafish sbno1 as a bait and a zebrafish embryonic cDNA library (Zochi et al., manuscript in preparation). To confirm this interaction, we further performed co-immunoprecipitation assays (Fig. 8). When a partial fragment of sbno1 tagged with Myc (underlined by black line in Fig. 1) and Flag-tagged Su(H)A were expressed in mammalian culture cells, we detected a specific binding between Su(H) and the conserved region of sbno1 spanning the helicase C-terminal conserved domain from nuclear fractions (Fig. 8). In terms of broad and moderate expression throughout the developing neural tissue (accompanying slightly stronger expression in some specific regions), the expression pattern of sbno1 and sbno2a up to the segmentation stage is compatible with that of some Notch signaling genes, including notch receptors (Hsiao et al.,2007); mib, a RING ubiquitin ligase gene, which is essential for Notch signaling activation (Itoh et al.,2003); numb, which is involved in ubiquitination and endocytotic trafficking of Notch receptors (Niikura et al.,2006); and Su(H), the nuclear effector of Notch signal (Sieger et al.,2003; Echeverri and Oates,2007). The interaction observed between sbno and Su(H) (Fig. 8) supports a role for sbno in Notch signaling during zebrafish embryogenesis. On the other hand, the evolutionary origin of the sbno gene family (Fig. 2A) also suggests a possible function of this gene-family outside of Notch-related signaling. The expression of strawberry notch family genes of zebrafish and mouse in the developing brain and mature neurons (Baba et al.,2006; Katsuyama, manuscript in preparation) further suggest an important function of the sbno genes for neuronal differentiation and function.

thumbnail image

Figure 8. Binding of Su(H)A and sbno1 proteins of zebrafish examined by co-immunoprecipitation assay. A: The protein complex was precipitated using anti-Myc antibody, and the precipitate was detected by Western blot analysis using anti-Flag antibody. B: The protein complex was precipitated using anti-Flag antibody, and the precipitate was detected using anti-Myc antibody.

Download figure to PowerPoint

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Fish Embryos

Wild-type zebrafish (Danio rerio) embryos were obtained from natural crosses of fish with the AB genetic background. The embryos were incubated at 28.5°C in E3 embryo medium (Brand et al.,2002).

cDNA Cloning

Using blast searches of the zebrafish genome database (http://www.ensembl.org) with the mouse Sbno1 putative protein sequence (Baba et al.,2006), we identified three predicted transcripts, which are partial sequences of the protein coding region. The cDNA fragments of these genes were amplified by polymerase chain reaction (PCR) using zebrafish embryonic cDNA as a template and specific primers: CCTGGTCAAGATTTGCTTCT GG and CCAGTAAGGCACTTTGAAT GGAG for sbno1, AATCTCTCATCCT GATATCGTGG and CATATCTCTGA AAAACATGAGTCC for sbno2a, and AATGACTCTTTATCAGAATACGCC and TCAGAGTCCATTCTCAACAACT CC for sbno2b. PCR reactions were carried out using BD advantage2 PCR system (BD Biosciences Clontech). The PCR products were cloned in pGEM easy T/A cloning vectors (Promega Co.) and sequenced. To obtain the full-length cDNA sequence of sbno1 and sbno2a, we carried out rapid amplification of cDNA ends (RACE) using specific primers and a zebrafish cDNA library as template. The RACE products were subcloned in pGEM vector and sequenced. The molecular phylogenetic tree of Strawberry notch family proteins was generated by CLUSTALW (http://align.genome.jp/).

Whole-Mount In Situ Hybridization

Digoxigenin-labeled antisense RNA probes were used for whole-mount in situ hybridization. Template DNA of sbno genes used to synthesize antisense RNA probes was PCR product obtained using PCR primers described above. Zebrafish specimens were fixed in 4% paraformaldehyde in phosphate buffered saline (PBS), hybridized, and stained as described previously (Katsuyama et al.,2007). BM purple (Roche) was used as the alkaline phosphatase substrate. After coloring, specimens were post-fixed in 4% paraformaldehyde in PBS, embedded in Technovit8100 (Heraeus Kulzer GmbH & Co.) following manufacturer's protocol, and serially sectioned at 10 micrometers of thickness.

Immunoprecipitation Assays

Protein coding sequence of Su(H)A and a partial fragment of sbno1, indicated by black underline in Figure 1, were amplified from a zebrafish embryo cDNA library and sublconed in pcDNA3 plasmids (Invitrogen) containing tag sequence. COS-7 cells were cultured in DMEM containing 10% fetal bovine serum (FBS) and antibiotics at 37°C in 5% CO2. Transfections were performed in 6-cm plate. Cells were plated at 70–80% confluence 24 hr before transfection and transfected with Lipofectamine2000 (Invitrogen). Whole-cell extracts were prepared 48 hr posttransfection in lysis buffer (0.01 M TrisHCl pH 7.8, 0.15 M NaCl, 1% NP40, 1 mM ethylenediaminetetraacetic acid [EDTA]) in the presence of protease inhibitors (Halt Protease Inhibitor Cocktail EDTA-free, Pierce Biotechnology, Rockford, IL). Nuclear and cytoplasmic fractions were prepared using the NE-PER Nuclear and Cytoplasmic Extraction System (Pierce). Protein concentrations were measured using the Bio-Rad Protein Assay (Bio-Rad Laboratorie). Extracts and fractions were then analyzed for protein expression by Western blotting or used in co-IP assays.

COS-7 whole-cell extracts (2 mg) or nuclear/cytoplasmic fractions (1 mg) were incubated with an anti-Myc (9E10, Santa Cruz) or anti-Flag (anti-DDDDK-Tag, MBL) antibody and were precipitated with recombinant protein G (rProtein G) agarose (Invitrogen) overnight at 4°C. The resin was then washed three times with PBS and bound-protein were eluted by boiling in 2× sodium dodecyl sulfate (SDS) sample buffer for 5 min, 25% of the precipitated reaction was resolved by SDS-polyacrylamide gel electrophoresis, proteins were transferred to polyvinylidene difluoride membranes and analyzed by Western Blot analysis.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

We thank members of the Division of Anatomy and Developmental Neurobiology, Kobe University Graduate School of Medicine and The Laboratory for Vertebrate Body Axis, CDB RIKEN for their support throughout this study. We also thank Dr. Raymond Habas (Department of Biology, Temple University) for critical reading of this manuscript. This work was supported by a research grant from Japan Society for the Promotion of Science to A.T.; a grant-in-aid from the Ministry of Education, Culture, Sports, Science, and Technology of Japan to Y.K., and T.T.; and Shourei-Kenkyu-Josei of the Hyogo Science and Technology Association to Y.K.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES