Expression patterns of sulfatase genes in the developing mouse embryo

Authors

  • Andreas Ratzka,

    1. Center for Medical Biotechnology, University of Duisburg-Essen, Essen, Germany
    2. Development and Disease Group, Max Planck Institute for Molecular Genetics, Berlin, Germany
    Current affiliation:
    1. Department of Neuroanatomy, Hannover Medical School, Carl-Neuberg-Straße 1, 30625 Hannover, Germany
    Search for more papers by this author
  • Stefan Mundlos,

    1. Development and Disease Group, Max Planck Institute for Molecular Genetics, Berlin, Germany
    Search for more papers by this author
  • Andrea Vortkamp

    Corresponding author
    1. Center for Medical Biotechnology, University of Duisburg-Essen, Essen, Germany
    • University of Duisburg-Essen, Center for Medical Biotechnology, Universitätsstraße 2, 45141 Essen, Germany
    Search for more papers by this author

Abstract

Mammalian sulfatase enzymes participate in various processes, such as hormone regulation, lysosomal degradation and modulation of several signaling pathways. The sulfatase gene family consists of 14 members in mice and 17 in humans. Mutations of at least eight members are associated with human disorders, with main disease manifestations in the nervous system and skeleton. Despite their biological significance, little is known about their expression during embryonic development, especially for the more recently discovered gene family members. By in situ hybridization, we compared the expression patterns of nine sulfatases: ArsB, ArsG, ArsI, ArsJ, Galns, Gns, Ids, Sulf1, and Sulf2 in midgestation mouse embryos. Of interest, overlapping expression domains of several sulfatases could be detected in the developing central nervous system, eye, skeleton, and inner organs. Moreover, novel expression patterns for ArsG in choroid plexus, ArsI in hypertrophic chondrocytes and ArsJ in joints were identified. Developmental Dynamics 239:1779–1788, 2010. © 2010 Wiley-Liss, Inc.

INTRODUCTION

Highly sulfated glycosaminoglycans, such as chondroitin sulfate (CS) or heparan sulfate (HS), have been identified to play critical roles for proper embryonic development (Grobe et al.,2002; Schwartz and Domowicz,2002; Gorsi and Stringer,2007; Lamanna et al.,2007; Ishii and Maeda,2008). During biosynthesis in the Golgi compartment, specific glycosyltransferases catalyze the synthesis of long polysaccharide-chains. These are subsequently modified by a variety of sulfotransferases generating a tissue-specific pattern of sulfation, which is required for proper growth factor signaling, activation, and receptor binding (Kusche-Gullberg and Kjellén,2003; Chapman et al.,2004; Ledin et al.,2004). The opposing reaction, the removal of sulfate groups, is catalyzed by specific sulfatases, for example during HS degradation in the lysosome. The sulfatase gene family encodes for enzymes, which catalyze the hydrolysis of sulfate ester bonds from a wide range of substrates, such as glycolipids, steroids, and highly sulfated carbohydrates, such as CS or HS (Table 1). Nevertheless, the individual sulfatases operate highly substrate-specific. The 2-O-sulfate groups of HS glucosamine are, for example, hydrolyzed by iduronate-2-sulfatase (Ids) but not by glucosamine-6-sulfatase (Gns), which specifically hydrolyses the HS 6-O-sulfate groups (Hanson et al.,2004). Based on the high degree of sequence conservation of the N-terminal regions, 17 human and 14 mouse sulfatase genes have been identified (Sardiello et al.,2005). Amongst these, three groups of closely related sulfatases can be distinguished. The first group comprises arylsulfatase B (ArsB), ArsI, and ArsJ; the second group ArsC and ArsE (plus ArsD, ArsF, ArsH in humans); and the third group Gns, Sulf1, and Sulf2 (Franco et al.,1995; Morimoto-Tomita et al.,2002; Obaya,2006). However, the individual family members have been investigated to different degrees. For example, ArsA, ArsB, and ArsC have been deeply analyzed, with regard to their natural substrate, biological function, and crystal structure, whereas for the more recently discovered family members, ArsG, ArsI, ArsJ, and ArsK, barely more than their sequences are known.

Table 1. Murine Sulfatases, Substrates, Expression Domains, and Associated Human Disordersa
GeneSulfatases (synonym)Physiological substratesExpression domains in this studyAssociated human disorders
  • a

    Abbreviations: br, brain; co, cornea; cp, choroid plexus; CS, chondroitin sulfate; dg, dorsal root ganglia; DS, dermatan sulfate; GalN, galactosamine; GlcN, glucosamine; hc, hypertrophic chondrocytes; HS, heparan sulfate; IdoA, iduronic acid; KS, keratan sulfate; le, lens epithelium; nbl, neuroblastic layer; ocm, optic cup margin; pc, proliferating chondrocytes; phc, prehypertrophic chondrocytes; rpe, retinal pigmented epithelium; S, sulfate; sc, spinal cord. Table modified from Hanson et al. (2004), Diez-Roux and Ballabio (2005), Sardiello et al. (2005).

ArsAArylsulfatase Asulfo-glycolipids (sulfatide)not detectedMetachromatic leukodystrophy
ArsBArylsulfatase BCS, DS (4-O-S GalN)boneMucopolysaccharidosis type VI (Maroteaux-Lamy syndrome)
ArsC (Sts)Arylsulfatase C (Steroid sulfatase)steroid sulfatesnot detectedX-linked Ichtyosis
ArsEArylsulfatase Eunknownnot detectedChondrodysplasia punctata 1
ArsGArylsulfatase Gunknownchoroid plexus 
ArsIArylsulfatase Iunknowncartilage (phc, hc), eye (le), notochord, stomach 
ArsJArylsulfatase Junknowncartilage (joints) 
ArsKArylsulfatase Kunknownnot detected 
GalnsGalactosamine- 6-sulfataseCS, KS (6-O-S GalN)ubiquitous, eye (le, ocm)Mucopolysaccharidosis type IVA (Morquio A syndrome)
GnsGlucosamine- 6-sulfataseHS, KS (6-O-S GlcN)ubiquitous, bone, dg, eye (le, rpm), floor plate, spleenMucopolysaccharidosis type IIID (Sanfilippo D syndrome)
IdsIduronate-2-sulfataseHS, DS (2-O-S IdoA)neuronal tissues (br, dg, sc, nbl)Mucopolysaccharidosis type II (Hunter syndrome)
SgshN-sulfoglucosamine- sulfohydrolase (Sulfamidase)HS (N-S GlcN)not detectedMucopolysaccharidosis type IIIA (Sanfilippo A syndrome)
Sulf1Sulfatase 1HS (6-O-S GlcN)bone, cartilage (joints, hc), choroid plexus, eye (le), floor plate, gonad, heart, lung, mesenchyme, stomach 
Sulf2Sulfatase 2HS (6-O-S GlcN)bone, cartilage (joints, pc), eye (co, nbl), floor plate, heart, kidney, lung, mesenchyme, stomach 

Based on their subcellular localization, sulfatases are classified into lysosomal sulfatases, such as ArsA, ArsB, Ids, N-sulfoglucosamine-sulfohydrolase (Sgsh), Gns, and galactosamine-6-sulfatase (Galns) or a heterogeneous group of nonlysosomal sulfatases, which are localized in microsomes (ArsC), endoplasmatic reticulum (ArsD, ArsF, ArsG, ArsI, ArsJ), Golgi apparatus (ArsE), or the cell surface (Sulf1, Sulf2; Diez-Roux and Ballabio,2005). Recently ArsA and ArsB, which have been classified as lysosomal proteins, have been localized on the cell surface of adult mouse and rat hepatocytes, sinusoidal endothelial cells and sinusoidal macrophages (Mitsunaga-Nakatsubo et al.,2009), indicating that the subcellular localization might at least in part be cell-type specific. Additional, unexplored functions might therefore be carried out by these sulfatases outside the cell. Of interest, the previously identified extracellular HS sulfatases (Sulf1, Sulf2) have been identified to modulate growth factor signaling during development and tumor growth, by removing sulfate groups from the 6-O positions of HS (Lamanna et al.,2007; Nawroth et al.,2007; Lai et al.,2008).

Except of Sulf1 and Sulf2, all the other CS- or HS-specific sulfatases identified so far (ArsB, Galns, Gns, Ids, Sgsh) are involved in the lysosomal degradation of glycosaminoglycans. Consequently, human mutations in these genes lead to five different types of mucopolysaccharidoses (MPS; Table 1). Deficiency of another lysosomal sulfatase, ArsA, which degrades 3-O-sulfoglycolipids (e.g., sulfatide) of the myelin sheathes, causes metachromatic leukodystrophy (MLD), characterized by a progressive loss of myelin. As in most lysosomal storage diseases, the symptoms of MLD and MPS are progressive with a late infantile, juvenile, or adult disease onset, indicating that the enzymes might substitute for each other at earlier stages of development or that nondegradable macromolecules accumulate slowly over time (Diez-Roux and Ballabio,2005; Ashworth et al.,2006; Eckhardt,2008). Deficiency of the nonlysosomal sulfatase ArsC, also known as steroid sulfatase (Sts), causes X-linked ichthyosis, whereas increased ArsC levels support the growth of hormone-dependent tumors of the breast and prostate (Reed et al.,2005). Deficiency of ArsE, another nonlysosomal sulfatase, has been identified to cause chondrodysplasia punctata 1, although the underlying mechanisms, including the physiological substrate of ArsE, are still unknown (Franco et al.,1995).

In the rare human disorder multiple sulfatase deficiency (MSD), the enzymatic activities of all sulfatases are severely reduced. MSD is caused by mutations in Sumf1 (sulfatase modifying factor 1), an enzyme that introduces a Cα-formylglycine residue in the active site of the sulfatase enzymes (Dierks et al.,2003). Recently a Sumf1−/− mouse has been described, which completely lacks sulfatase enzymatic activity, resembling an animal model of a severe form of MSD. Those mice display early mortality, skeletal abnormalities, and neurological defects (Settembre et al.,2007,2008), emphasizing the importance of proper sulfatase function. Studying the expression pattern of the sulfatase gene family could facilitate the discovery of additional players, which might contribute to the complex phenotype of MSD.

To deepen our insight into the role of the sulfatase gene family during embryonic development, we analyzed the expression patterns of 9 (out of 14) murine sulfatase genes in relation to each other. In midgestation mouse embryos distinct but overlapping regions of expression were identified, especially in the developing eye and skeleton. Moreover, novel expression domains for ArsG (choroid plexus), ArsI (hypertrophic chondrocytes, eye lens) and ArsJ (joints) were discovered.

RESULTS AND DISCUSSION

General Expression in the Embryo

To study the expression pattern of the individual sulfatases, riboprobes for all known 14 murine members were generated and in situ hybridization was performed on sections of embryonic day (E) 12.5 and E14.5 mouse embryos. For five genes (ArsA, ArsC, ArsE, ArsK, Sgsh), no specific expression patterns could be detected, hence they were excluded from further analysis. As myelination starts perinatally in the spinal cord (Baumann and Pham-Dinh,2001), lack of embryonic ArsA expression is in accordance with the observed phenotype. Similarly, ArsC-deficient human patients appear normal at birth and display first signs of X-linked ichthyosis between 0 and 3 months of age (Diez-Roux and Ballabio,2005).

ArsB was not detected at E12.5 and E14.5 (Fig. 1A,B), but displayed a strong signal at E16.5 in the developing bone (Fig. 5G). ArsJ showed weak expression in cartilage primordia of the vertebrae (Figs. 1H, 2N, arrowhead), Meckel's cartilage, otic capsule (Fig. 3B), and joints (Fig. 5C) at E14.5, but was no longer detectable at E16.5. Although Galns and Gns were ubiquitously expressed in most tissues at E12.5 and E14.5 (Fig. 1I–L), regions with stronger expression, such as dorsal root ganglia in case of Gns (Figs. 1K,L, 3H) or the eye lens epithelium in case of Galns were detected (Fig. 4B).

Figure 1.

Expression of sulfatases in the developing mouse embryo. A–X: Parasagittal sections of embryonic day (E) 12.5 (A,C,E,G,I,K,M,O,Q,S,U,W) and E14.5 (B,D,F,H,J,L,N,P,R,T,V,X) mouse embryos are shown (cranial is up, dorsal is left). S–X: The pictures show details of the vertebral column at 4× higher magnification. A–X: The expression patterns of ArsB (A,B), ArsG (C,D), ArsI (E,F,S,T), ArsJ (G,H), Galns (I,J), Gns (K,L), Ids (M,N), Sulf1 (O,P,U,V), Sulf2 (Q,R,W,X) are described in the text. br, brain; cp, choroid plexus; dg, dorsal root ganglion fp, floor plate; lu, lung; mc, Meckel's cartilage; ms, mesenchyme; nc, notochord; pp, parachordal plate (future basioccipital and basisphenoid bones); sc, spinal cord; ve, vertebra. Scale bars =1 mm in Q (applies to all E12.5) 1 mm in R (applies to all E14.5 sections), except scale bar in W applies to S,U,W and in X to T,V,X.

Figure 2.

Expression of sulfatases in the inner organs. A,C,E–O: Parasagittal sections of embryonic day (E) 12.5 (A,C) and E14.5 (E–O) mouse embryos (cranial is up, dorsal is left). B,D: Transversal sections of E14.5 mouse embryos at the thorax level (dorsal is up, lateral is right). A–O: The expression patterns of Sulf1 (A,B,F–H), Sulf2 (C–E,I,J), ArsI (K–M), ArsJ (N), and Gns (O) are described in the text. ad, adrenal gland; ao, aorta (filled with erythrocytes); br, bronchus; epc, epicard; es, esophagus; go, gonad; ha, heart atrium; hv, heart ventricle; ki, kidney; li, liver; lu, lung; mes, mesentery; myc, myocard; pa, pancreas; pe, pelvis cartilage primordium; pec, pericard; pl, pleural lining; rc, rib cartilage; sp, spleen; sto, stomach; vc, vena cava; ve, vertebrae. Scale bar = 500 μm in O (applies to all figures).

The remaining five sulfatases (ArsG, ArsI, Ids, Sulf1, Sulf2) displayed strong, specific expression domains at various embryonic stages (Fig. 1C–F,M–R). ArsG was exclusively expressed in the developing choroid plexus at E12.5 and at E14.5 (Figs. 1C,D, 3C). ArsI was expressed in the notochord and the cartilage primordia of the vertebrae at E12.5 (Fig. 1E,S). At E14.5, ArsI expression was also detected in other skeletal elements, such as Meckel's cartilage and the parachordal plate (Fig. 1F,T). Ids expression was detected in neuronal tissues, such as cortex, striatum, thalamus, dorsal root ganglia, and spinal cord (Figs. 1M,N, 3D,G). At E12.5, Sulf1 and Sulf2 are expressed in overlapping domains in the floor plate of the spinal cord and in the mesenchyme surrounding the cartilage primordia of the vertebrae (Fig. 1O,U,Q,W). At E14.5, Sulf1 is additionally expressed in the choroid plexus (Figs. 1P, 3E) and Sulf2 becomes expressed in chondrocytes of the parachordal plate and vertebrae (Fig. 1R,X). In addition to the ubiquitously expressed Galns and Gns, the most widespread tissue distribution was seen for Sulf1 and Sulf2. Aspects of their expression patterns and the associated developmental defects seen in Sulf1- and Sulf2-deficient animals, have recently been reported (Ohto et al.,2002; Nagamine et al.,2005; Holst et al.,2007; Lum et al.,2007; Ratzka et al.,2008; Kalus et al.,2009). To allow a comparison with the expression of other sulfatases, we focused our analysis on four regions (inner organs, central nervous system, eye, and skeleton), which co-express several sulfatases.

Figure 3.

Expression of sulfatases in the central nervous system. A–J: Coronal sections of embryonic day (E) 14.5 embryo head at the otic capsule level (A–F) and transversal sections of E14.5 spinal cord at forelimb level (G–J). The expression patterns of ArsI (A), ArsJ (B), ArsG (C), Ids (D,G), Sulf1 (E,I), Sulf2 (F,J), and Gns (H) are described in the text. ch, cortical hem; cl, cochlea; cp, choroid plexus; cx, cortex; dg, dorsal root ganglia; fp, floor plate; lv, lateral ventricle; mc, Meckel's cartilage (including the future stapes bone); ms, mesenchyme; oc, otic capsule; pp, parachordal plate (future basioccipital and basisphenoid bone); st, striatum; tg, trigeminal ganglion; th, thalamus; vb, vertebral body; vh, ventral horn. Scale bar = 500 μm in F (applies to A–F), 500 μm in J (applies to G,H,I,J).

Expression in the Inner Organs

Sulf1 is expressed in the pleural lining of the lung at E12.5 and E14.5 (Fig. 2A,B). At E12.5 Sulf2 is expressed in the lung mesenchyme, close to the bronchial airway epithelium (Fig. 2C, arrow). This expression becomes more pronounced at E14.5 (Fig. 2D,E, arrow). Of interest, lung-related defects have been identified in severely runted Sulf2-deficient mice (Lum et al.,2007). In the developing esophagus, Sulf1 and Sulf2 expression can be detected in different cell types (Fig. 2B,D), which have been identified as muscle progenitors (Sulf1) and innervating neural progenitors (Sulf2; Ai et al.,2007). An overlapping expression domain of Sulf1 and Sulf2 can be seen in the mesentery of the gastrointestinal tract and the stomach at E12.5 (Fig. 2A,C). At E14.5, ArsI becomes co-expressed with Sulf1 and Sulf2 in stomach and esophagus (Fig. 2F,K,M,H,J). Sulf1 expression was also seen in the aorta wall, the pericard and the epicard of the heart at E14.5 (Fig. 2B), whereas Sulf2 was expressed in the myocard of the heart ventricle at E12.5 and E14.5 (Fig. 2C,D). At E14.5, Sulf1 was the only sulfatase expressed in the gonads (Fig. 2G). In the kidney, Sulf1 was expressed in the ureter (Fig. 2F, arrowhead) and Sulf2 in the nephrogenic mesenchyme (Fig. 2I). ArsJ was not detected in the inner organs, but in the cartilage primordia of the vertebrae (Fig. 2N, arrowhead). An intensified staining of the ubiquitously expressed Gns was observed in the white pulp of the spleen (Fig. 2O, arrowhead), whereas Sulf1 and Sulf2 are expressed in the splenic mesenchyme (Fig. 2H,J).

Expression in the Central Nervous System

Of all analyzed sulfatases, Ids displayed the most widespread expression in the central nervous system, such as cortex, striatum, thalamus, trigeminal ganglion, spinal cord, and dorsal root ganglia (Fig. 3D,G). Of interest, patients with a severe form MPS II (Hunter syndrome), which is caused by mutations in the Ids gene, display an early onset of learning difficulties with progressive neurodegeneration (Ashworth et al.,2006). Neuronal expression of Ids was also seen at E10.5 and E12.5 (Fig. 1M; data not shown). In cross-sections of E14.5 spinal cords, intense overlapping expression domains of Ids and Gns, especially in the ventral horn and dorsal root ganglia, were detected (Fig. 3G,H). Furthermore, Gns displayed a strong, restricted expression domain in the floor plate of the spinal cord (Fig. 3H), which partly overlapped with the ventral-most domains of Sulf1 and Sulf2 expression (arrow Fig. 3I,J). Of interest, in chick embryos, Sulf1 has been shown to regulate Sonic hedgehog signaling, a main regulator of dorsoventral patterning of the neural tube (Danesin et al.,2006).

In addition to Ids, four other sulfatases (ArsG, ArsI, Sulf1, Sulf2) were expressed in noncartilaginous tissues of E14.5 heads. ArsG and Sulf1 were detected in the developing choroid plexus (Fig. 3C,E). Unlike ArsG the expression domain of Sulf1 was extended to an adjacent region, also known as cortical hem (Fig. 3C,E), which serves as an important signaling center during telencephalic development. ArsI and Sulf2 were also expressed in the cortical hem (Fig. 3A,F), but in contrast to Sulf1 were not expressed in the choroid plexus. As described for the developing rat brain (Ohto et al.,2002; Nagamine et al.,2005) Sulf1 expression at E14.5 was more restricted compared with Sulf2, which was also detected in the murine brain stem (Fig. 1P,R; data not shown). Neurological phenotypes have been described in adult mouse mutants deficient for either Sulf1 or Sulf2 (Kalus et al.,2009).

Expression in the Eye

The eye develops from several different cell populations. At E9.5, reciprocal inductive interactions of the optic vesicle, an outpouching of the neural tube, and the overlying surface ectoderm will result in the formation of the optic cup and lens at E14.5. The lens is composed of the lens epithelium and lens fibers. Other structures of the eye, such as cornea and sclera, are derived from migrating cranial neural crest cells (Thut et al.,2001). We analyzed stage E14.5 and E16.5, when cells of the optic cup have started to differentiate into the pigmented epithelium and the inner- and outer- neuroblastic layers of the retina, but have not yet completed their differentiation into the 10 layers of the adult retina.

At E14.5 and E16.5, the lens epithelium, but not the adjacent lens fibers nor the cornea expresses ArsI, Galns, Gns, and Sulf1 (Fig. 4A–C,E,G–I,K). In addition to the lens epithelium, a more intense expression of the ubiquitously expressed Galns and Gns was detected in the anterior margin of the optic cup at E14.5 (Fig. 4B,C) and in the neuroblastic layers of the developing retina at E16.5 (Fig. 4H,I). Furthermore, Gns was the only sulfatase expressed in the anterior retinal pigmented epithelium (Fig. 4C,I). At E14.5 and 16.5, the inner neuroblastic layer, which gives rise to ganglion and supporting cells, and an outer neuroblastic layer, which gives rise to light-receptive rod and cone cells, can be distinguished. Ids is expressed in the inner neuroblastic layer at E14.5 and E16.5 (Fig. 4D,J), whereas Sulf2 is expressed in the outer neuroblastic layer and more intense in the optic cup margin (Fig. 4L). At both stages, Sulf1 and Sulf2 are expressed in the periocular mesenchyme (Fig. 4K,L).

Figure 4.

Expression of sulfatases in the developing eye. A–L: High power views of coronal sectioned embryonic day (E) 14.5 (A–F) and E16.5 (G–L) eyes (dorsal is up). The expression patterns of ArsI (A,G), Galns (B,H), Gns (C,I), Ids (D,J), Sulf1 (E,K), and Sulf2 (F,L) were analyzed on parallel sections and are described in the text. br, brain; co, cornea; el, eyelid; le, lens epithelium; lf, lens fibers; inbl, inner neuroblastic layer; nbl, neuroblastic layer; ocm, optic cup margin; on, optic nerve; onbl, outer neuroblastic layer; pm, periocular mesenchyme; rpe, retinal pigmented epithelium. Scale bar = 500 μm in F (applies to A–F), 500 μm in L (applies to G–L).

Expression in Cartilage and Bone

In cartilaginous structures of E14.5 heads, four sulfatases, ArsI, ArsJ, Sulf1, and Sulf2, were detected. ArsI, ArsJ, and Sulf2 are expressed in Meckel's cartilage and otic capsule (Fig. 3A,B,F). Sulf2 shows widespread expression in the head mesenchyme (Fig. 3F) and, together with ArsI and Sulf1, surrounding the parachordal plate (future basioccipital and basisphenoid bones; Fig. 3A,E). Additional sites of Sulf1 expression can be found surrounding Meckel's cartilage and in the cochlea epithelium (Fig. 3E).

As cartilage is composed of chondrocytes of different maturation stages (proliferating, prehypertrophic, and hypertrophic chondrocytes), we have analyzed sulfatase expression in relation to that of Indian hedgehog (Ihh), a marker of prehypertrophic chondrocytes, in longitudinal sections of radius and ulna at E14.5 and E16.5. We found that proliferating chondrocytes express Sulf2 (Figs. 5F,L, 6J), whereas prehypertrophic chondrocytes express ArsI (Figs. 5B,H, 6L) and hypertrophic chondrocytes express ArsI and Sulf1 (Fig. 5H,K). Of interest, at E14.5, ArsI and Sulf2 are nonoverlappingly expressed in the elbow joints (Fig. 5B,F) and Meckel's cartilage (Fig. 3A,F). Therefore, ArsI (expressed in the perichondrium) and Sulf2 (expressed in proliferating chondrocytes) might become useful marker genes for future studies on chondrocyte differentiation. At E14.5 articular chondrocytes of the elbow joint express ArsJ, Sulf1, and Sulf2 (Fig. 5C,E,F), whereas ArsI is expressed by adjacent chondrocytes (Fig. 5B). During limb development Sulf1 (apical ectodermal ridge) and Sulf2 (limb bud mesoderm) are already expressed at E10.5 (Ratzka et al.,2008) and are both expressed at E12.5 and E13.5 in the forming digits (Fig. 6A–D). In contrast, ArsI expression was not detected in the limb at E12.5 or E10.5 (Fig. 6E; data not shown), but was expressed at E13.5 and E14.5 in the tip of the digits (Fig. 6F,K), which also co-expresses Sulf1 and Sulf2 (Fig. 6G,I, arrows).

Figure 5.

Expression of sulfatases in the developing skeleton. A–L: High power views of the elbow joint region of longitudinal sectioned embryonic day (E) 14.5 (A–F) and E16.5 (G–L) forelimbs. The expression patterns of ArsB (A,G), ArsI (B,H), ArsJ (C,I), Gns (D,J), Sulf1 (E,K), and Sulf2 (F,L) are described in the text. bo, bone; ejo, elbow joint; hc, hypertrophic chondrocytes; hu, humerus; per, perichondrium (arrow in B,F); pc, proliferating chondrocytes; phc, prehypertrophic chondrocytes; ra, radius; ul, ulna. Scale bar = 500 μm in F (applies to A–F), 500 μm in L (applies to G–L).

Figure 6.

Expression of sulfatases in the developing limb. A–F: Whole-mount in situ hybridization of embryonic day (E) 12.5 (A,C,E) and E13.5 (B,D,F) embryos. G–L: Double labeling with Ihh (orange staining) was used to identify prehypertrophic chondrocytes in longitudinal sections of E14.5 forelimbs. H,J,L: High power views of the distal radius. A–L: The expression patterns of Sulf1 (A,B,G,H), Sulf2 (C,D,I,J), and ArsI (E,F,K,L) are described in the text. ct, connective tissue; dt, digit tip; jo, joint; pc, proliferating chondrocytes; per, perichondrium; phc, prehypertrophic chondrocytes; ra, radius; te, tendon; ul, ulna. Scale bar = 400 μm in K (applies to G,I,K), 100 μm in L (applies to H,J,L).

At E16.5, the cartilaginous skeleton has been partially replaced by bone. During this process, termed endochondral ossification (Karsenty and Wagner,2002), the hypertrophic chondrocytes in the center of the skeletal elements are gradually replaced by osteoclasts and osteoblasts, the latter producing the calcified bone matrix. At this stage, distal proliferating chondrocytes express Sulf2 (Fig. 5L) and hypertrophic chondrocytes express ArsI and Sulf1 (Fig. 5H,K). In the elbow joint, only Sulf2 is still expressed (Fig. 5L), whereas ArsJ and Sulf1 are no longer detectable (Fig. 5I,K). In addition to the cartilaginous expression domains of Sulf1 and Sulf2, both sulfatases were also detected in the developing bone (Fig. 5K,L). ArsB and Gns displayed a strong, punctuate expression pattern in the bone (Fig. 5G,J), similar to an osteoclast-specific expression pattern.

In total, we found six sulfatases (ArsB, ArsI, ArsJ, Gns, Sulf1, Sulf2) to be expressed in the developing skeleton. Of interest, these six sulfatases can be separated, based on their amino acid sequence, in two groups (ArsB, ArsI, ArsJ) and (Gns, Sulf1, Sulf2). All members of the last group have been characterized biochemically and found to hydrolyze 6-O-sulfate groups of glucosamine residues of HS chains. For the first group, only ArsB has been investigated and characterized as chondroitin-4-sulfate– and dermatan-4-sulfate–specific sulfatase. Although, biochemical studies of ArsI and ArsJ are still missing, the close sequence homology of ArsI and ArsJ might indicate similar substrate specificities. In addition to the previously known localization in the endoplasmatic reticulum, secretion of overexpressed ArsI into the medium has been reported (Oshikawa et al.,2009). Assuming that ArsI is indeed a secreted sulfatase, its expression in hypertrophic chondrocytes might be involved in remodeling of the extracellular matrix during the transition of a cartilaginous- into a bony skeleton. Furthermore, as ArsI and Ihh are expressed in partially overlapping domains, ArsI might be involved in modifying Ihh signaling, which is a main regulator of chondrocyte differentiation and proliferation. Of interest, Ihh signaling is not only affected by HS (Koziel et al.,2004) but also by CS and, particularly of interest, by chondroitin-4-sulfate groups (Cortes et al.,2009). Biochemical studies and investigation of ArsI-deficient animals are required to clarify this hypothesis.

Although, we did not detect ArsC expression in any embryonic tissue, expression domains of ArsC (Sts) in cartilage and skin of mouse embryos and in growth plates of adult rats have been reported before (Compagnone et al.1997; van der Eerden et al.,2002). In accordance with their expression patterns, skeletal phenotypes in mice or cats deficient for ArsB, Sulf1, and Sulf2 have been reported (Abreu et al.,1995; Evers et al.,1996; Holst et al.,2007; Ratzka et al.,2008). Additionally, mutation of Galns, at least in MPS IVA patients, lead to skeletal malformations, whereas the skeletons of Galns−/− mice are normal (Tomatsu et al.,2003). Mutations of another sulfatase, ArsE causes chondrodysplasia punctata 1 in humans (Franco et al.,1995), but expression could not be detected in our hybridization screen.

Conclusions

By in situ hybridization, we compared the expression pattern of nine sulfatase genes. We identified expression domains of three recently discovered sulfatases: ArsG (developing choroid plexus), ArsI, and ArsJ (both in the developing skeleton) and revealed a more complete picture of the sulfatases expressed in the skeleton, eye, inner organs, and neuronal tissue. This study might provide a basis to understand the phenotypes observed in multiple sulfatase deficiency patients and the Sumf1−/− mice animal model.

EXPERIMENTAL PROCEDURES

For time pregnancies, noon on the day of the vaginal plug was defined as embryonic day (E) 0.5. E12.5, E14.5, and E16.5 C57BL/6 mouse embryos were fixed with 4% paraformaldehyde overnight, dehydrated, and embedded in paraffin. Seven-micrometer tissue sections were collected on Superfrost slides and processed for in situ hybridization, which was performed as previously described (Ratzka et al.,2008). The sulfatase DNA clones were obtained as IMAGE clones (IC) from RZPD (Berlin) or were polymerase chain reaction (PCR) amplified from mouse cDNA or gDNA and subsequently cloned into the pCR4-Topo vector (Invitrogen). All plasmids were sequence verified before being used as PCR template. Digoxygenin-UTP (DIG) -labeled riboprobes were generated using a Roche DIG RNA labeling kit and the corresponding Sp6, T3, or T7 RNA polymerases. Primer sequences and plasmids used to PCR amplify the transcription templates are summarized in Table 2. Alkaline phosphatase (AP) -labeled anti-DIG antibody (1:2,000) and BM-purple as a substrate was used to detect the bound riboprobes. The Ihh riboprobe was Biotin-16-UTP labeled (Roche) using T7 polymerase and an XbaI linearized plasmid (Bitgood and McMahon,1995) as template. After inactivation of the anti-DIG–AP with 4% PFA for 30 min, streptavidin-AP was used to detect the biotin-labeled riboprobe and visualized with INT/BCIP (Roche). Embryonic structures were identified using appropriate literature, e.g., Kaufmann (1992) and Theiler (1989).

Table 2. Sulfatase Riboprobes and DNA Templatesa
RiboprobesSizeGenBankPCR primers and plasmidsPolymerases
  • a

    Transcription templates were generated by polymerase chain reaction (PCR) amplification of mouse sulfatase cDNA clones. All PCR products contained an RNA polymerase transcription promoter, amplified from the cloning vector, using one of the following reverse primers: M13-21-F (5′-CGACGTTGTAAAACGACGGCCAGT), M13-R (5′-AGCG GATAACAATTTCACACAGGA), Sp6 (5′-CTATTTAGGTGACACTATAG), T3 (5′-ATTAACCCTCACTAAAGGGA), or T7 (5′-TAATACGACTCACTATAGGGA). The sequences of the gene-specific forward (-F) and reverse (-R) primers are listed in the table above. The last column indicates the RNA polymerase (Sp6, T3, or T7) used to generate the antisense riboprobes. Abbreviations: CDS, coding sequence; IC, IMAGE clone; UTR, untranslated region.

ArsA_#113UTR799BC011284PCR: T7 and ArsA-F (5′-CTACAGATCTGCTGTCAGC) from pCMV-SPORT6-ArsA (IC:3669438)T7
ArsB_#41CDS-3UTR443NM_009712PCR: M13-21-F and ArsB-F (5′-CTCCGTCTCAGTCCAACGTCTC) from pCR4-TOPO-ArsB (cloned PCR-product, with primers ArsB-F and ArsB-R 5′-GCCAACAGCAAGATCCTTCCAG)T7
ArsC_#4CDS-3UTR622AI037744PCR: T7 and T3 from pT7T3D-Pac1-ArsC (IC:1381235)T3
ArsE_#433UTR256BB667144PCR: M13-R and ArsE-F (5′-CTTCCTGTGGGACCGGAAGTG) from pCR4-TOPO-ArsE (cloned PCR-product, with primers ArsE-F and ArsE-R 5′-CATTTCATTGAAACAGGAAGTCCCG)T3
ArsG_#163UTR926BC022158PCR: T7 and ArsG-F (5′-GACATCGCTGATGACAACA) from pCMV-SPORT6-ArsG (IC:5134725)T7
ArsI_#473UTR885AW822332PCR: M13-R and ArsI-F (5′-GTCGCCGCAAGAAGAAATGCAAG) from pT7T3D-Pac1-ArsI (IC:2802810)T7
ArsJ_#525UTR645NM_173451PCR: M13-R and ArsJ-F (5′-GATTGACAAACGCTCAGCGG) from pCR4-TOPO-ArsJ (cloned PCR-product, with primers ArsJ-F and ArsJ-R 5′-CCATTCACTCTGGTCCCACAG)T3
ArsK_#20CDS795NM_029847PCR: M13-R and ArsK-F (5′-CTCAGACCATGGAGAGATGG) from pCR4-TOPO-ArsK (cloned PCR-product, with primers ArsK-F and ArsK-R 5′-GCTGTGAGCTACTGGTGGAT)T3
Galns_#133UTR1013BC004002PCR: T7 and Galns-F (5′-GTAACCAGGCTGTCATGAA) from pCMV-SPORT6-Galns (IC:3492664)T7
Gns_#543UTR945NM_029364PCR: M13-R and Gns-F (5′-GCGTCAGAACGAGAAGGTTC) from pCR4-TOPO-Gns (cloned PCR-product, with primers Gns-F and Gns-R 5′-CTGGAACCGAGTTTCGCCAC)T3
Ids_#03CDS1504AW743503PCR: T3 and T7 from pT7T3D-Pac1-Ids (IC:3025090)T7
Sgsh_#183UTR518NM_018822PCR: T3 and Sgsh-F (5′-GGAGCAATGGAGGCAGTAC) from pCR4-TOPO-Sgsh (cloned PCR-product, with primers Sgsh-F and Sgsh-R 5′-CAGAGCCCAGATAGACCAC)T3
Sulf1_#143UTR1553BC049276PCR: T7 and Sulf1-F (5′-GACAGTTATGGGATGGATG) from pCMV-SPORT6-Sulf1 (IC:4500954)T7
Sulf2_#153UTR946AY101177PCR: Sp6 and Sulf2-F (5′-CCAGAAATGAAGAGACCTTC) from pCMV-SPORT6-Sulf2 (IC:3155559)Sp6

Ancillary