SEARCH

SEARCH BY CITATION

Keywords:

  • Wtx;
  • Amer genes;
  • Wilms' tumor;
  • Wnt signaling;
  • central nervous system;
  • mouse embryogenesis;
  • gene expression

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

WTX/AMER1 is a novel negative regulator of the WNT/β-catenin pathway with mutations detected in Wilms' tumors and an X-linked sclerosing bone dysplasia. WTX/AMER1 (Fam123b) shares several domains of homology with two other recently identified proteins: AMER2 (Fam123a) and AMER3 (Fam123c). Here, we describe an in-depth expression analysis of all three members of this gene family during mouse embryonic development. All genes were strongly expressed in the central as well as the peripheral nervous system, thus suggesting important roles of this gene family during neurogenesis. Specific expression was found in the retina, inner ear, and nasal epithelium. Outside of the nervous system Wtx/Amer1 showed the broadest expression domains including cephalic and limb mesenchyme, skeletal muscle, bladder, gonads, lung bud, salivary glands, and the kidneys. The widespread expression pattern of Wtx/Amer1, together with its role as a modulator of the Wnt signaling pathway, suggest that Wtx/Amer1 serves pleiotropic roles during mammalian organogenesis. Developmental Dynamics 239:1867–1878, 2010. © 2010 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

WTX has been recently identified as a gene mutated in a high proportion of Wilms' tumor, the most common pediatric solid cancer (Rivera et al.,2007). More recently, germline mutations in WTX were also observed in OSCS (osteopathia striata congenita with cranial sclerosis) patients, a condition characterized by increased bone density and craniofacial malformations in females and lethality in males (Jenkins et al.,2009). Therefore, while being implicated in these different developmental malignancies, WTX appears as both a tumor suppressor and a critical regulator of embryonic development.

On the molecular level, WTX appears to be tightly linked to the WNT/β-catenin signaling pathway. It was identified as a protein associated with the β-catenin destruction complex (Major et al.,2007), promoting ubiquitination and degradation of β-catenin in vitro. In a parallel study, WTX was also found to bind to APC thus directly inducing changes in the localization of APC from the ends of microtubules to the plasma membrane. Based on these findings WTX was given the alternative name AMER1 for APC membrane recruitment 1 (Grohmann et al.,2007). This study also identified AMER2 as a protein that shares high similarity with WTX. By using the murine WTX/AMER1 amino acid sequence as a tool for homology assignment in a database, our lab found that WTX actually belongs to a family of three proteins: WTX/AMER1 (NCBI nomenclature: FAM123B), AMER2 (FAM123A), and the third new family member we identified (FAM123C) which we will call subsequently as AMER3 accordingly to the phylogenetic analysis (Boutet et al., unpublished results). Despite being highly conserved among vertebrates, the expression patterns of the Amer gene family during embryonic development remain largely unexplored. In the present manuscript, we described a systematic study using section and whole-mount in situ hybridization to determine the spatiotemporal expression of WTX/Amer1, Amer2, and Amer3 during mouse embryonic development.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Expression of Amer Genes From Postimplantation to Midgestation Stages

To test whether Amer transcripts are already present in early mouse embryos, we performed semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis on RNA extracted from embryonic day (E) 7.5 to E9.5 embryos. While significant expression of the WTX/Amer1 gene was detected at E7.5, very low levels of Amer2 RNA expression were observed at the same stage (Supp. Fig. S1A, which is available online). Whole-mount in situ hybridization confirmed the presence of WTX/Amer1 and Amer2 transcripts in the embryo proper at E7.5 (data not shown), suggesting a potential involvement of these genes during gastrulation. At E8.5 WTX/Amer1 and Amer2 transcription levels were significantly increased (Supp. Fig. S1A). Whole-mount in situ hybridization at this stage, displayed a diffuse yet clear gradient of mRNA expression along the anterior–posterior axis for both genes (data not shown). This gradient along the neuraxis was maintained and became more evident for Amer2 at E9.0. (Note the strong staining for Amer2 in the prospective brain and anterior embryonic structures in Supp. Fig. S1B). Amer3 mRNA expression was not detected from E7.5 to E9.0 (Supp. Fig. S1A,B), but a highly regionalized expression in cranial ganglia and anterior part of the neural tube could be observed from E9.5 (Supp. Fig. S1C).

From E9.5 to E11.5, mRNA expression of the Wtx/Amer1 and Amer2 genes was detected in all prospective regions of the central nervous system: the neuroepithelium of developing brain and neural tube along the body axis (Figs. 1A(a,b), 1B(b), 2A(a–c), 2B(a–f)). A more restricted expression was found for Amer3 within the telencephalon, mesencephalon, ventral part of the hindbrain, and spinal cord (Figs. 1C(C3), 3(A,C), and Supp. Fig. S1C). Vibratome sections of whole-mount stained embryos at E10.5 revealed strong regionalization of Amer3 transcripts, with labeling being mainly restricted to groups of neurons in the anterior–lateral part of the forebrain and ventral midbrain (white arrowheads in Fig. 3(d)). Other signs of regionalization were the presence of Amer3 transcripts in the nascent marginal layer of the hindbrain and spinal cord neuroepithelium (Fig. 3(a–c,c′,e,f)), with the strongest signal present in presumptive motor neuron pools (postmitotic neurons) of the basal plate (Fig. 3(e,f), white arrowheads). No labeling was detected in the ventricular zone. In case of Amer2, even though moderate expression was observed along the neuroepithelium of the hindbrain, it was chiefly evident in neuronal groups in the basal plate and alar plate (Fig. 2B(d,e) black arrowheads). Amer2 mRNA was also expressed throughout the neural tube with highest levels in the marginal layer (Fig. 2B(b)).

thumbnail image

Figure 1. Developmental expression of Wtx/Amer1 and Amer family genes in midgestation mouse embryos. A: Expression of Wtx/Amer1 was analyzed by whole-mount in situ hybridization (A1) followed by vibratome sections (a,b,c) at embryonic day (E) 9.5. B: Section in situ hybridization of Wtx/Amer1 at E10.5 (a,b). Drawings indicate the approximate angle of sections at the discussed embryonic stages. C: Comparative expression analysis of the Amer gene family at E11.5. Otic vesicles are delineated with dashed lines in C1′. Lateral (A1, C1, C2 and C3) and dorsal (C1′, C2′, and C3′) whole-mount views are shown. Ba, branchial arches; Bp, branchial pouch; Bw, body wall; Cb, cerebellum; Ce, coelomic epithelium; Cfm, craniofacial mesenchyme; D, dermomyotome; Da, dorsal aorta; Flb, forelimb bud; Fv, fourth ventricle; H, heart; Hb, hindbrain; Hlb, hindlimb bud; Me, mesencephalon; My, myotome; Nt, neural tube; Otv, otic vesicle; Ov, optic vesicle; Psm, presomitic mesoderm; Rb, rhombencephalon; S, somites; Sc, spinal cord; Tc, telencephalon; Ua, umbilical artery; Uv, umbilical vein; Vg, trigeminal ganglion.

Download figure to PowerPoint

thumbnail image

Figure 2. Highlights of Amer2 expression in midgestation mouse embryos. A,B: Expression of Amer2 was analyzed by whole-mount in situ hybridization (ISH) at embryonic stages 9.5 (A) and 10.5 (B). Frontal (B1) and lateral (A1, B2 and B3) whole-mount views are shown. The approximate level and orientation of the gelatin sections after whole-mount staining (a–c in A and a–f in B) are shown in the schematic drawings. Ba, branchial arches; Bp, basal plate; Da, dorsal aorta; Dc, diencephalon; Drg, dorsal root ganglion; Flb, forelimb bud; Fv, fourth ventricle; H, heart; Hb, hindbrain; Hlb, hindlimb bud; Inl, inner (neural) layer of the optic cup; Me, mesencephalon; Nt, neural tube; Os, optic stalk; Otv, otic vesicle; Ov, optic vesicle; Rb, rhombencephalon; S, somites; Sc, spinal cord; St, sympathetic trunk; Tc, telencephalon; TeV, telencephalic vesicle; Tv, third ventricle; Vg, trigeminal ganglion. Black arrowheads are used to indicate regionalization of Amer2 expression in the neural epithelium. D, dorsal; V, ventral.

Download figure to PowerPoint

thumbnail image

Figure 3. Highlights of Amer3 expression in embryonic day (E) 10.5 mouse embryos. Expression of Amer3 was analyzed by whole-mount in situ hybridization (ISH). A–D: Lateral (A–C) and frontal (D) whole-mount views are shown. a–f: Gelatin sections of the stained embryos at approximate level and orientation as shown in the schematic drawing. Ba, branchial arches; Da, dorsal aorta; Dc, diencephalon; Drg, dorsal root ganglion; Flb, forelimb bud; Fv, fourth ventricle; H, heart; Hb, hindbrain; Hlb, hindlimb bud; Me, mesencephalon; Mnp, mandibular process; Mxp, maxilar process; Nt, neural tube; Otv, otic vesicle; Rb, rhombencephalon; S, somites; Sc, spinal cord; Tc, telencephalon; Tv, third ventricle; Vg, trigeminal ganglion; VII/VIIIg, facio-acoustic ganglion; IXg, petrosal ganglion; Xg, nodose ganglion. White arrowheads are used to indicate regionalization of Amer3 expression in the neural epithelium. D, Dorsal; V, Ventral.

Download figure to PowerPoint

Expression of all three Amer genes was found in the trigeminal ganglion (V) (Fig. 1B(b), Fig. 2B(B3), Fig. 3(A,C), Fig. 3(a), and data not shown) and the otic vesicle (Fig. 1A(a), Fig. 2A(A1), Fig. 1C(C3′)) whereas only Wtx/Amer1 and Amer2 were detected in the optic vesicle from E9.5 to E11.5 (Fig. 1A(A1), Fig. 2B(c), and data not shown). It is important to mention that Amer3 transcripts in the otic vesicle were evident at E11.5 (Fig. 1C(C3′)) but not at earlier stages (Fig. 3(A)). Very strong and specific expression of Amer3 was also detected in additional cranial nerves including the facioacoustic (VII/VIII) ganglion, glossopharyngeal or petrosal (IX) ganglion, and inferior ganglion of vagus nerve or nodose ganglion (X) (Fig. 3(A), and Suppl. Fig. S1C). Section in situ hybridization at later stages demonstrated also expression of Wtx/Amer1 and Amer2 in the facio-acoustic (VII/VIII) ganglion (Fig. 4D and data not shown).

thumbnail image

Figure 4. A–D: Comparative expression analysis of Amer family genes at E11.5 (A), E12.5 (B), E13.5 (C), and E14.5 (D) (sagittal sections). Ag, adrenogland primordium; Bw, body wall; Cb, cerebellar primordium; Ce, coelomic epithelium; Cp, cortical plate; Da, dorsal aorta; Dc, diencephalon; Drg, dorsal root ganglia; E, eye; H, heart; Hl, hindlimb; K, kidney; L, lung; Lb, lung bud; Lp, liver primordia; Lv, lateral ventricle; M, limb musculature; Mb, midbrain; Mo, medulla oblongata; Mv, mesencephalic vesicle; Nc, neocortex; Oe, olfactory epithelium; Po, pons; Sc, spinal cord; Schg, sympathetic chain of ganglia; Sg, stellate ganglion; T, tongue; Tc, telencephalon; Te, testis; Th, thalamus; Uv, umbilical vein; Vf, vibrissal follicles; Vg, trigeminal ganglia; VII/VIIIg, vestibulocochlear ganglion; Vz, ventricular zone. Asterisks (*) indicate expression in nuclei of the medulla oblongata.

Download figure to PowerPoint

Sections through the dorsal aorta in the rostral part of the trunk at E10.5 evidenced strong Amer2 expression in the primary sympathetic ganglionic condensations along the midline dorsal aorta (Fig. 2B(a,b)). Amer2 expression in the sympathetic trunk was maintained throughout development (Fig. 9(j)). Moreover, we could detect all Amer gene transcripts in the anlagen of the dorsal root ganglia (Figs. 2B(a,b), 3(b), and data not shown).

In non-neural tissues, very strong expression of Wtx/Amer1 was observed in the umbilical arteries and veins, the coelomic epithelium and the body wall (Figs. 1A(b), 1B(b)). Wtx/Amer1 was also strongly expressed in the limb bud mesenchyme underlying the surface ectoderm (Fig. 1B(a)), while Amer2 was only moderately expressed in this structure (Figs. 2A(c), 2B(a)). In the head region, high levels of Wtx/Amer1 and moderate to low levels of Amer2 expression were detected in the facial primordium from E9.5. Lateral views of the embryonic head region at E9.5 clearly showed presence of Wtx/Amer1 transcripts in the craniofacial mesenchyme (Fig. 1A(A1)) and presence of Wtx/Amer1 and lower levels of Amer2 mRNA in the branchial arches (Figs. 1A(A1), 2A(A1), 2B(B3)). Staining of the mesenchyme of the brachial arches (which is mainly neural crest derived) was confirmed in vibratome sections (Fig. 1A(a)) and paraffin (Fig. 1B(b)) sections. Conspicuous Wtx/Amer1 expression was also found in the caudal presomitic mesoderm (Fig. 1A(A1)). Finally, all Amer gene transcripts were observed in the developing somites though in a distinctive pattern. While Wtx/Amer1 and Amer2 were detected at the internal edges of the somites, probably representing the boundary of dermomyotome and myotome (Figs. 1A(b,c), 2A(c)), Amer3 mRNA was observed more internally (presumably in the sclerotome) and seemed restricted to the developing somites of the medial part of the body (Fig. 3A(c), and Supp. Fig. S1C(b)). This complementary expression pattern in the somites (and in another structures as the olfactory epithelium, see below) could be a reflection of the subfunctionalization or division of expression between Amer family members that might have occurred during evolution.

Expression in the Fetal Nervous System and Sensory Placode Derivatives

To further investigate the expression patterns of Amer genes in late embryonic and fetal tissues, we performed in situ hybridization using paraffin sections prepared from E11.5 to E18.5 mouse embryos. A summary of the observed expression patterns can be found in Table1.

Table 1. Summary of the Expression of Amer Family from E12.5 to E14.5
 Wtx/Amer1Amer2Amer3
  1. Abbreviations: (−), virtually absent transcripts; (+), expression at slightly above background levels; (++), moderate expression levels; (+++), robust expression levels. The level of expression was assessed for each probe separately.

  2. (1) No transcripts in the intrinsic muscle of the tongue; expression restricted to clusters of cells.

  3. (2) Expression at the level of the bladder neck.

  4. (2) Expression restricted to thymic capsule.

Central nervous system   
1. Forebrain   
* Telencephalon+++++++
* Diencephalon   
 Thalamus+++++++
2. Hinbrain   
* Metencephalon   
 Cerebellum+++++++
 Pons+++++++
* Metencephalon   
 Medulla Oblongata+++++++
3. Midbrain+++++++
4. Spinal cord+++++++++
Peripheral and sensory nerves   
1. Peripheral nervous system   
* Dorsal root ganglion+++++++++
* Autonomic ganglia   
 Stellate ganglion+++++++
 Sympathetic trunk+++
* Trigeminal ganglion+++++++
* Vestibulocochlear ganglion++++++
2. Sensory organs   
* Eye (neural retina)+++++
* Ear (cochlea)+++++
* Nose (olfactory epithelium)++++
Other tissues   
1. Digestive system   
* Tongue++− (1)
* Esophagus+++
* Salivary gland epithelium+++
2. Respiratory system   
* Lung+++
* Main bronchus+++
3. Urogenital system   
* Kidney++++
* Bladder++++ (2)
* Male gonad++++
4. Integumental system   
* Vibrissa+++
5. Skeleton   
* Muscle++++
* Cartilage/bone   
 Long bone++
 Vertebrae
 Craniofacial+++
6. Thymus gland− (3)

All Amer family members showed a highly overlapping expression pattern throughout the nervous system, but specific domains of regionalization could be also distinguished.

Between E12.5 and E14.5, sagittal and transverse head paraffin sections showed expression of Amer genes throughout the telencephalon, thalamus, midbrain, pons, medulla oblongata, and spinal cord (Fig. 4B,C,D). The highest level of expression was seen for Amer2 at all stages studied. Landmarks of Wtx/Amer1 expression were the intense labeling of distinctive neuronal tracts in the medulla oblongata (asterisks in Fig. 4B,D and Fig. 9(d)). In the case of Amer3, expression was restricted to the outer zone or the cortical plate (Fig. 4D; Fig. 6A), a subpial layer where postmitotic neurons reside (Andrieu et al.,2003). The cell layers of undifferentiated neural precursors such as the ventricular zone of the neocortex were not labeled. Further investigations will be needed to reveal the significance of Amer3 specificity to postmitotic neuronal populations. Finally, transcripts of Wtx/Amer1 and Amer2 were also detected in the choroid plexus within the fourth ventricle (Fig. 6B).

At the level of the spinal cord, transverse sections at E15.5 evidenced highly overlapping expression of Amer genes in the forming dorsal and ventral horns of the mantle layer (gray matter; Fig. 5A). The marginal layer (white matter) was almost devoid of Amer gene expression. Similarly, all Amer genes transcripts were observed in ganglia of the peripheral nervous system such as the dorsal root ganglion (Figs. 4, 5A,B), the trigeminal ganglion (Figs. 4, 5D), the vestibulocochlear ganglion (Fig. 4D and data not shown), but not in the axon-enriched corresponding fibers. Expression was also highly overlapping in the stellate ganglion (Figs. 4D, 5C), a sympathetic ganglion formed by the fusion of the inferior cervical ganglion and the first thoracic ganglion. Therefore, these domains of expression appear to be a hallmark of the Amer gene family. On the other hand, strong expression of Amer2 extended to the suprarenal ganglion (Fig. 9i) and the sympathetic trunk (Fig. 2B(a,b), Fig. 9(j)). Finally, labeling for Amer2 and Amer3 was also significantly present in the hypogastric plexus (Fig. 9(k,l)).

thumbnail image

Figure 5. A–D: Expression of Amer genes in the spinal cord and ganglia at embryonic day (E) 14.5 (B–D) and E15.5 (A). (A, transverse and B–D, sagittal sections). Expression of Amer genes in the spinal cord at the T1 vertebrae level (A), the dorsal root ganglia at the thoracic level (B), the stellate ganglion (C), the trigeminal ganglion (D). Dh, dorsal horn; Drg, dorsal root ganglion; R, cartilage primordium of rib; R-Vg, rootlets of trigeminal ganglion; Sa, subclavian artery; Sg, stellate ganglion; T1, cartilage primordium of the thoracic T1 vertebrae; V, cartilage primordium of vertebrae; Vg, trigeminal ganglion; Vh, ventral horn; Wm, white matter.

Download figure to PowerPoint

Domains of expression also covered sensory organs such as the eye and inner ear. Wtx/Amer1 and Amer2 transcripts were detected in the cochlear epithelium of the inner ear (Fig. 6C). Despite its expression in the otic vesicle at E11.5 (Fig. 1C(C3,C3′)), no Amer3 labeling was observed in the cochlea at E14.5.

thumbnail image

Figure 6. A–E: Expression of Amer genes in the nervous system and sensory organs at embryonic day (E) 13.5 (A,B,D), E14.5 (C), and E18.5 (E) (sagittal sections). A: Magnification of the frontal part of the head region of the E14.5 embryos shown in Figure 4D showing the distinct expression of Amer genes in the forebrain/midbrain structures. B: Magnification of the rostral part of the head region of the E14.5 embryos shown in Figure 4D showing the distinct expression of Amer genes in the hindbrain. C: Expression of Amer genes in the cochlea. D,E: Expression of Amer genes in the retina. C, cochlea; Cop, choroid plexus within central part of lumen of fourth ventricle; Cp, cortical plate; Ct, cartilage primordium of the petrous part of the temporal bone; El, eyelid; Fv, fourth ventricle; Gcl, ganglion cell layer; Ivf, interventricular foramen; L, lens; Lv, lateral ventricle; Mo, medulla oblongata; Nc, neocortex; Po, pons; Rn, retinal neuroepithelium; Th, thalamus; Vz, ventricular zone.

Download figure to PowerPoint

At E13.5, the neural retina displayed signal for the three Amer genes (Fig. 6D). Wtx/Amer1 and Amer3 transcripts were clearly enriched in the innermost layer of the neural retina, where the first postmitotic neurons are born (Sahly et al.,1998). In contrast, very strong Amer2 expression was detected in a “salt-and-pepper” pattern throughout the entire neural retina. At E18.5, the pattern of expression was maintained with Wtx and Amer3 expression in the innermost presumptive ganglion cell layer, whereas Amer2 expression extended as well to the ventricular zone (Fig. 6E).

Expression in Organs Containing an Epithelial Component

Throughout development, Wtx/Amer1 transcripts were clearly noticeable at sites where interactions between mesenchymal and epithelial tissues take place: e.g., salivary glands, lungs, kidneys, developing vibrissae, and palate. Expression was also robust in the olfactory and oral epithelium. It is noteworthy to mention that Amer2 transcripts were present either at low levels or in a complementary manner in respect to Wtx/Amer1 when analyzing those tissues. No expression of Amer3 could be detected in epithelial structures.

In the olfactory epithelium, strong hybridization signal for Wtx/Amer1 was detected from E11.5 onward. The signal for Amer2 was much lower at this stage (Fig. 4A). Later on, both Wtx/Amer1 and Amer2 were expressed at high levels in the olfactory epithelium of the nasal cavity, although in a complementary/stratified manner (Fig. 7A,B). Wtx/Amer1 was present in the presumptive supporting cell layer, whereas Amer2 was present in the basal layer (Fig. 7A,B, bottom insets). Expression for the two genes was higher in the ventral part of the nasal cavity epithelium. Finally, Amer2 expression was also detected in the tubules of the nasal serous glands at higher levels than that of Wtx/Amer1 (Fig. 7B, top inset).

thumbnail image

Figure 7. A–F: Expression of Amer genes in epithelial structures at embryonic day (E) 12.5 (E), E15.5 (A,C,D,F), and E18.5 (B). (E, sagittal section; A–D, F transverse sections) A,B: Expression of Wtx/Amer1 and Amer2 in the olfactory epithelium. Higher power views of the epithelia (bottom insets) and the tubules of nasal serous glands (top insets) are shown. C: Expression of Amer genes in the primordium of follicle of vibrissa. The dotted circles are used to delimitate the connective tissue sheath from the interfollicular epidermis. D: Expression of Amer genes in the submandibular gland. Black arrowheads are used to indicate expression in presumptive submandibular autonomic ganglia. E: Expression of Amer genes in the lung. F: Expression of Amer genes in the tongue. White arrowheads are used to indicate expression in presumptive neuronal columns. V (ventral) and D (dorsal) indicate the orientation of the tissue. Be, branching epithelium; Cts, connective tissue sheath; E, eye; H, heart; Ie, interfollicular epidermis; Im, intrinsic muscle of the tongue; Lm, lung mesenchyme; Ns, nasal septum; Oe, olfactory epithelium; Ore, oral epithelium; Sg, serous glands; St, sympathetic trunk.

Download figure to PowerPoint

In the developing vibrissae, Wtx/Amer1 transcripts were observed in the epithelial compartment, predominantly in the connective tissue sheath (Fig. 7C). Additionally, Wtx/Amer1 expression was found in the interfollicular epidermis. In contrast, the developing follicles were almost devoid of Amer2 transcripts, but expression seemed confined to the interfollicular epidermis in their immediate surroundings (Fig. 7C).

At E14.5, Wtx/Amer1 mRNA was patent in the branching epithelium of the developing submandibulary salivary glands (Fig. 7D). Amer2 expression was slightly above background levels. Interestingly, Amer2 and Amer3 expression was prominent in the presumptive submandibular ganglia along the ducts of the submandibular gland (Fig. 7D, black arrowheads).

Wtx/Amer1 was ubiquitously and strongly expressed in the mesenchymal component of the lung buds at E12.5 (Fig. 7E). Moreover, Wtx/Amer1 labeling in the luminal side of some of the branches of the epithelial bronchial tree was also detected (Fig. 7E inset). In contrast, very low levels of Amer2 expression were found throughout the developing lungs whereas no expression of Amer3 could be detected. At E14.5, the level of expression of Wtx/Amer1 in the lungs was significantly reduced in the mesenchymal tissue and expression in the epithelial component was mainly restricted to the epithelium of the terminal bronchi (Fig. 9(e) inset). Prominent Wtx/Amer1 expression was also seen in the luminal side of the main bronchus (Fig. 9(f)).

Another feature of note was the presence of Wtx/Amer1 transcripts in the intrinsic muscle of the tongue (genioglossus) (Figs. 7F, 9(c), and data not shown) as well as the oral and soft palate epithelium (Figs. 7F, 9(c)). In addition, clusters of cells at the ventrolateral portion of the tongue, which could correspond to neuronal columns, exhibited strong Amer3 hybridization signal (Fig. 7F, white arrowheads). Finally, the esophageal epithelium was also labeled for Wtx/Amer1 (Fig. 9(f)).

Expression in the Urogenital System

Wilms' tumor is a developmental tumor of the kidney and given the involvement of Wtx/Amer1 in this type of cancer, we were very interested to study a potential expression of Amer genes during urogenital development.

In the developing kidney, only transcripts of Wtx/Amer1 and Amer2 were detected being the expression highly developmentally regulated. At E10.5, expression of Wtx/Amer1 was first detected in the urogenital ridge and at E11.5, both Wtx/Amer1 and Amer2 were observed in the metanephric mesenchyme surrounding the branching epithelium (data not shown). From E12.5 onward, Wtx/Amer1 showed overt expression in the condensing mesenchyme and derived early epithelial structures, such as comma and S-shaped bodies (Fig. 8A,B). Wtx/Amer1 expression in the branching epithelia—with the exception of the ureteric bud tips could not be detected. Amer2 transcripts overlapped highly with those of Wtx/Amer1, although levels of expression were much lower (Fig. 8A,B). At later stages, expression of Wtx/Amer1 and Amer2 decreased and became confined to the cortical (nephrogenic) region of the kidney (data not shown). This spatiotemporal expression suggests that Wtx/Amer1 is active in the progenitor cell population that is supposed to give rise to Wilms' tumors. Indeed Wtx/Amer1 was expressed in a similar, but not completely overlapping pattern to the Wilms' tumor suppressor gene WT1 as previously reported for embryonic human tissues (Rivera et al.,2007). We could not detect expression in more mature tubular or glomerular structures.

thumbnail image

Figure 8. Expression of Wtx/Amer1 and Amer2 genes in the urogenital system at embryonic day (E) 14.5 (sagittal sections). A: Expression in the kidney and adrenoglands. The arrows indicate chromaffin cells. B: Higher power views of the kidney cortical region. The dotted and dashed lines are used to delineate ureteric tips and S-shaped bodies, respectively. C: Expression in the testis. D: Expression in the ovary. E: Expression the urogenital sinus (future bladder). A, adventitia of the bladder; Ag, adrenogland; Be, branching epithelia; Cm, condensing mesenchyme; CMd, caudal part of the mesonephric duct; D, detrusor muscle of the bladder; E, epithelium of the bladder (Urothelium); Ge, germinal epithelium; Hp, hypogastric plexus at the level of the bladder neck; K, kidney; Mm, muscularis mucosa of the bladder; PMd, proximal part of the mesonephric duct; S, S-shaped body; St, seminiferous tubules; U, urethra; Ut, ureteric tip.

Download figure to PowerPoint

In the developing adrenal glands, Wtx/Amer1 was expressed at low levels in the cortical region. A major molecular landmark is the unambiguous detection of Amer2 hybridization signals in groups of cells of the medullary region (Fig. 8A, arrows, Fig. 9(i)). These cells very likely correspond to neural crest derived adrenal medullary chromaffin cells, which could be confirmed by a co-staining using tyrosine hydroxylase as a marker (Lohr et al.,2006).

thumbnail image

Figure 9. Other sites of expression of Amer genes. a: Expression of Wtx/Amer1 in embryonic day (E) 14.5 mouse forelimb. Gelatin sections at three different levels after staining and re-fixation of the whole-mount limb are shown. b: Expression of Wtx/Amer1 in the femur at E14.5. Higher power views of distal (b1) and medial (b2) regions are shown. c: Expression of Wtx/Amer1 in the palate at E14.5. d: Expression of Wtx/Amer1 in a nucleus of the medulla oblongata at E14.5. e: Expression of Wtx/Amer1 in the lung at E15.5. The inset shows expression in the luminal side of the epithelia of a segmental bronchus. f: Expression of WTX/Amer1 in the esophageal and main bronchus epithelial lumen at E14.5. g: Expression of Wtx/Amer1 in the umbilical artery and vein of the umbilical cord at E12.5. h: Expression of Wtx/Amer1 in the thymus at E14.5. i: Expression of Amer2 in the adrenogland at E14.5. The arrowheads indicate neurons of the suprarenal ganglion. j: Expression of Amer2 in the sympathetic trunk at E12.5. k: Expression of Amer2 in the hypogastric plexus E14.5. l: Expression of Amer3 in the hypogastric plexus E14.5. Ag, adrenogland; Br, bronchus; D, diaphysis; Da, dorsal aorta; E, esophagus; Ep, epiphysis; H, heart; Hp, hypogastric plexus; Htc, hypertrophic chondrocytes; K, kidney; Lm, limb muscle; MBr, main bronchus; Mo, medulla oblongata; P, cartilage primordium of the palatal shelf of maxilla; Pe, palatal epithelium; Pt, periosteum, Rp, residual lumen of Rathke's pouch; St, sympathetic trunk; T, tongue; Th, thymus; Uc, umbilical cord.

Download figure to PowerPoint

In respect to the developing gonads, Wtx/Amer1 was very strongly expressed in the coelomic epithelium of the urogenital ridge from E10.5 (Figs. 1B(b), 4A). At E12.5, conspicuous hybridization signal for Wtx/Amer1 was detected in the gonadal epithelium of both the female and male gonad (data not shown). However, expression for Wtx/Amer1 was excluded from the mesonephric tubules, the mesonephric (Wolffian), and the paramesonephric (Mullerian) ducts (data not shown). At E14.5, the interstitial tissue between the seminiferous tubules of the male gonad was highly positive for Wtx/Amer1 transcripts (Fig. 8C). In the female gonad, the highest expression was detected in the germinal epithelium (Fig. 8D). The “spotty” pattern observed throughout the ovarian tissue was probably due to the main expression of Wtx/Amer1 around the ovigerous cords. Amer2 expression, while present, was substantially lower than that of Wtx/Amer1 in gonadal tissues, whereas no expression of Amer3 could be detected at any of the stages studied. Amer2 seemed to be expressed at very low levels in the coelomic epithelium of the male gonad at E12.5 (data not shown), being restricted to a subset of cells of the interstitial population at E14.5 (Fig. 8C). In the female gonad, it was expressed at low levels in the cortical region at E14.5 (Fig. 8D).

In the future bladder at E14.5, Wtx/Amer1 was prominently expressed in the muscularis mucosa and external adventicia layer, whereas much lower expression was seen in the smooth muscle layers (detrusor muscle; Fig. 8E). In the case of Amer2, only faint expression was observed in the future bladder wall. However, strong expressions of Amer2, and to a lesser extent in case of Amer3, were detected in the bladder neck (Fig. 8E, bracket, and data not shown). These hybridization signals are likely to correspond to sympathetic neurons from the sympathetic chain and hypogastric plexus (see also Figs. 9(k) and 9(l)).

Other Sites of Amer Gene Expression

In the developing limbs, both Wtx/Amer1 and Amer2 transcripts were detected. At E10.5, strong expression of Wtx/Amer1 was observed in the limb buds (Fig. 1B(a)). In contrast, Amer2 hybridization signal was significantly less intense and mostly confined to the distal part of the buds (Fig. 2B(a)). Sections revealed that the labeling in both cases was mainly of mesodermal origin. The thin layer of ectodermal cells that ensheath those limb bud mesenchymal cells appeared negative. At later stages, intense labeling for Wtx/Amer1 was observed in the interdigital mesenchyme (Fig. 9(a)) right below the surface ectoderm. Labeling for Amer2 was also present, although at lower level (data not shown). Strong expression of Wtx/Amer1 was also observed in differentiating muscles of the limb muscles (Fig. 9(b)) and body wall (Figs. 1A(b), 4B, and data not shown). Lower labeling was observed for Amer2 (data not shown). These results are consistent with the early expression of Wtx/Amer1 and Amer2 in the somites (Figs. 1A(b,c), 2A(c)). In addition, in the skeletal system, moderate expression of Wtx/Amer1 was detected in the epiphyseal region of the long bones at E14.5, whereas the ossifying diaphyseal region was virtually devoid of staining (Fig. 9(b–b2). Amer2 expression followed that of Wtx/Amer1, but at seemingly lower intensity (data not shown). The Wtx/Amer1 expression in the forming bones overlaps with a previous study (Jenkins et al.,2009), although in our case we could not detect strong labeling as reported. On the other hand, we could detect specific and intense expression in extraskeletal structures such as the kidneys, the gonads, the lungs, and the central nervous system. These differences in sensitivity within different structures might be due to probe differences or different hybridization conditions. Finally, sections through the ribs and vertebrae did not show labeling for any of the Amer genes.

In the cardiovascular system, clear Amer2 labeling was found in the thoracic dorsal aorta from E11.5 (Fig. 4A,B; Fig. 9(j)). Wtx/Amer1 was detected in both the umbilical artery and vein of the umbilical cord constituting one of the strongest areas of Wtx/Amer1 expression (Fig. 1A(b), 1B(b), Fig. 9(g)). We could not detect specific expression of any of the Amer genes in the heart chambers at any of the studied stages (Fig. 4A–D, and data not shown).

Finally, and in contrast to a previous report (Jenkins et al.,2009), Wtx/Amer1 did not appear to be expressed in the thymic rudiment at the stages analyzed (E13.5–E14.5; Fig. 9(h) and data not shown). Nevertheless, an enrichment of Wtx/Amer1 signal above background levels was observed at the level of the cortical region of the thymus (Fig. 9(h), bracket).

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Here, we have characterized the expression of Wtx/Amer1 and the Wtx related genes Amer2 and Amer3 during mouse embryonic development. Genes belonging to the same gene family often share common sites of expression pattern and we expected that this may also be the case for the Amer genes. Indeed, we observed that the three members are expressed in a highly overlapping manner, in particular concerning neuroectoderm derivatives, yet they also have distinct temporal and tissue-specific signatures.

Overall, our results indicate that Amer genes share to a certain extent expression in neurons of both central and peripheral nervous systems, and in many neural crest derivatives including sensory cranial ganglia, dorsal root ganglia, autonomic ganglia, and branchial arches. This spatial and temporal overlap of gene expression patterns may suggest that one of the original functions of an AMER ancestor protein may have been related to the development of the nervous system. Whether Amer genes play a major role in the development of those structures and whether they act in a functionally redundant manner remains to be investigated. However, it is noteworthy that patients with germline mutations in WTX/AMER1 display, in addition to the sclerosing skeletal dysplasia, central nervous system malformations, and learning disabilities (Jenkins et al.,2009) pointing toward an important role of WTX/AMER1 during neurogenesis.

Wtx/Amer1 appears to be the most widely expressed member of the Amer gene family and staining could be detected in ectoderm, endoderm, and mesoderm derived tissues. This broad expression may reflect a novel function(s) adopted by this protein. Indeed, Wtx/Amer1 has adopted a long C-terminal domain which seems to be able to interact with β-catenin, a function that—based on their protein structure—is unlikely to be found in Amer2 and Amer3. The broad and specific expression of Wtx/Amer1 in non-neural tissues, such as the somites, the developing limb buds, the axial muscles, the kidneys, the male gonad, and the lungs suggest multiple independent roles of this gene during embryogenesis. This pattern of expression suggests potential roles of WTX/AMER1 in muscle, bone, and kidney development in correlation with the clinical phenotypes of patients with either germline (Jenkins et al.,2009) or de novo (Rivera et al.,2007) WTX/AMER1 mutations. Finally, the robust expression of Wtx/Amer1 in the facial mesenchyme, branchial arches, and somites might also suggest involvement of this gene in the differentiation of neural crest cells and mesoderm derived mesenchyme (Hunter et al.,2006; Fisher et al.,2006).

Wtx/Amer1 was also significantly present in places where mesenchymal–epithelial interactions take place. Canonical Wnt signaling is known to be essential in many aspects of tissue branching in organs such as the kidney, lung, and salivary gland (for review, see Grigoryan et al.,2008). Therefore, the specific expression of Wtx/Amer1 in these organs might be related to its role as a modulator of Wnt/β-catenin signaling and be required for proper morphogenesis.

Finally and remarkably, our data indicate that Wtx/Amer1 expression overlaps with regions where both Wnt genes and Wnt pathway modulators have been reported to be expressed and play a developmental role (Parr et al.,1993; Bhat et al.,1994; Takada et al.,1994; Ikeya et al.,1997; Zeng et al.,1997; Yamaguchi et al., 1999; Hasegawa et al.,2002; Lan et al.,2006; Yu et al.,2007; Summerhurst et al.,2008; Vendrell et al.,2009; Witte et al.,2009). Moreover, a comprehensive view of the domains of expression of Amer genes throughout embryonic development, suggests involvement of these genes in processes such as cellular differentiation, organ morphogenesis, and tissue patterning. It will now be important to perform functional studies to elucidate the physiological role of Amer genes and their relationship with the Wnt signaling pathway.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Embryo Collection

Embryos were collected from time-mated C57B6 females considering the date when the vaginal plug was observed as embryonic day 0.5 (E0.5). Embryos from E11.5 to E18.5 were fixed with 4% paraformaldehyde (PFA) in phosphate buffer saline (PBS) at 4°C overnight. Embryos were then washed in PBS, dehydrated through a graded series of ethanol, placed in xylene, and paraffin embedded.

Embryos from E8.5 to E11.5 were fixed for 1 hr in PFA 4%, washed in PBS, dehydrated through a graded methanol series and kept in 100% methanol at −20°C till use for whole-mount in situ hybridization.

In Situ Hybridization

In situ hybridizations on 10-μm-thick paraffin embedded sections or on whole-mount sections were carried out essentially as described previously (Chaboissier et al.,2004). A minimum of two independent experiments with at range of two to four embryos per developmental stage were performed.

Hybridizations were performed with digoxigenin-UTP labeled antisense probes transcribed with T7 or Sp6 polymerases. Expression was revealed by colorimetric staining using an anti-digoxigenin antibody coupled to alkaline phosphatase in the presence of BM purple (Roche Diagnostics) supplemented with 2 mM levamisole (Sigma). Control experiments were performed using corresponding sense riboprobes on adjacent sections, giving either no signal or a uniformly low background as expected. In case of Wtx/Amer1, while two different antisense RNA probes were used for the detection of gene transcripts, data were reproducible and consistently overlapping with those two different probes.

Whole-mount stained embryos were then refixed in PFA 4% in PBS, embedded in a gelatin/albumin mixture supplemented with 2.5% glutaraldehyde and sectioned in 50- to 80-μm-thick vibratome sections.

Probes

Wtx/Amer-1, 2, and 3 riboprobes used to generate the data were obtained by RT-PCR using total RNA isolated from E12.5 mouse embryos. Purified PCR products were cloned into PCRII vector (Invitrogen). Details concerning design of the probes are shown in Table 2.

Table 2. Details of Expression Probes Used to Reveal Specific Expression
GeneExtent of probe in GenBank sequenceProbe length in nucleotides
  • 1

    Referred as probe in N-terminal.

  • 2

    Referred as probe in C-terminal.

Wtx/Amer1Nucleotide 1604-2526 on NM_175179.41923 bp
Wtx/Amer1Nucleotide 630-1248 on NM_175179.42619 bp
Amer2Nucleotide 914-1897 on NM_028113.3984 bp
Amer3Nucleotide 217-1168 on NM_213727.2952 bp

RT-PCR

A total of four E7.5, four E8.5, three E9.5, and two E10.5 embryos were collected and snap-frozen. RNA was extracted using Trizol (Invitrogen), cDNAs generated from 3 μg of RNA (M-MLV Reverse Transcriptase System and random hexamers; Invitrogen) and 1 μl of the produced cDNA used for semiquantitative PCR. A total of 0.5 μl of the original RNA sample (RT-PCR without reverse transcription) was used as a DNA contamination control. All experiments were performed in duplicate. The sequences of the primers used are as follows: mWTX_fw: gctgtagtcccggtgaagg; mWTX_rs: gtcaggaagcatcacagtgg; mAmer2_fw: gctccacagaattcccattg; mAmer2_rs: tgctccttctccggatgtt; mAmer3_fw: aaggcacggctttcctct; mAmer3_rs: aggtcctggcataggctgt; mHPRT_fw: tcctcctcagaccgctttt; mHPRT_rs: cctggttcatcatcgctaatc. 25 cycles of PCR were performed using annealing temperatures of 58°C for wtx/Amer1 and Hprt, 56°C for Amer2 and 54°C for Amer3.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

We thank Thomas Lamonerie and Michele Studer for their comments on the manuscript. We also thank Fariba Ranc for providing mice. G.C. was supported by a Marie-Curie fellowship as part of the InterDeC PhD program and G.C. and A.B. by personal fellowships from the Association pour la Recherche sur le Cancer (ARC). This work was supported by grants from ARC (grant 1130) and the Association for International Cancer Research (AICR grant 09-0752).

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information
  • Andrieu D, Watrin F, Niinobe M, Yoshikawa K, Muscatelli F, Fernandez PA. 2003. Expression of the Prader-Willi gene Necdin during mouse nervous system development correlates with neuronal differentiation and p75NTR expression. Gene Expr Patterns 3: 761765.
  • Bhat RV, Baraban JM, Johnson RC, Eipper BA, Mains RE. 1994. High levels of expression of the tumor suppressor gene APC during development of the rat central nervous system. J Neurosci 14: 30593071.
  • Chaboissier MC, Kobayashi A, Vidal VI, Lutzkendorf S, van de Kant HJ, Wegner M, de Rooij DG, Behringer RR, Schedl A. 2004. Functional analysis of Sox8 and Sox9 during sex determination in the mouse. Development 131: 18911901.
  • Fisher DA, Kivimae S, Hoshino J, Suriben R, Martin PM, Baxter N, Cheyette BN. 2006. Three Dact gene family members are expressed during embryonic development and in the adult brains of mice. Dev Dyn 235: 26202630.
  • Grigoryan T, Wend P, Klaus A, Birchmeier W. 2008. Deciphering the function of canonical Wnt signals in development and disease: conditional loss- and gain-of-function mutations of beta-catenin in mice. Genes Dev 22: 23082341.
  • Grohmann A, Tanneberger K, Alzner A, Schneikert J, Behrens J. 2007. AMER1 regulates the distribution of the tumor suppressor APC between microtubules and the plasma membrane. J Cell Sci 120: 37383747.
  • Hasegawa S, Sato T, Akazawa H, Okada H, Maeno A, Ito M, Sugitani Y, Shibata H, Miyazaki Ji J, Katsuki M, Yamauchi Y, Yamamura Ki K, Katamine S, Noda T. 2002. Apoptosis in neural crest cells by functional loss of APC tumor suppressor gene. Proc Natl Acad Sci U S A 99: 297302.
  • Hunter NL, Hikasa H, Dymecki SM, Sokol SY. 2006. Vertebrate homologues of Frodo are dynamically expressed during embryonic development in tissues undergoing extensive morphogenetic movements. Dev Dyn 235: 279284.
  • Ikeya M, Lee SM, Johnson JE, McMahon AP, Takada S. 1997. Wnt signalling required for expansion of neural crest and CNS progenitors. Nature 389: 966970.
  • Jenkins ZA, van Kogelenberg M, Morgan T, Jeffs A, Fukuzawa R, Pearl E, Thaller C, Hing AV, Porteous ME, Garcia-Minaur S, Bohring A, Lacombe D, Stewart F, Fiskerstrand T, Bindoff L, Berland S, Ades LC, Tchan M, David A, Wilson LC, Hennekam RC, Donnai D, Mansour S, Cormier-Daire V, Robertson SP. 2009. Germline mutations in WTX cause a sclerosing skeletal dysplasia but do not predispose to tumorigenesis. Nat Genet 41: 95100.
  • Lan Y, Ryan RC, Zhang Z, Bullard SA, Bush JO, Maltby KM, Lidral AC, Jiang R. 2006. Expression of Wnt9b and activation of canonical Wnt signaling during midfacial morphogenesis in mice. Dev Dyn 235: 14481454.
  • Lohr J, Gut P, Karch N, Unsicker K, Huber K. 2006. Development of adrenal chromaffin cells in Sf1 heterozygous mice. Cell Tissue Res 325: 437444.
  • Major MB, Camp ND, Berndt JD, Yi X, Goldenberg SJ, Hubbert C, Biechele TL, Gingras AC, Zheng N, Maccoss MJ, Angers S, Moon RT. 2007. Wilms tumor suppressor WTX negatively regulates WNT/beta-catenin signaling. Science 316: 10431046.
  • Parr BA, Shea MJ, Vassileva G, McMahon AP. 1993. Mouse Wnt genes exhibit discrete domains of expression in the early embryonic CNS and limb buds. Development 119: 247261.
  • Rivera MN, Kim WJ, Wells J, Driscoll DR, Brannigan BW, Han M, Kim JC, Feinberg AP, Gerald WL, Vargas SO, Chin L, Iafrate AJ, Bell DW, Haber DA. 2007. An X chromosome gene, WTX, is commonly inactivated in Wilms tumor. Science 315: 642645.
  • Sahly I, Gogat K, Kobetz A, Marchant D, Menasche M, Castel M, Revah F, Dufier J, Guerre-Millo M, Abitbol MM. 1998. Prominent neuronal-specific tub gene expression in cellular targets of tubby mice mutation. Hum Mol Genet 7: 14371447.
  • Summerhurst K, Stark M, Sharpe J, Davidson D, Murphy P. 2008. 3D representation of Wnt and Frizzled gene expression patterns in the mouse embryo at embryonic day 11.5 (Ts19). Gene Expr Patterns 8: 331348.
  • Takada S, Stark KL, Shea MJ, Vassileva G, McMahon JA, McMahon AP. 1994. Wnt-3a regulates somite and tailbud formation in the mouse embryo. Genes Dev 8: 174189.
  • Vendrell V, Summerhurst K, Sharpe J, Davidson D, Murphy P. 2009. Gene expression analysis of canonical Wnt pathway transcriptional regulators during early morphogenesis of the facial region in the mouse embryo. Gene Expr Patterns 9: 296305.
  • Witte F, Dokas J, Neuendorf F, Mundlos S, Stricker S. 2009. Comprehensive expression analysis of all Wnt genes and their major secreted antagonists during mouse limb development and cartilage differentiation. Gene Expr Patterns 9: 215223.
  • Yamaguchi TP, Bradley A, McMahon AP, Jones S. 1999. A Wnt5a pathway underlies outgrowth of multiple structures in the vertebrate embryo. Development 126: 12111223.
  • Yu HM, Liu B, Costantini F, Hsu W. 2007. Impaired neural development caused by inducible expression of Axin in transgenic mice. Mech Dev 124: 146156.
  • Zeng L, Fagotto F, Zhang T, Hsu W, Vasicek TJ, Perry WL, 3rd, Lee JJ, Tilghman SM, Gumbiner BM, Costantini F. 1997. The mouse Fused locus encodes Axin, an inhibitor of the Wnt signaling pathway that regulates embryonic axis formation. Cell 90: 181192.

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
DVDY_22313_sm_SuppFig1.tif5078KSupporting Figure 1: Expression of Amer genes during postimplantation mouse embryonic development. A: Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis of Amer genes in embryonic day (E) 7.5–E10.5 mouse embryos. Expression of the Hprt gene was used as a control of mRNA levels. The expression of the three Amer genes at E10.5 was used as a positive control for the assay. B: Whole-mount in situ hybridization analysis of Amer genes at E9.0. Wtx/Amer1 was diffusely expressed along the neuraxis, with a higher expression level in the anterior part (white arrowhead). This anterior-posterior gradient of expression was more evident for Amer2. Note the strong staining located in the anterior embryonic territories and prospective forebrain (black arrowhead). The dotted line indicates the approximate level of a gelatin section after whole-mount staining (lower inset). No Amer3 expression could be detected at this stage. C: Whole-mount in situ hybridization of Amer3 at E9.5 showing high levels of expression in the anterior part of the developing neural tube and cranial ganglia. The white asterisk is used to indicate trapping of stain within the neural tube. (a,b) Gelatin sections of the stained embryos at a level shown in the schematic drawing. White arrowheads are used to indicate regionalization of Amer3 expression in the neural epithelium. Fv, fourth ventricle, H, heart; Hb, hindbrain; Me, mesencephalon; Nt, neural tube; S, somites; Sc, spinal cord; Tc, telencephalon; VII/VIIIg, facio-acoustic ganglion; IXg, petrosal ganglion; Xg, nodose ganglion.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.