SEARCH

SEARCH BY CITATION

Keywords:

  • Ror1;
  • postnatal growth retardation phenotype;
  • skeletal defects;
  • mice

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Ror1 is a member of the Ror-family receptor tyrosine kinases. Ror1 is broadly expressed in various tissues and organs during mouse embryonic development. However, so far little is known about its function. The closely related family member Ror2 was shown to play a crucial role in skeletogenesis and has been shown to act as a co-receptor for Wnt5a mediating non-canonical Wnt-signaling. Previously, it has been shown that during embryonic development Ror1 acts in part redundantly with Ror2 in the skeletal and cardiovascular systems. In this study, we report that loss of the orphan receptor Ror1 results in a variety of phenotypic defects within the skeletal and urogenital systems and that Ror1 mutant mice display a postnatal growth retardation phenotype. Developmental Dynamics 239:2266–2277, 2010. © 2010 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Ror1 is one of the two vertebrate Ror-family members of orphan receptor-tyrosine kinases (Yoda et al.,2003; Green et al.,2008; Minami et al.,2009). Like its closely related family member Ror2, Ror1 contains an extracellular cysteine-rich domain (CRD) similar to the CRD domain of the Wnt-receptor frizzled (Saldanha et al.,1998). It has been demonstrated that Ror2 can bind to Wnt-ligands as well as to the BMP/TGFβ-family member, Gdf5 (Oishi et al.,2003; Sammar et al.,2004; Liu et al.,2008). Ror2 activity can mediate non-canonical Wnt-signaling through interaction with Wnt5a, and modulates the canonical Wnt-signaling pathway through differential interaction with the Frizzled receptor (Hikasa et al.,2002; Mikels and Nusse,2006; He et al.,2008; Li et al.,2008). Ror1 has been recently demonstrated to be capable of binding the Wnt5a ligand as well. However, whether this binding results in functional activity is currently not known (Fukuda et al.,2008). Both Ror genes are widely expressed during embryonic development, in limbs, perichondrium of the developing long bones, teeth, heart, lung, liver, gut, urogenital tract, and hippocampal neurons (Oishi et al.,1999; Al-Shawi et al.,2001; Matsuda et al.,2001; Paganoni and Ferreira,2003; Rodriguez-Niedenfuhr et al.,2004; Schwabe et al.,2004). Mutations in ROR2 in humans cause autosomal dominant brachydactyly type B (BDB) and are associated with an autosomal recessive form of Robinow syndrome (RS) (Afzal et al.,2000; Oldridge et al.,2000; Schwabe et al.,2000; van Bokhoven et al.,2000; Hamamy et al.,2006). Loss of Ror2 in mice results in phenotypic changes resembling RS (DeChiara et al.,2000; Takeuchi et al.,2000; Schwabe et al.,2004). The point mutation Ror2-W749X, linked to human BDB, behaves as a recessive mutation in mouse causing brachydactyly and models recessive RS (Raz et al.,2008). In addition, ROR family member have been implicated in tumor formation in humans. ROR1 has been found to be overexpressed in patients with acute and chronic lymphoblastic leukemia (Shabani et al.,2007,2008; Daneshmanesh et al.,2008) and was found to act as a survival kinase in HeLa cervical carcinoma cells (MacKeigan et al.,2005). ROR2 has been found to be overexpressed in squamous cell carcinoma, renal cell carcinoma, and metastatic melanoma, and to regulate osteosarcoma cell invasiveness (Enomoto et al.,2009; Kobayashi et al.,2009; Morioka et al.,2009; Wright et al.,2009; O'Connell et al.,2010). Previously it was reported that loss of Ror1 in mice results in perinatal lethality due to respiratory defects, but that these mice lack any abnormalities in skeletogenesis (Nomi et al.,2001). Here, we have re-examined the Ror1 mutants and found that the mice have subtle skeletal defects at birth; they showed fusions of the sternebrae, a cleft in the basisphenoid bone, and abnormal development of the cervical vertebral element C2. Homozygous mice survived in our facility and displayed abnormal synchondrosis in the cranial base, postnatal growth retardation, and age-related skeletal changes. Furthermore, we observed additional phenotypic defects in Ror1−/− mutants, such as female infertility probably due to an imperforated hymen, kidney defects, and occasionally enlarged seminal vesicles in Ror1−/− males.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Skeletal Defects in Ror1−/− Embryos

Ror1 mutant embryos displayed very distinct skeletal defects, which were apparent prior to birth. The sternum of Ror1−/− embryos was shortened and showed fusion of caudal sternebrae (S) involving to a variable degree S1–S4 (Fig. 1A and Table 1). In addition, the xyphoid process was abnormally bifurcated showing two ossification centers in all mutants examined at birth or early postnatal stages (Fig. 1A). Defects in sternal development were already detectable at E15.5 where the two sternal bands were still separated from each other in the caudal region of Ror1−/− embryos, while they were already almost completely fused along the entire length in the wild-type littermate controls (Fig. 1B, E). The sternal-costal junctions, demarcations between the end of the ribs and the sternal tissue, can be distinguished by their reduced reactivity with the proteoglycan staining reagent alcian blue and low levels of Collagen 2α1 (Col2α1) transcript, appeared right at the sternal bands in the wild-type (see arrowheads in Fig. 1C), while they were located more laterally in the Ror1 mutants (Fig. 1F). In situ hybridization for the prehypertrophic marker, Ihh, revealed that the onset of chondrocyte differentiation occurs normally in the Ror1 mutant sterni (Fig. 1D, G). However, in the caudal part the Ihh expression domains were not absolutely restricted to the intercostal segments (arrowheads in Fig. 1G). At E17.5, the abnormal shape and location of the sternal-costal junctions were still present in the mutant sterni. The sternal bands had either begun to fuse abnormally, visible by the presence of alcian blue–positive and Col2α1 (not shown) -expressing cells in the midline, or were still separated by a small band of none-chondrogenic cells (data not shown). However, as in the wild-type, chondrocytes within the sternal bands had maturated into hypertrophic chondrocytes that expressed Collagen 10α1 (Col10α1) and Osteopontin (Opn) and produced mineralized matrix in all mutants examined (Fig. 1I, J, M, N). In contrast to the controls where this process was restricted to the intercostals regions, hypertrophic cells differentiated also at the ends of ribs in the mutants leading to the formation of continuous hypertrophic domains in the region of sternebrae 3–4 (Fig. 1M, N). Concomitantly, Ihh expression was altered and expressed all around the hypertrophic regions (Fig. 1K, R). The abnormal expression of maturation markers, such as Ihh and Col10α1, suggests that the absence of functional Ror1 affects the normal organization of cells into a growth plate-like structure in the intercostal regions of the sternum, instead those are now located at the costal-sternal junctions. This defect was even more apparent at P0 where Col10α1 and Ihh were expressed almost all around the fused sternebrae elements, including the regions at the ends of the ribs (data not shown).

thumbnail image

Figure 1. Sternum defects in Ror1 mutant mice. A: Schematic representation of the ossification centers in the sternum (colored in red), from rostral to caudal: manubrium, sternebrae (s) 1–4, xyphoid process. Alcian blue/alizarin red stained sterni with ribs of postnatal day 5 (P5) old wild-type (WT) and two Ror1 mutant animals. B–G: Sections from E15.5 old wild-type (B–E) and mutant embryos (E–G), stained with alcian blue and eosin (B, E), hybridized with probes for Col2a1 (C, F) and Ihh (D, G). Arrowheads in B, C, E, F indicate the normal (B, C) and abnormal (E, F) shape and location of the sternal-costal junctions. Arrowheads in G indicate the fused Ihh expression domain across two intercostals segments. H–R: Sections from E17.5 old wild-type (H–K) and mutant (L–R) embryos, stained with von Kossa / alcian blue (vK/AB) (H, L), or hybridized with probes for Col10a1 (I, M), Osteopontin (Opn) (J, N) and Ihh (K, R).

Download figure to PowerPoint

Table 1. Summary of the Observed Sternebrae Fusion Defects in Mutant and Control (Wt/Het) Animals
Genotypes4+s3s4-s2s4-s1s4-manubrium
  • a

    Occasionally a slight misalignment of sternum halves was observed (n=3; e.g. WT in Fig. 1C).

Wt/Het (n=108)a0000
Mut (n=35)121481

In addition to the defects in the sternum, we detected skeletal abnormalities in the cervical vertebral element C2 and the base of the skull in newborns (P0). The cervical element C2 appeared wider in the mutants (n=9) and was split in some mutants (n=4/9; Fig. 2A). In the skulls of mutant newborns, clefts were present in the posterior region of the basisphenoid bone and in the anterior borders of the exoccipitale bones in 100% of the mutants analyzed (n=9; Fig. 2B). No alterations were found in the suture regions in the dorsum of the skull (data not shown). At P5, the clefts had developed into holes, which were still visible at later stages and in adults (Fig. 2C, D, and data not shown). Furthermore, we noticed in the cranium of P5 and P19 heads a bony bridge within the spheno-occipitale synchondrosis connecting the basioccipitale with the basisphenoid bone (arrows in Fig. 2C, D). This resulted in premature synostosis of the spheno-occipitale synchondrosis in the cranial base and an overall shortening of the skull with a more dome-shaped appearance in X-rays at the adult stage (Fig. 2E). At P5, it was also apparent that the vomeral bones were hypoplastic (Fig. 2C). In the P17 and P19 mutant heads, we noticed a hole in the exoccipitale bones, which probably was the result of the cleft already visible in the newborn skulls (n=5; Fig. 2D). The fusion of the basisphenoid and basioccipitale bone was also clearly visible by microCTs of aged mutant specimens (Fig. 2F). None of these skeletal defects was visible in heterozygous Ror1 animals.

thumbnail image

Figure 2. Skull and vertebral defects in Ror1 mutant mice. A: Cervical region of the axial skeleton of wild-type (WT) and two different Ror1−/− newborns (M1 and M2), with M1 showing a widening of the C2 element and M2 showing a split C2 element with a dorsal floating piece (arrowheads). B: Schematic view of the basal cranial bones (bo, basioccipitale; bs, basisphenoid; ps, presphenoid; eo, exoccipitale) and ventral view on alcian blue/alizarin red–stained skulls of wild-type and Ror1−/− newborns (PO), showing the cleft in the basisphenoid bone (arrow). The magnified regions on the right show the exoccipitale bone of wild-type (WT) and Ror1−/− (M), with the arrowhead pointing at the cleft in the mutant. C: Dorsal view on the alcian blue/alizarin red–stained base of a wild-type and mutant P5 old skull, after removal of the ventral flat bones. The arrow indicates the bony bridge between the basioccipitale and basisphenoid bone, the arrowhead points at the hole in the basisphenoid bone, and the asterisks mark the vomeral bones. Note: The alcian blue staining in this sample is almost not visible. D: Ventral view on alcian blue/alizarin red–stained skulls of wild-type and Ror1−/− P19 old mice, with the arrow pointing at the bony bridge between the basioccipitale and basisphenoid bone. The magnified regions on the right show the exooccipitale bone of wild-type (WT) and Ror1−/− (M), with the arrowhead pointing at the hole in the mutant. E: X-ray of 3-month-old mice showing the round, dome-like shape of the mutant skull in comparison to the wild-type. F: MicroCT image of the cranial base of wild-type and mutant 18-month-old animals, with the white arrowhead pointing at the synostosis of the basioccipitale and basisphenoid bones in the mutant.

Download figure to PowerPoint

As previously described, Ror1 is expressed at E10.5 and E11.5 in the developing limbs, somites, and head (see Supp. Fig. S1A,B, which is available online). At E12.5, we noticed a prominent expression of Ror1 in the mesoderm of the body wall and at E13.5 in the sternal bars (see Supp. Fig. S1C–E). Ror1 appears also to be expressed in perichondrium of the skeletal elements in the developing limb (see Supp. Fig. S1F, G). Furthermore, we noticed Ror1 expression in the roof of the oral cavity and in the area of the developing pituitary gland (see Supp. Fig. S1H, I). Thus, Ror1 is expressed in or near the skeletal elements/structures affected by the loss of Ror1 activity.

Growth retardation of the Ror1 mutant pups became apparent at P2 (see Fig. 4), associated with morphological and molecular changes in the growth plates of long bones (Fig. 3B), while there were no changes detectable at E17.5 or in newborns (Fig. 3A and data not shown). At P2, the prehypertrophic, Ihh-expressing, and the hypertrophic, Col10α1-expressing zones of the mutant growth plates were shorter compared to wild-type or heterozygous littermate controls (Fig. 3B). In the wild-type growth plates at P2, only the last 3–4 rows of hypertrophic chondrocytes had mineralized matrix, while the hypertrophic chondrocytes towards the articular region were slightly smaller and had a non-mineralized matrix (Fig. 3B). Similarly, Opn was expressed in the last 3–4 rows of hypertrophic chondrocytes in the wild-type growth plate (Fig. 3B). In contrast, in the Ror1 mutant growth plate, only 3–4 rows of hypertrophic cells were present, which all expressed Opn and had a slightly hyper-mineralized matrix (Fig. 3B). Thus, loss of Ror1 seems to affect the differentiation of a distinct subpopulation of hypertrophic cells and prehypertrophic chondrocytes. Examination of P5 specimens revealed a similar phenotype in the growth plate, with a hyper-mineralized matrix and reduced zones of Ihh- and Col10α1-expressing chondrocytes in the mutant (Fig. 3C). In addition, skeletal preparations as well as sections through the long bones revealed that the formation of the secondary ossification center was delayed in Ror1 mutants (Fig. 3C and data not shown).

thumbnail image

Figure 3. Postnatal growth plate phenotypes of Ror1 mutants showing the proximal end of the humerus of wild type and Ror1−/− at P0, P2, and P5. A: P0 growth plate stained with von Kossa/alcian blue (AB) and hybridized with probes for Ihh, Col10α1, and Opn. Note there is no difference between wild type and mutant at this stage. Black bars indicate the zone of hypertrophic chondrocytes in the von Kossa/alcian blue staining and the Col10α1 positive zone. B: P2 growth plate stained with von Kossa/alcian blue (AB) and hybridized with probes for Ihh, Col10α1, and Opn. Note the reduced size of the Ihh- and Col10α1-positive zones in the mutant compared to the wild type. White bars indicate the zone of Col10α1-positive hypertrophic chondrocytes. At the right, magnified regions of the P2 growth plates from WT and Ror1−/− hybridized with Opn, showing Opn expression throughout the zone of hypertrophic chondrocytes in the Ror1 mutant. Yellow line indicates the border between the prehypertrophic/hypertrophic cells and the border between hypertrophic cells and the osteogenic front is indicated by the red line. C: P5 growth plate stained with von Kossa/alcian blue (AB) and hybridized with probes for Ihh, Col10α1, and Opn, showing reduced zones of Ihh- and Col10α1-positive cells in the mutant. White bars indicate the zone of Col10α1-positive hypertrophic chondrocytes. Alizarin red (AR)/alcian blue (AB)–stained wild-type and mutant humeri at P5, showing reduced or absent secondary ossification centers in the mutant (arrowheads). D: Alizarin red/alcian blue–stained wild-type, Ror1 heterozygous, and Ror1 mutant humeri and femora of littermates at P19 and bar graph showing the length difference based on the size measurements from three different litters (Ror1+/+n = 4; Ror1+/− n = 5; Ror1−/− n = 5). **P ≤ 0.003 (based on two-tailed Student's t-test).

Download figure to PowerPoint

Ror1 Mutants Show Postnatal Growth Retardation and Have a Reduced Life Expectancy

At postnatal day 2, Ror1 mutant pups could easily be identified by their reduction in size and weight (Fig. 4A, B). Statistically significant reduction in the weight was apparent already at P1. However, the size reduction was less apparent at that age (Fig. 4A and data not shown). In contrast, no significant differences were detected between Ror1 heterozygous and wild-type animals. Within the first 6 postnatal days, mutant pups reached only approximately 50% of the weight of their heterozygous and wild-type littermates (Fig. 4A). The life expectancy of the mutants was reduced; only 60% of the mutants (32/53) survived until weaning (Fig. 4C). The reduced life expectancy might in part be due to the occasional kidney defects (see below) or physical weakness of the runted pups compared to their littermates. Ror1−/− pups, which survived until after weaning, stayed smaller and reached only 60–75% of the weight of their littermates (Fig. 4D, E). Accordingly, their long bones were ∼20% shorter compared to wild-type and heterozygous littermates (see Fig. 3D). X-rays of 3-month-old female mice suggested a decrease in bone density and in cortical thickness (Fig. 4D, see also inset). This finding prompted us to examine volumetric bone mineral density (BMD) and bone geometry by peripheral quantitative computed tomography. Femurs from Ror1 mutant male and female mice were characterized by bonedensitometry, which revealed reductions in the cross-sectional area, total BMD, and cortical thickness in the shaft and metaphyseal region (Table 2). Cortical bone osteopenia at the femoral shaft might be slightly more pronounced in females than in males (Table 2). Likewise, the reduction in weight and size was more prominent in females than in males at the age of 3 months (Fig. 4E and data not shown). Together, this suggests a possible involvement of sex hormones in the expressivity of the mutant phenotype. Mutant males aged for 13–18 months still showed severe weight reduction (32–60%). However, the difference in size was relatively small (5–10%) compared to their littermate controls (Table 3).

thumbnail image

Figure 4. Postnatal growth retardation and reduced survival of Ror1 mutant mice. A: Bar graph showing weight reduction of the Ror1 mutants (n = 6–9) at postnatal days P1–P6 compared to their heterozygous (n = 8) and wild type (n = 8) littermates. **P = 0.0001 (based on two-tailed Student's t-test). B: Pictures of P2 old pups showing size reduction of mutants compared to heterozygous littermate. C: Kaplan Meier survival blot of Ror1 mutants (n = 53; red line) compared to heterozygous and wild type littermates (n = 152; green line) until weaning in percent survival. D: X-ray picture of 3-month-old Ror1−/− (left) and Ror1+/+ (right) female littermates showing size reduction (white arrows point at the tip of the tails) and reduced bone density and cortical thickness of the mutant Ror1−/− femur compared to the control (WT) in the inset (n = 3). E: Bar graphs showing weight reduction of mutant females (Ror1−/− n = 5; Ror1+/− n = 7; Ror1+/+ n = 4) and males (Ror1−/− n = 5; Ror1+/− n = 9) at 3, 6, 8, and 14 weeks of age, compared to littermate controls. Note: The males used in this study were derived from Ror1−/− and Ror1+/− intercrosses; hence, no wild-type littermates were available for comparison.

Download figure to PowerPoint

Table 2. Bone Densitometry Data of Femurs of 3–4-Month-Old Micea
GenotypeSexAge (wk)Cross-sect area (mm)Total BMD Trab (mg/cm3)BMD (mg/cm3)Cort. thickness (mm)
  • a

    BMD, bone mineral density; Cort., cortical; wk, weeks; F, female; M, male; —, not applicable.

Femoral shaft
Wt (n=3)F151.92±0.16699±490.232±0.008
Het (n=6)F151.88±0.13675±310.223±0.011 
Mut (n=4)F151.36±0.11580±520.172±0.020
Het (n=2)M142.54±0.03660±70.247±0.005
Mut (n=2)M141.94±0.08645±840.219±0.014
Femoral metaphysis
Wt (n=3)F153.38±0.20499±23168±110.207±0.016
Het (n=6)F153.41±0.18490±28165±120.203±0.013
Mut (n=4)F152.53±0.32376±38145±100.122±0.028
Het (n=2)M144.20±0.02510±47228±250.226±0.032
Mut (n=2)M143.24±0.40427±70172±170.155±0.028
Table 3. Comparison of Weight and Size in 13–18-Month- (M) Old Ror1 Mutants and Littermates
GenotypeAge (M)Weight (g)Size (cm)
  • a

    Cystic right kidney, left seminal vesicle enlarged.

Het184618.2
Mut182917.5
Wt165218.7
Het165119
Mut163518
Wt154118.5
Het154218.5
Mut152316.5
Het134517.7
Muta131816

Abnormal Ossifications Develop in the Spine of Aged Ror1 Mutants

In alizarin red/alcian blue–stained skeletal preparations of aged mutant mice (15–18 months), we observed abnormal mineralization in the intervertebral discs of the lower thoracic region (n=2/2; T10–T13; arrowheads in Fig. 5A) and occasionally within un-fused sternal synchondroses (data not shown). Abnormal ossification within the axial skeleton could also be observed in microCTs of the lower thoracic spine of 15–18-month-old male mice (n=2/3; arrows in Fig. 5B). In addition, we noticed that there were abnormal ossifications between the spine and the proximal ends of the ribs (white arrowheads in Fig. 5C). The reduction in cortical bone thickness was also visible in the microCTs of the ribs and vertebral bodies (Fig. 5C and data not shown).

thumbnail image

Figure 5. Alterations in the aged skeleton. A: Spines of 18-month-old Ror1+/− and Ror1−/− males stained with alizarin red/alcian blue, showing abnormal mineralization in the intervetebral discs (white arrowheads) between thoracic segments T10–T13 of the mutant. B: MicroCTs of 18-month-old Ror1+/+ and Ror1−/− males showing abnormal mineralization in the intervetebral discs (black arrows) of the mutant spine. C: MicroCTs of the same specimens showing abnormal mineralization in the costovertebral joint of the mutant (white arrowhead).

Download figure to PowerPoint

IGFI Serum Levels Are Reduced in Ror1 Mutants

Given that the hole in the basisphenoid bone of Ror1−/− embryos was located directly below the pituitary gland (see Fig. 6A), we suspected that the postnatal growth retardation might be due to altered hormone production by the pituitary gland. Thus, we examined the specification of different hormone-producing cells using immunohisto-chemical staining for growth hormone (GH), thyroid-stimulating hormone beta (TSHβ), luteinizing hormone alpha and beta (LHα, β), and adrenocorticotropin (ACTH) on E17.5 and P2 sagittal sections. However, no obvious differences in hormone staining were detected between wild-type and Ror1 mutant pituitaries at both stages of development (Fig. 6A and data not shown). Older pituitary glands of Ror1-deficient animals were slightly hypoplastic and had a different shape compared to wild-type and heterozygous littermate controls (Fig. 6B and data not shown). Western blots on pituitary gland extracts of P17 and P19 old littermates revealed, however, no difference in GH levels (Fig. 6C). Although GH production seemed not to be affected, its possible that the levels of secreted GH might be altered in Ror1−/− animals. Since GH synthesis and release from pituitary somatotrophs is pulsatile, the serum GH levels fluctuate accordingly. Thus, instead of measuring the serum GH levels we measured the serum levels of IGF-I, since they directly depend on GH levels. The IGF-I levels were indeed reduced in 3-month-old male and female Ror1 mutant animals (Fig. 6D).

thumbnail image

Figure 6. Analysis of the pituitary gland. A: Sagittal sections through the skull and the pituitary gland of wild-type and Ror1−/− littermates at P0 stained with von Kossa/alcian blue (AB) and at P2 stained with antibodies to hormones produced by specific subpopulations of the anterior lobe: growth hormone (GH), thyroid-stimulating hormone β subunit (TSHβ), luteinizing hormone α (LHα) and β (LHβ) subunits, and adrenocorticotropic hormone (ACTH). B: Morphological appearance of pituitary gland at P17. C: Western blot for growth hormone (GH) and tubulin (tub) from P17 old males and females showing no significant differences in pituitary GH levels between mutants and littermate controls. Note: Brackets indicate corresponding littermates. D: Blot of IGF serum levels from 2–3-month-old males and females, showing reduced IGF serum levels in Ror1−/− males and females (red bars) compared to their littermate controls (n = 1 for each genotype, IGF-serum levels of each specimen were determined by ELISA in duplicates).

Download figure to PowerPoint

Urogenital Defects in Ror1 Mutant Animals

Approximately 90% of the Ror1 mutant females had an abnormal vagina with an imperforated hymen and could, therefore, not reproduce (Fig. 7A). With age, these Ror1−/− females accumulated liquid and cellular material in their uteri resulting in a swelling of the uteri and abdomen (Fig. 7B, C). Almost all Ror1 mutant males tested could reproduce normally, but 3/7 dissected Ror1−/− males showed abnormal seminal vesicles that were either cystic or solid and unilaterally enlarged (Fig. 7D, D′). Approximately 30% (5/17) of the Ror1−/− mice had abnormal kidneys, where double kidneys and double ureters were present unilaterally (Fig. 7E). All of the mutants with kidney defects had been found dead within the first week, with the exception of one male that was sacrificed at the age of 13 months and had a cystic right kidney (see Table 1). In addition to the urogenital defects, we noticed that the mutant animals had almost no subcutaneous fat and that the visceral fat pads associated with the urogenital system were also reduced in size (Fig. 7D, F).

thumbnail image

Figure 7. Non-skeletal defects in Ror1 mutant adult animals. A: Abnormal vagina in the Ror1 mutant female (on the right). B: Swelling of the uteri in a Ror1 mutant female (on the right). C: Dissected uteri of wild-type and Ror1 mutant females. D: Abnormal seminal vesicles (sv) in Ror1 mutant male (right side) and reduced urogenital fat pads (fp) attached to the testis (t). bl, bladder. D′: Fixed genital tract of a Ror1 mutant male, showing enlargement of one of the seminal vesicles. E: Kidneys of wild-type (left) and Ror1 mutant (right) newborn animals, showing unilateral double kidney in the Ror1 mutant. Note: The adrenal glands in the Ror1 mutant were lost during preparation. F: P18 old skinned wild-type (top) and Ror1 mutant (bottom) specimens, showing absence of subcutane white adipose tissue (arrows) in the mutant.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Ror1 mutants have previously been reported to die shortly after birth due to defects in lung maturation (Nomi et al.,2001). Currently, we have no explanation for the increased postnatal survival of Ror1 mutants that were bred in Vienna, particularly since Ror1 mice were maintained in a C57Bl/6 background. Nevertheless, we cannot rule out subtle differences between the C57Bl/6 strains in the two geographically distinct locations. The fact that we still observed a high lethality rate for the Ror1 mutants within the first few days suggests a fitness weakness of Ror1 mutants. In contrast to Ror2, loss-of Ror1 activity resulted only in minor skeletal defects, affecting primarily the sternum, the basisphenoid bone, and the axial element C2 during embryonic development. Ror1 and Ror2 have been implicated as co-receptors in Wnt-signaling and for Ror2 it was shown that it can modulate Gdf5/BMP receptor signaling (Sammar et al.,2004; Green et al.,2008). As such, it is interesting to note that a similar phenotype in the basisphenoid bone has been observed in embryos double mutant for Tcf4/Lef1 during development at E15.5 and in mutants for Bmp7 or conditional mutants of the Tgf-beta receptor 2, Tgfbr2ΔCol2 (Jena et al.,1997; Baffi et al.,2004; Brugmann et al.,2007). Furthermore, it is interesting to note that double mutants for the heparan sulfate 6-O-endosulfatase genes Sulf1 and Sulf2, which alter sulfate modification of heparan molecules in the extracellular matrix, showed a similar phenotype in the basisphenoid bone (Holst et al.,2007; Ratzka et al.,2008). In these mutants, signaling of several growth factors (including Wnts, hedgehogs, and fibroblast growth factors) is probably affected. Mutants for Gli3Δ699/Δ699, which encodes only a N-terminal truncated version of Gli3 solely acting as a repressor, also have a hole in the basisphenoid bone (Bose et al.,2002). Fusions of sternebrae or ectopic mineralization within the fibrocartilage separating the sternebrae have been reported also in Sulf1/2 double mutants and in mutants for the TGFβ/BMP family members, Bmp5 and Gdf5 (Storm and Kingsley,1996; Holst et al.,2007; Ratzka et al.,2008). Thus, given the phenotypic similarities, it might be possible that in analogy to Ror2, Ror1 might not only interact with Wnt-ligands altering Wnt-signaling, but might also modulate TGFβ/BMP signaling.

Besides the patterning defects in certain skeletal elements, we noticed postnatal alterations in the growth plates of the long bones of Ror1 mutants. Here the zones of prehypertrophic and hypertrophic chondrocytes were reduced from postnatal day 2 onwards. Based on our analyses, it seemed that primarily the zone of immature hypertrophic chondrocytes, in which the cells do not have a mineralized matrix, nor do they express Opn, is severely reduced or maybe even lost. This specific defect in chondrocyte maturation might contribute to the fact that the appearance of the secondary ossification centers was delayed as well. Currently, we have no explanation for the molecular nature of the specific defect. The previous study by Nomi and colleagues suggests that Ror1 has redundant functions with Ror2 during embryonic skeletal development (Nomi et al.,2001). However, the study gave no insights into the underlying mechanism explaining the further shortening of the skeletal elements particularly in the stylopode region. Ror2 seems to be regulating chondrocyte maturation primarily at the level of prehypertrophic chondrocytes (Schwabe et al.,2004). Our analysis suggests that in contrast to Ror2, Ror1 might be required at a slightly different step of chondrocyte maturation acting primarily in immature hypertrophic chondrocytes. This could explain the additional decrease in overall length and of the mineralized zone of the stylopode elements, humerus and femur, upon loss of Ror1 in a Ror2 mutant background. This would also explain why there was no significant effect on zeugopode elements such as the ulna and radius upon additional removal of Ror1 (Nomi et al.,2001). Here the differentiation of prehypertrophic and hypertrophic chondrocytes is already severely delayed in Ror2 single mutants, while it still occurs in the stylopode at E15.5 (Schwabe et al.,2004).

In addition to the specific reduction in immature hypertrophic chondrocytes, the postnatal growth deficiency might in part be influenced by the reduction in IGF-I serum levels but it is probably also influenced by sex hormones given that the differences in size are much more pronounced in females than in males. Whether the reduced IGF-I serum levels are related to altered growth hormone production due to the morphological alteration in the basisphenoid bone and the associated pituitary gland deformation or if they might be due to local Ror1 activity in IGF-I-producing organs is currently unclear. While Ror1 is expressed fairly broadly in the organism, it is not expressed in the liver, which is the major site of IGF-I production (Al-Shawi et al.,2001; Baskar et al.,2008). Concomitantly, liver-specific deletion of Igf-1 does not affect growth of the appendicular skeleton (Yakar et al.,1999; Sjogren et al.,2002). Thus, local IGF-I production in the growth plate of the long bones is probably affected in Ror1 mutants, given the reduction in the hypertrophic zone that is the predominant region in which Igf-1 is transcribed postnatally (Reinecke et al.,2000; Smink et al.,2002). IGF-I has been shown to stimulate hypertrophic chondrocyte differentiation (Mushtaq et al.,2004). Thus, a reduction in IGF-I-producing hypertrophic chondrocytes might exaggerate the phenotype. Our phenotypic analysis suggests that Ror1 activity is required for postnatal growth and hypertrophic chondrocyte differentiation and that the phenotype is possibly mediated in part via the GH/IGF-I system. Since Ror1 is fairly broadly expressed and not highly expressed in the chondrocytes, it is currently unclear to what extent the growth plate phenotype is due to a Ror1 activity requirement particularly in chondrocytes. In addition, it is well known that cortical bone mass and size is severely reduced in IGF-I-ablated mice (Moerth et al.,2007). Therefore, it remains to be determined whether the cortical bone osteopenia observed in Ror1 mutants is caused by lack of Ror1 and concomitantly reduced Wnt signaling in periosteal osteoblasts, or by an indirect effect through the GH/IGF-1 axis.

Furthermore, our phenotypic analysis revealed a requirement for Ror1 in the urogenital system. The relatively low penetrance of the kidney defects makes it difficult to study the underlying mechanisms. In addition to Ror1, Ror2 is also expressed in the urogenital tract (Al-Shawi et al.,2001). Interestingly, we noticed in Ror2 mutants a very similar kidney phenotype with double ureters, unilateral or bilateral double kidneys, cystic kidneys, or even sporadic agenesis of one kidney in 30–40% of Ror2 mutants (C. Hartmann, unpublished observation). Thus, it is possible that Ror1 and Ror2 act redundantly in kidney development, although no defect in kidney development has been reported in the previous double mutant analysis (Nomi et al.,2001). Ror1 and Ror2 could possibly modulate Wnt or TGF-β/BMP-signaling during kidney development, as Wnt-signaling as well as TGF-β/BMP-signaling have been functionally implicated in different aspects of kidney development (Martinez and Bertram,2003; Pulkkinen et al.,2008).

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Mouse Husbandry

The generation of the Ror1 mutant allele has been previously described (Nomi et al.,2001). The Ror1 strain was maintained in a C57Bl/6 background. Mutants were generated by intercrosses of heterozygous mice, or through breeding of homozygous males with heterozygous females to increase the number of mutant offspring. Genotyping of mice was performed by PCR using the following primer pairs: for detection of the 1.1-kb wild-type allele the WT_for-primer 5′ GGCAACAAATGGCAAGAAAGTG GTGTC and WT_rev-primer 5′ GAAA TGGAATCCTTAGACTCCGTTATC were used. For detection of the 1.1-kb mutant allele, the WT_for-primer was used in combination with the neo-primer 5′ ATCGCCTTCTATCGCCTT CTTGACGAG.

Skeletal Preparations, MicroCT, and Bone Densitometry

For the alcian blue/alizarin red staining of newborns, postnatal, and adult mouse skeletons, the mice were sacrificed, skinned, eviscerated, fixed in 95% ethanol, and stained according to McLeod (1980). Harvested organs were visually inspected for abnormalities. Three-dimensional medium-resolution images were obtained from the skulls, spine, ribs, and digits of Ror1−/− and control mice (Ror1+/−; Ror1+/+) using microcomputed tomography (eXplore locus SP, GE Healthcare, London, Ontario, Canada). Scans were taken at 28-μm isotropic resolution and 720 projections were acquired over an angular range of 360°. Images were reconstructed and thresholded to distinguish bone voxels with MicroView software version 5.2.2 (GE Healthcare, Buckinghamshire, UK). One threshold was chosen for all specimens or as previously described (Amarilio et al.,2007). Volumetric bone mineral density (BMD) of the femurs was measured by peripheral quantitative computed tomography (pQCT) using a XCT Research M+ pQCT machine (Stratec Medizintechnik, Pforzheim, Germany) as described (Schneider et al.,2009). One slice (0.2 mm thick) in the mid-diaphysis of the femur and 3 slices in the distal femoral metaphysis located 1.5, 2, and 2.5 mm proximal to the articular surface of the knee joint were measured. BMD values of the distal femoral metaphysis were calculated as the mean over 3 slices. A voxel size of 0.070 mm and a threshold of 600 mg/cm3 were used for calculation of BMD.

Histology and In Situ Hybridizations

For histology and section in situ hybridizations, material from embryos and pups was dissected, washed in PBS, and fixed overnight in 4% PFA/PBS, dehydrated to 70% ethanol, and processed using a standard program of the Tissue-Tek VIP5 Vacuum Infiltration Processor (Sakura, Torrance, CA). Processed tissue was embedded in paraffin and sectioned at 5 μm. Hematoxylin/eosin staining was performed using standard protocols. Alcian blue/van Kossa staining on sections was performed as follows: tissue was rehydrated, washed twice in deionized water, exposed for 60 min in 2% silver-nitrate solution to a 60-W lamp, washed three times in deionized water, incubated for 2 min in 1% acetic acid, stained with alcian blue solution (pH 2.2) for 15 min, washed in 1% acetic acid, dehydrated into 75% ethanol, counterstained for 30 sec with eosin, destained with 100% ethanol and xylene, and mounted using DPX (Fluka, St. Louis, MO). Whole mount and section in situ hybridizations were done as previously described (Murtaugh et al.,1999; Riddle et al.,1993).

Immunohistochemistry, Western Blot, and Elisa for IGF1 Serum Levels

Immunohistochemistry for the following hormone precursors, GH (1:10,000), TSHβ (1:2,000), LHα (1:2,000), LHβ (1:2,000), and ACTH (1:3,000) was performed on paraffin sections of the pituitaries from E17 embryos and P2 mice. Antibodies were obtained from the National Hormone and Pituitary Program and immunohistochemistry was performed using the Ventana. Briefly, sections were dewaxed and rehydrated; antigen-retrieval was done using citrate buffer pH 6.0. Western blots to determine GH protein levels were performed on 50-μg protein extracts from dissected pituitaries from P17 & P19 mice (α-GH at a dilution of 1:2,000). IGFI serum levels were determined in duplicates from the plasma of Ror1−/− and control mice at 2 and 3 months of age using an IGF-I Elisa assay following the manufacturer's instructions (Quantikine Kit, R&D Systems, Minneapolis, MN).

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

We thank Christiane Schüler, Martin Glösmann, and Claudia Bergow for help with the pQCT analysis, and Vukoslav Kommenovic for technical assistance. The IMP is supported by Boehringer Ingelheim. N.L. was supported by the Austrian Science Found (FWF grant P19281-B16).

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information
  • Afzal AR, Rajab A, Fenske CD, Oldridge M, Elanko N, Ternes-Pereira E, Tuysuz B, Murday VA, Patton MA, Wilkie AO, Jeffery S. 2000. Recessive Robinow syndrome, allelic to dominant brachydactyly type B, is caused by mutation of ROR2. Nat Genet 25: 419422.
  • Al-Shawi R, Ashton SV, Underwood C, Simons JP. 2001. Expression of the Ror1 and Ror2 receptor tyrosine kinase genes during mouse development. Dev Genes Evol 211: 161171.
  • Amarilio R, Viukov SV, Sharir A, Eshkar-Oren I, Johnson RS, Zelzer E. 2007. HIF1alpha regulation of Sox9 is necessary to maintain differentiation of hypoxic prechondrogenic cells during early skeletogenesis. Development 134: 39173928.
  • Baffi MO, Slattery E, Sohn P, Moses HL, Chytil A, Serra R. 2004. Conditional deletion of the TGF-beta type II receptor in Col2a expressing cells results in defects in the axial skeleton without alterations in chondrocyte differentiation or embryonic development of long bones. Dev Biol 276: 124142.
  • Baskar S, Kwong KY, Hofer T, Levy JM, Kennedy MG, Lee E, Staudt LM, Wilson WH, Wiestner A, Rader C. 2008. Unique cell surface expression of receptor tyrosine kinase ROR1 in human B-cell chronic lymphocytic leukemia. Clin Cancer Res 14: 396404.
  • Bose J, Grotewold L, Ruther U. 2002. Pallister-Hall syndrome phenotype in mice mutant for Gli3. Hum Mol Genet 11: 11291135.
  • Brugmann SA, Goodnough LH, Gregorieff A, Leucht P, ten Berge D, Fuerer C, Clevers H, Nusse R, Helms JA. 2007. Wnt signaling mediates regional specification in the vertebrate face. Development 134: 32833295.
  • Daneshmanesh AH, Mikaelsson E, Jeddi-Tehrani M, Bayat AA, Ghods R, Ostadkarampour M, Akhondi M, Lagercrantz S, Larsson C, Osterborg A, Shokri F, Mellstedt H, Rabbani H. 2008. Ror1, a cell surface receptor tyrosine kinase is expressed in chronic lymphocytic leukemia and may serve as a putative target for therapy. Int J Cancer 123: 11901195.
  • DeChiara TM, Kimble RB, Poueymirou WT, Rojas J, Masiakowski P, Valenzuela DM, Yancopoulos GD. 2000. Ror2, encoding a receptor-like tyrosine kinase, is required for cartilage and growth plate development. Nat Genet 24: 271274.
  • Enomoto M, Hayakawa S, Itsukushima S, Ren DY, Matsuo M, Tamada K, Oneyama C, Okada M, Takumi T, Nishita M, Minami Y. 2009. Autonomous regulation of osteosarcoma cell invasiveness by Wnt5a/Ror2 signaling. Oncogene 28: 31973208.
  • Fukuda T, Chen L, Endo T, Tang L, Lu D, Castro JE, Widhopf GF, 2nd, Rassenti LZ, Cantwell MJ, Prussak CE, Carson DA, Kipps TJ. 2008. Antisera induced by infusions of autologous Ad-CD154-leukemia B cells identify ROR1 as an oncofetal antigen and receptor for Wnt5a. Proc Natl Acad Sci USA 105: 30473052.
  • Green JL, Kuntz SG, Sternberg PW. 2008. Ror receptor tyrosine kinases: orphans no more. Trends Cell Biol 18: 536544.
  • Hamamy H, Saleh N, Oldridge M, Al-Hadidy A, Ajlouni K. 2006. Brachydactyly type B1: report of a family with de novo ROR2 mutation. Clin Genet 70: 538540.
  • He F, Xiong W, Yu X, Espinoza-Lewis R, Liu C, Gu S, Nishita M, Suzuki K, Yamada G, Minami Y, Chen Y. 2008. Wnt5a regulates directional cell migration and cell proliferation via Ror2-mediated noncanonical pathway in mammalian palate development. Development 135: 38713879.
  • Hikasa H, Shibata M, Hiratani I, Taira M. 2002. The Xenopus receptor tyrosine kinase Xror2 modulates morphogenetic movements of the axial mesoderm and neuroectoderm via Wnt signaling. Development 129: 52275239.
  • Holst CR, Bou-Reslan H, Gore BB, Wong K, Grant D, Chalasani S, Carano RA, Frantz GD, Tessier-Lavigne M, Bolon B, French DM, Ashkenazi A. 2007. Secreted sulfatases Sulf1 and Sulf2 have overlapping yet essential roles in mouse neonatal survival. PLoS One 2: e575.
  • Jena N, Martin-Seisdedos C, McCue P, Croce CM. 1997. BMP7 null mutation in mice: developmental defects in skeleton, kidney, and eye. Exp Cell Res 230: 2837.
  • Kobayashi M, Shibuya Y, Takeuchi J, Murata M, Suzuki H, Yokoo S, Umeda M, Minami Y, Komori T. 2009. Ror2 expression in squamous cell carcinoma and epithelial dysplasia of the oral cavity. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 107: 398406.
  • Li C, Chen H, Hu L, Xing Y, Sasaki T, Villosis MF, Li J, Nishita M, Minami Y, Minoo P. 2008. Ror2 modulates the canonical Wnt signaling in lung epithelial cells through cooperation with Fzd2. BMC Mol Biol 9: 11.
  • Liu Y, Rubin B, Bodine PV, Billiard J. 2008. Wnt5a induces homodimerization and activation of Ror2 receptor tyrosine kinase. J Cell Biochem 105: 497502.
  • MacKeigan JP, Murphy LO, Blenis J. 2005. Sensitized RNAi screen of human kinases and phosphatases identifies new regulators of apoptosis and chemoresistance. Nat Cell Biol 7: 591600.
  • Martinez G, Bertram JF. 2003. Organisation of bone morphogenetic proteins in renal development. Nephron Exp Nephrol 93: e1822.
  • Matsuda T, Nomi M, Ikeya M, Kani S, Oishi I, Terashima T, Takada S, Minami Y. 2001. Expression of the receptor tyrosine kinase genes, Ror1 and Ror2, during mouse development. Mech Dev 105: 153156.
  • McLeod MJ. 1980. Differential staining of cartilage and bone in whole mouse fetuses by alcian blue and alizarin red S. Teratology 22: 299301.
  • Mikels AJ, Nusse R. 2006. Purified Wnt5a protein activates or inhibits beta-catenin-TCF signaling depending on receptor context. PLoS Biol 4: e115.
  • Minami Y, Oishi I, Endo M, Nishita M. 2009. Ror-family receptor tyrosine kinases in noncanonical Wnt signaling: Their implications in developmental morphogenesis and human diseases. Dev Dyn 239: 115.
  • Moerth C, Schneider MR, Renner-Mueller I, Blutke A, Elmlinger MW, Erben RG, Camacho-Hubner C, Hoeflich A, Wolf E. 2007. Postnatally elevated levels of insulin-like growth factor (IGF)-II fail to rescue the dwarfism of IGF-I-deficient mice except kidney weight. Endocrinology 148: 441451.
  • Morioka K, Tanikawa C, Ochi K, Daigo Y, Katagiri T, Kawano H, Kawaguchi H, Myoui A, Yoshikawa H, Naka N, Araki N, Kudawara I, Ieguchi M, Nakamura K, Nakamura Y, Matsuda K. 2009. Orphan receptor tyrosine kinase ROR2 as a potential therapeutic target for osteosarcoma. Cancer Sci 100: 12271233.
  • Murtaugh LC, Chyung JH, Lassar AB. 1999. Sonic hedgehog promotes somitic chondrogenesis by altering the cellular response to BMP signaling. Genes Dev 13: 225237.
  • Mushtaq T, Bijman P, Ahmed SF, Farquharson C. 2004. Insulin-like growth factor-I augments chondrocyte hypertrophy and reverses glucocorticoid-mediated growth retardation in fetal mice metatarsal cultures. Endocrinology 145: 24782486.
  • Nomi M, Oishi I, Kani S, Suzuki H, Matsuda T, Yoda A, Kitamura M, Itoh K, Takeuchi S, Takeda K, Akira S, Ikeya M, Takada S, Minami Y. 2001. Loss of mRor1 enhances the heart and skeletal abnormalities in mRor2-deficient mice: redundant and pleiotropic functions of mRor1 and mRor2 receptor tyrosine kinases. Mol Cell Biol 21: 83298335.
  • O'Connell MP, Fiori JL, Xu M, Carter AD, Frank BP, Camilli TC, French AD, Dissanayake SK, Indig FE, Bernier M, Taub DD, Hewitt SM, Weeraratna AT. 2010. The orphan tyrosine kinase receptor, ROR2, mediates Wnt5A signaling in metastatic melanoma. Oncogene 29: 3444.
  • Oishi I, Takeuchi S, Hashimoto R, Nagabukuro A, Ueda T, Liu ZJ, Hatta T, Akira S, Matsuda Y, Yamamura H, Otani H, Minami Y. 1999. Spatio-temporally regulated expression of receptor tyrosine kinases, mRor1, mRor2, during mouse development: implications in development and function of the nervous system. Genes Cells 4: 4156.
  • Oishi I, Suzuki H, Onishi N, Takada R, Kani S, Ohkawara B, Koshida I, Suzuki K, Yamada G, Schwabe GC, Mundlos S, Shibuya H, Takada S, Minami Y. 2003. The receptor tyrosine kinase Ror2 is involved in non-canonical Wnt5a/JNK signalling pathway. Genes Cells 8: 645654.
  • Oldridge M, Fortuna AM, Maringa M, Propping P, Mansour S, Pollitt C, DeChiara TM, Kimble RB, Valenzuela DM, Yancopoulos GD, Wilkie AO. 2000. Dominant mutations in ROR2, encoding an orphan receptor tyrosine kinase, cause brachydactyly type B. Nat Genet 24: 275278.
  • Paganoni S, Ferreira A. 2003. Expression and subcellular localization of Ror tyrosine kinase receptors are developmentally regulated in cultured hippocampal neurons. J Neurosci Res 73: 429440.
  • Pulkkinen K, Murugan S, Vainio S. 2008. Wnt signaling in kidney development and disease. Organogenesis 4: 5559.
  • Ratzka A, Kalus I, Moser M, Dierks T, Mundlos S, Vortkamp A. 2008. Redundant function of the heparan sulfate 6-O-endosulfatases Sulf1 and Sulf2 during skeletal development. Dev Dyn 237: 339353.
  • Raz R, Stricker S, Gazzerro E, Clor JL, Witte F, Nistala H, Zabski S, Pereira RC, Stadmeyer L, Wang X, Gowen L, Sleeman MW, Yancopoulos GD, Canalis E, Mundlos S, Valenzuela DM, Economides AN. 2008. The mutation ROR2W749X, linked to human BDB, is a recessive mutation in the mouse, causing brachydactyly, mediating patterning of joints and modeling recessive Robinow syndrome. Development 135: 17131723.
  • Reinecke M, Schmid AC, Heyberger-Meyer B, Hunziker EB, Zapf J. 2000. Effect of growth hormone and insulin-like growth factor I (IGF-I) on the expression of IGF-I messenger ribonucleic acid and peptide in rat tibial growth plate and articular chondrocytes in vivo. Endocrinology 141: 28472853.
  • Riddle RD, Johnson RL, Laufer E, Tabin C. 1993. Sonic hedgehog mediates the polarizing activity of the ZPA. Cell 75: 14011416.
  • Rodriguez-Niedenfuhr M, Prols F, Christ B. 2004. Expression and regulation of ROR-1 during early avian limb development. Anat Embryol (Berl) 207: 495502.
  • Saldanha J, Singh J, Mahadevan D. 1998. Identification of a Frizzled-like cysteine rich domain in the extracellular region of developmental receptor tyrosine kinases. Protein Sci 7: 16321635.
  • Sammar M, Stricker S, Schwabe GC, Sieber C, Hartung A, Hanke M, Oishi I, Pohl J, Minami Y, Sebald W, Mundlos S, Knaus P. 2004. Modulation of GDF5/BRI-b signalling through interaction with the tyrosine kinase receptor Ror2. Genes Cells 9: 12271238.
  • Schneider MR, Mayer-Roenne B, Dahlhoff M, Proell V, Weber K, Wolf E, Erben RG. 2009. High cortical bone mass phenotype in betacellulin transgenic mice is EGFR dependent. J Bone Miner Res 24: 455467.
  • Schwabe GC, Tinschert S, Buschow C, Meinecke P, Wolff G, Gillessen-Kaesbach G, Oldridge M, Wilkie AO, Komec R, Mundlos S. 2000. Distinct mutations in the receptor tyrosine kinase gene ROR2 cause brachydactyly type B. Am J Hum Genet 67: 822831.
  • Schwabe GC, Trepczik B, Suring K, Brieske N, Tucker AS, Sharpe PT, Minami Y, Mundlos S. 2004. Ror2 knockout mouse as a model for the developmental pathology of autosomal recessive Robinow syndrome. Dev Dyn 229: 400410.
  • Shabani M, Asgarian-Omran H, Jeddi-Tehrani M, Vossough P, Faranoush M, Sharifian RA, Toughe GR, Kordmahin M, Khoshnoodi J, Roohi A, Tavoosi N, Mellstedt H, Rabbani H, Shokri F. 2007. Overexpression of orphan receptor tyrosine kinase Ror1 as a putative tumor-associated antigen in Iranian patients with acute lymphoblastic leukemia. Tumour Biol 28: 318326.
  • Shabani M, Asgarian-Omran H, Vossough P, Sharifian RA, Faranoush M, Ghragozlou S, Khoshnoodi J, Roohi A, Jeddi-Tehrani M, Mellstedt H, Rabbani H, Shokri F. 2008. Expression profile of orphan receptor tyrosine kinase (ROR1) and Wilms' tumor gene 1 (WT1) in different subsets of B-cell acute lymphoblastic leukemia. Leuk Lymphoma 49: 13601367.
  • Sjogren K, Jansson JO, Isaksson OG, Ohlsson C. 2002. A model for tissue-specific inducible insulin-like growth factor-I (IGF-I) inactivation to determine the physiological role of liver-derived IGF-I. Endocrine 19: 249256.
  • Smink JJ, Koster JG, Gresnigt MG, Rooman R, Koedam JA, Van Buul-Offers SC. 2002. IGF and IGF-binding protein expression in the growth plate of normal, dexamethasone-treated and human IGF-II transgenic mice. J Endocrinol 175: 143153.
  • Storm EE, Kingsley DM. 1996. Joint patterning defects caused by single and double mutations in members of the bone morphogenetic protein (BMP) family. Development 122: 39693979.
  • Takeuchi S, Takeda K, Oishi I, Nomi M, Ikeya M, Itoh K, Tamura S, Ueda T, Hatta T, Otani H, Terashima T, Takada S, Yamamura H, Akira S, Minami Y. 2000. Mouse Ror2 receptor tyrosine kinase is required for the heart development and limb formation. Genes Cells 5: 7178.
  • van Bokhoven H, Celli J, Kayserili H, van Beusekom E, Balci S, Brussel W, Skovby F, Kerr B, Percin EF, Akarsu N, Brunner HG. 2000. Mutation of the gene encoding the ROR2 tyrosine kinase causes autosomal recessive Robinow syndrome. Nat Genet 25: 423426.
  • Wright TM, Brannon AR, Gordan JD, Mikels AJ, Mitchell C, Chen S, Espinosa I, van de Rijn M, Pruthi R, Wallen E, Edwards L, Nusse R, Rathmell WK. 2009. Ror2, a developmentally regulated kinase, promotes tumor growth potential in renal cell carcinoma. Oncogene 28: 25132523.
  • Yakar S, Liu JL, Stannard B, Butler A, Accili D, Sauer B, LeRoith D. 1999. Normal growth and development in the absence of hepatic insulin-like growth factor I. Proc Natl Acad Sci USA 96: 73247329.
  • Yoda A, Oishi I, Minami Y. 2003. Expression and function of the Ror-family receptor tyrosine kinases during development: lessons from genetic analyses of nematodes, mice, and humans. J Recept Signal Transduct Res 23: 115.

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
DVDY_22362_sm_suppfig1.tif8422KSupporting Figure 1. Embryonic expression of Ror1. A: E10.5 embryo showing expression in the somites, proximal region of the limb, flank region, branchial arches, the otic vesicle, eye, mesenchyme throughout the head and in the dorsal midline of the brain vesicles. B: E11.5 showing that Ror1 continues to be expressed in the regions where it was expressed at E10.5. C: E12.5 embryo showing a broad diffuse expression in somites and head region, strong expression in the limbs at the anterior and posterior region of the zeugopode (arrowheads). D: Same embryo as in C with the right forelimb removed in order to show the high Ror1 expression in the body wall (arrow). E: Frontal view on the chest region of a E13.5 embryo, showing strong Ror1 expression at the edges of the body wall corresponding to the sternal bands (arrowheads). F: E13.5 forelimb, showing Ror1 expression in the perichondrium of the digits (arrow). G: Skinned E15.5 forelimb, showing Ror1 expression in perichondrium (arrow) and around the joint regions (arrowhead) in the digits. H: E13.5 head cut along the midline, showing Ror1 expression in the roof of the oral cavity, in the region around the pituitary gland (asterisk), and in the nasal cavity (arrowhead). I: Higher magnification of the boxed region shown in H.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.