SEARCH

SEARCH BY CITATION

Keywords:

  • zebrafish;
  • recombination;
  • Cre/lox;
  • CreERT2;
  • Tamoxifen;
  • heat shock;
  • promoter

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Cre-mediated site-specific recombination has emerged as an indispensable tool for the precise manipulation of the mammalian genome. Recently, we showed that Cre is also highly efficient in zebrafish and temporal control of recombination can be achieved by using the ligand-inducible CreERT2. Previous attempts have been made to control recombination by using the temperature inducible hsp70l promoter to conditionally drive the expression of Cre or EGFP-Cre, respectively. However, in this study we demonstrate that the hsp70l promoter possesses a basal leakiness resulting in Cre-mediated recombination even at permissive temperatures. In order to prevent non-conditional recombination, we combined the hsp70l promoter with a mCherry-tagged ligand-inducible CreERT2. At permissive temperatures and in the absence of the ligand tamoxifen (TAM), no non-conditional recombination is observed indicating tight regulation of CreERT2. Instead, comprehensive site-specific recombination is mediated following heat induction and administration of TAM. Developmental Dynamics, 2011. © 2010 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Zebrafish represents a widely used vertebrate model system with many forward and reverse genetic advantages to study development and disease (Lieschke and Currie,2007). Furthermore, techniques for the temporally and spatially controlled over-expression of genes using the Gal4-UAS and the mifepristone-inducible LexPR system are also available in this organism (Scheer and Campos-Ortega,1999; Asakawa et al.,2008; Emelyanov and Parinov,2008). Additional invaluable tools for genetic manipulations are site-specific recombinases such as Cre and Flp and recent progress has shown their efficient usage in zebrafish (Thummel et al.,2005; Le et al.,2007; Feng et al.,2007; Yoshikawa et al.,2008; Liu et al.,2008; Wang et al.,2008; Hans et al.,2009; Boniface et al.,2009). Cre promotes strand exchanges between loxP target sites without any additional cofactors. At least two of these target sites are required and the orientation of the loxP sites confers the directionality of the recombination process. Head-to-head orientation causes inversion of the intervening DNA sequence, whereas head-to-tail orientation results in the excision of the DNA between the two sites (Dymecki and Kim,2007; Feil,2007). In addition to native Cre, chimeric Cre recombinases have been developed that allow temporal control of Cre-mediated recombination, which is achieved by the fusion of Cre to the ligand-binding domain of a steroid hormone receptor (Metzger et al.,1995). Currently, Cre fused to the mutated human ligand-binding domain of the estrogen receptor (CreERT2) has the best properties for ligand sensitivity and inducible recombination efficiency (Feil et al.,1997). One approach that has been proven to be advantageous in mouse is the application of conditional, tissue-specific Cre-driver lines in combination with effector lines driven by a broadly active promoter like the Rosa26 locus (Soriano1999). In another approach used in zebrafish, tissue-specific effector constructs or stable transgenic lines have been combined with a ubiquitous Cre or EGFP-Cre source driven by the temperature-inducible hsp70l promoter (formerly known as hsp70, Thummel et al.,2005; Le et al.,2007; Feng et al.,2007; Yoshikawa et al.,2008). Indeed, high, ubiquitous levels of Cre provided upon heat shock showed the general functionality of this approach. However, when using the Tg(hsp70l:EGFP-Cre) line, leakiness of the hsp70l promoter has been observed even at permissive temperatures resulting in non-conditional recombination (Hans et al.,2009). Here, we show that non-conditional recombination at permissive temperatures is also occurring in the Tg(hsp70l:Cre) line, indicating that basal leakiness is a general property of the hsp70l promoter that limits the usefulness of the existing Cre driver lines. To solve this problem, we generated a non-leaky conditional line using a bicistronic mRNA coding for mCherry and CreERT2 separated by a viral T2A peptide sequence (Provost et al.,2007) under the control of the zebrafish heat shock–inducible hsp70l promoter (Halloran et al.,2000). In the absence of TAM, no recombination is observed at permissive temperatures, whereas full recombination is achieved in the presence of TAM after heat treatment.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Our previous study using the Tg(hsp 70l:EGFP-Cre) line demonstrated leakiness of the hsp70l promoter at permissive temperatures resulting in non-conditional recombination (Hans et al.,2009). However, leakiness can be a feature of the Tg(hsp70l:EGFP-Cre) line due to positional effects to the integration site of the transgenic cassette or it can represent a general property of the hsp70l promoter, which would impede the generation of a non-leaky native Cre driver line. We thus examined whether leakiness can also be observed in the Tg(hsp70l:Cre) line. When crossed to our red-to-green reporter line (Hans et al.,2009), we observe Cre-mediated recombination at permissive temperatures. In the absence of Cre activity, the reporter line expresses DsRed2 under the control of the Xenopus Elongation Factor 1 alpha (EF1α) promoter but changes to EGFP after a successful recombination event. Double transgenic embryos carrying the reporter and the Tg(hsp70l:Cre) allele display a strong DsRed2 signal but also significant EGFP expression in a mosaic fashion at 24 hr post-fertilization (hpf) (Fig. 1A,B). Brief heat induction at mid-gastrulation stages leads to reduced DsRed2 and strong ubiquitous EGFP expression at 24 hpf (Fig. 1C) indicating successful recombination events in most or all cells. However, in contrast to the Tg(hsp 70l:EGFP-Cre) line, no pronounced maternal contribution can be observed. In order to corroborate the expression of Cre at permissive temperatures, we performed RT-PCR on cDNA obtained at different developmental stages from male and female carriers crossed to wild-type fish. When using male Tg(hsp70l:Cre) carriers, Cre transcripts are absent at the 2-cell stage (0.75 hpf) but are detected at late blastula stages (4 hpf) and at 24 hpf (Fig. 2A). Consistent with this, Cre transcripts can be detected at late blastula stages as well as 24 hpf in female Tg(hsp 70l:Cre) carriers. However, female carriers also display low amounts of Cre transcript at the 2-cell stage (Fig. 2A). As expected, similar results were obtained using the Tg(hsp70l:EGFP-Cre) line, which also displays non-conditional recombination at permissive temperatures (Hans et al.,2009). Again, Cre transcripts are absent at the 2-cell stage but can be detected at late blastula stages and at 24 hpf when using male Tg(hsp70l:EGFP-Cre) carriers (Fig. 2B). In female Tg(hsp70l:EGFP-Cre) carriers, Cre transcripts are again present at all stages (Fig. 2B). The amount of maternally provided Cre transcript was always significantly higher in the Tg(hsp70l:EGFP-Cre) line compared to the Tg(hsp70l:Cre) line, consistent with our observed recombination rates at permissive temperatures using female Tg(hsp70l: EGFP-Cre) and Tg(hsp70l:Cre) carriers. Although, we provide evidence that both lines Tg(hsp70l:Cre) and Tg (hsp70l:EGFP-Cre) express Cre transcripts sufficient to elicit recombination at permissive temperatures, the activity could still result from enhancer trapping. In order to address this, we performed RT-PCR on cDNA of two additional transgenic lines employing the hsp70l promoter, the Tg(hsp70l:fgf8a) and Tg(hsp 70l:dnfgfr1-EGFP) lines (Hans et al.,2007; Lee et al.,2005). Using female Tg(hsp70l:fgf8a) carriers crossed to wild-type fish and fgf8a specific primers, fgf8a transcripts can be detected at permissive temperatures at the 2-cell stage (Fig. 2C), when the endogenous fgf8a gene is not expressed (Reifers et al.,1998). Similarly, EGFP transcripts can be found at permissive temperatures at the 2-cell stage when female Tg(hsp70l: dnfgfr1-EGFP) carriers crossed to wild-type fish were used (Fig. 2C). These results prompted us to look at the expression levels of the endogenous hsp70l gene at permissive temperatures and, indeed, hsp70l can be detected at the 2-cell stage and at 24 hpf (Fig. 2C). Taken together, our findings clearly show that basal leakiness is a general property of the hsp70l promoter. We, thus, turned towards the tamoxifen-inducible CreERT2 recombinase. Recently, it was shown that temporal control of recombination in zebrafish can be achieved by using a ligand-inducible recombinase expressed at low or moderate levels (Hans et al.,2009; Boniface et al.,2009). We, therefore, reasoned that at permissive temperatures, when basal expression is provided by the hsp70l promoter, CreERT2 would be retained in the cytoplasm. In order to generate a new line, a single open reading frame coding for mCherry and CreERT2 separated by the viral T2A peptide sequence (Provost et al.,2007) was placed under the control of a zebrafish heat shock–inducible hsp70l promoter (Fig. 3A). The use of the viral T2A peptide allows equimolar production of mCherry and CreERT2 from a single open reading frame. Out of several independent founder fish, two stable Tg(hsp70l:mCherry-T2A-CreERT2) transgenic lines were established. At permissive temperatures, no expression of CreERT2 or fluorescent mCherry can be observed in the Tg(hsp70l:mCherry-T2A-CreERT2)#12 line at the 12-somite stage or 24 hr post-fertilization, respectively (Fig. 3B). In contrast, the Tg(hsp70l: mCherry-T2A-CreERT2)#15 line shows weak expression of CreERT2 as well as fluorescent mCherry in the forebrain, midbrain-hindbrain boundary, and rhombomere 4 of the hindbrain anlage (Fig. 3C) indicating an enhancer trap event that allows the straightforward identification of transgenic carriers already at early time points. Despite their different character at permissive temperatures, strong and ubiquitous CreERT2 and mCherry expression can be observed in both transgenic lines following heat induction (Fig. 3D and data not shown). Subsequently, we performed RT-PCR on cDNA obtained at the 2-cell stage and 24hpf from female carriers of the two different alleles crossed to wild-type fish. As expected, Cre transcripts could be detected in the Tg(hsp70 l:mCherry-T2A-CreERT2)#15 enhancer trap allele at 24 hpf when fluorescent mCherry can be observed. However, Cre transcripts were also present at the 2-cell stage in the absence of fluorescent mCherry. Similarly, Cre transcripts could be detected in both examined stages of the Tg(hsp70l: mCherry-T2A-CreERT2)#12 allele (Fig. 3E), which never showed any fluorescent mCherry at any stage at permissive temperatures.

thumbnail image

Figure 1. Cre-mediated recombination of the Tg(hsp70l:Cre) allele in the red-to-green reporter line in the absence and presence of heat. A: Scheme of the transgene combination of the embryos depicted in B and C. B: In the absence of heat, the combination of the Tg(hsp70l:Cre) allele with the red-to-green reporter line results in strong DsRed2 and mosaic EGFP expression in double transgenic embryos. C:In contrast, brief heat induction at mid-gastrulation stages results in reduced DsRed2 and strong ubiquitous EGFP expression in double transgenic embryos. B,C: Lateral views of live 24-hpf embryos.

Download figure to PowerPoint

thumbnail image

Figure 2. RT-PCR reaction analysis of the Tg(hsp70l:Cre), the Tg(hsp70l:EGFP-Cre), the Tg(hsp70l:fgf8a), and the Tg(hsp70l:dnfgfr1-EGFP) alleles as well as the endogenous hsp70l gene at permissive temperatures. A: When the Tg(hsp70l:Cre) allele is provided paternally, no Cre transcripts can be detected at the 2-cell stage but at late blastula stages and 24 hpf. In contrast, maternal contribution of the Tg(hsp70l:Cre) allele results in the detection of Cre transcripts at all examined stages. B: Similarly, if the Tg(hsp70l:EGFP-Cre) allele is provided paternally, Cre transcript can not be detected at the 2-cell stage but at late blastula stages and 24 hpf, whereas maternal contribution of the Tg(hsp70l:Cre) allele is present at all stages. C: Maternal contribution of the Tg(hsp70l:fgf8a) and the Tg(hsp70l:dnfgfr1-EGFP) alleles result in the detection of fgf8a and EGFP transcripts at the 2-cell stage. In wild-type embryos, hsp70l can be detected at the 2-cell stage and at 24 hpf.

Download figure to PowerPoint

thumbnail image

Figure 3. Regulation of mCherry and CreERT2 expression in the absence and presence of heat. A: Scheme of the Tg(hsp70l:mCherry-T2A-CreERT2) construct, which expresses a single open reading frame coding for mCherry (red) and CreERT2 (yellow) separated by a viral T2A peptide sequence (green) under the control of a zebrafish heat shock–inducible hsp70l promoter (blue). After translation, the viral T2A peptide cleavage leads to the production of non-fused mCherry and CreERT2 proteins. B: In the absence of heat, the Tg(hsp70l:mCherry-T2A-CreERT2)#12 allele is transcriptionally silent on CreERT2 RNA and fluorescent mCherry level, respectively. C: In contrast, the Tg(hsp70l:mCherry-T2A-CreERT2)#15 enhancer trap allele is expressed in the forebrain (arrow), midbrain-hindbrain boundary (arrowhead), and rhombomere 4 of the hindbrain anlage (asterisk) at permissive temperatures. D: After heat shock, CreERT2 RNA and fluorescent mCherry are expressed in a ubiquitous fashion. E: RT-PCR reaction analysis of the Tg(hsp70l:mCherry-T2A-CreERT2) alleles. When the Tg(hsp70l:mCherry-T2A-CreERT2) allele is provided maternally, Cre transcripts are detected for both alleles at the 2-cell stage and 24hpf. B–D: Dorsal and lateral views of transgenic embryos at the 12-somite stage and live 24-hpf embryos, respectively.

Download figure to PowerPoint

We next addressed Cre activity in both Tg(hsp70l:mCherry-T2A-CreERT2) alleles using our red-to-green reporter line (Hans et al.,2009) and varying the parameters TAM and heat. At permissive temperatures in the absence of TAM, double transgenic embryos carrying the reporter and one of the Tg(hsp70l:mCherry-T2A-CreERT2) alleles show strong ubiquitous DsRed2 but no EGFP expression at 24 hpf (Fig. 4A,B and see Supp. Fig. S1A,B, which is available online). The lack of EGFP expression clearly shows that CreERT2, which can be detected on the RNA level (Fig. 3E), is successfully retained in the cytoplasm even in the enhancer trap line. In contrast, application of TAM at mid-gastrulation stages relieves cytoplasmic retention of CreERT2 and demonstrates basal leakiness of the hsp70l promoter resulting in significant EGFP expression at 24 hpf (Fig. 4C and Supp. Fig. S1C). As expected, EGFP recapitulates the enhancer trap pattern of CreERT2 and mCherry in the Tg(hsp 70l:mCherry-T2A-CreERT2)#15 allele but also shows a mosaic EGFP expression similar to the native Cre driver lines Tg(hsp70l:EGFP-Cre) and Tg(hsp 70l:Cre). Following heat induction at mid-gastrulation stages, double transgenic embryos show non-conditional recombination in a mosaic fashion at 24 hpf (Fig. 4D and Supp. Fig. S1D), corroborating the finding that very high levels of CreERT2 overwhelm the cellular machinery (data not shown; Boniface et al.,2009). Finally, heat induction followed by application of TAM at mid-gastrulation stages leads to strong and ubiquitous EGFP expression at 24 hpf in double transgenic embryos (Fig. 4E and Supp. Fig. S1E). Because efficiency of recombination is an important attribute of the new Tg(hsp70l:mCherry-T2A-CreERT2) alleles, we performed immunocytochemistry on cross-sections at different levels confirming uniform EGFP expression (Supp. Fig. S2). In the presence of TAM, full recombination was also observed after very brief heat inductions that result in only very weak mCherry fluorescence in the Tg(hsp70l:mCherry-T2A-CreERT2) alleles (data not shown). We also addressed Cre activity at later developmental stages (Supp. Fig. S3). To this aim, we repeated the previous cross and applied TAM after heat induction during gastrulation, at 24 hpf and 48 hpf, respectively. However, as we previously reported our red-to-green reporter line driven by the EF1α promoter (Hans et al.,2009) reveals strong ubiquitous expression only during gastrulation and mid-somitogenesis stages (data not shown) but is shut down in a tissue-specific manner with strong transcription maintained only in the retina, lens, and mid-hindbrain boundary beyond 24 hpf (Supp. Fig. S3B). Consequently, EGFP expression following recombination could only be observed in these tissues from 48 hpf onwards. Nevertheless, embryos treated with heat and TAM during gastrulation stages were indistinguishable from embryos treated with heat and TAM at 48hpf if compared at 72 hpf (Supp. Fig. S3C–E). Furthermore, we never observed any EGFP expression in control embryos that did not receive heat induction and TAM. Although these experiments demonstrate tight regulation of our Tg(hsp70l:mCherry-T2A-CreERT2) alleles in the absence of heat and TAM at embryonic stages, it is also important to verify that they do not show any basal activity at larval stages since the advantage of these lines is mostly for later stage manipulations. To this aim, we repeated the previous cross and performed PCR analysis at different developmental stages. PCR amplification of the unrecombined transgene produces a product of 1,523 base pairs (BP), while the recombined transgene yields only a 304-bp fragment with the same PCR primers (Fig. 5A). As expected, the recombined 304-bp fragment was detected after the application of heat or TAM or both at mid-gastrulation stages, 1, 5, or 10 days, respectively (Fig. 5B). In contrast and more importantly, in the absence of heat and TAM no 304-bp fragment could be detected at any time point, whereas the unrecombined 1,523-bp fragment was always present. Taken together, these data show that the non-conditional Cre-mediated recombination of the native Cre driver lines Tg(hsp70l:EGFP-Cre) and Tg(hsp70l: Cre) at permissive temperatures can be controlled in our Tg(hsp70l:mCherry-T2A-CreERT2) alleles by the cytoplasmic retention of CreERT2.

thumbnail image

Figure 4. Cre-mediated recombination of the (hsp70l:mCherry-T2A-CreERT2)#152 allele in the red-to-green reporter line in the absence and presence of heat and TAM. A: Scheme of the transgene combination of the embryos depicted in B–E. B: In the absence of heat and TAM, the combination of the Tg(hsp70l:mCherry-T2A-CreERT2)#15 allele with the red-to-green reporter line results in strong DsRed2 but no EGFP expression in double transgenic embryos. C: Application of TAM leads to EGFP expression in the Tg(hsp70l:mCherry-T2A-CreERT2)#15 enhancer trap as well as a mosaic pattern in double transgenic embryos at permissive temperatures. D: In the absence of TAM, mosaic EGFP expression can be detected after heat treatment. E: Application of TAM and heat results in strong ubiquitous EGFP expression in double transgenic embryos. B–E: Lateral views of live 24-hpf embryos.

Download figure to PowerPoint

thumbnail image

Figure 5. Detection of Cre-mediated site-specific deletion by PCR analysis. A: Scheme of the expected PCR products before (1,523 bp) and after (304 bp) Cre-mediated recombination in the red-to-green reporter line using the primers indicated as arrows. B: Cre-mediated recombination of the (hsp70l:mCherry-T2A-CreERT2)#15 allele in the red-to-green reporter line in the absence (−) or presence (+) of heat and/or TAM at different developmental stages (mid-gastrulation, 1 day, 5 days, 10 days). In the absence of heat and TAM, only the unrecombined product of 1,523 bp can be detected, whereas application of heat or TAM or both leads to the amplification of the recombined 304-bp fragment. kb, kilobase.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Conventional use of the site-specific recombinase Cre is a powerful technology to manipulate mammalian genomes. Among others this includes temporal and spatial overexpression studies as well as genetic lineage tracings. Although there are currently several inducible expression systems available for zebrafish (Halpern et al.,2008), site-specific recombinases provide advantages that have not been fully adapted for zebrafish. In previous attempts to establish the Cre/loxP system in zebrafish, recombination efficiency was very low (Le et al.,2007; Feng et al.,2007). In one of these studies, the recombination was evaluated and only 129 recombined cells per embryo at 24 hpf could be detected although the recombined transgene was driven by the broad β-actin promoter and high, ubiquitous levels of Cre were provided during gastrulation using the Tg(hsp70l:Cre) line (Le et al.,2007). Although the reason for the recombination inefficiency is still unknown, the transgenesis approach seems to be crucial because effector lines generated by transposon- or meganuclease-mediated transgenesis have obliterated this problem (Yoshikawa et al.,2008; Hans et al.,2009; Boniface et al.,2009; Kikuchi et al.,2010). Transposon-mediated transgenesis delivers single copy integration events and meganuclease-mediated transgenesis produces low copy numbers, whereas the above-mentioned studies with low recombination efficiency used plasmid DNA injection into the cytoplasm of one-cell-stage embryos resulting in concatemeric DNA integration (Stuart et al.,1988). Here, we confirm our previous findings that Cre is in fact highly efficient in zebrafish (Hans et al.,2009). Furthermore, we show that low basal expression of the hsp70l promoter at permissive temperatures is a general property of this promoter. According to the Zebrafish Information Network (http://zfin.org/), more than 60 stable transgenic lines carrying the hsp70l promoter have been generated. In this respect, it is remarkable that stable transgenic lines driving potent effectors like fgf8a (Hans et al.,2007) show no developmental effects at permissive temperatures but the provided basal Cre levels are sufficient to induce recombination. The previous limitations of the existing Cre driver lines Tg(hsp70l:Cre) and Tg(hsp70l:EGFP-Cre) should now be resolved with our new Tg(hsp70l:mCherry-T2A-Cre ERT2) alleles. We demonstrate that in the absence of TAM, no non-conditional recombination can be observed at permissive temperatures, a prerequisite for controlled experiments. We selected two independent alleles. The Tg(hsp70l:mCherry-T2A-CreERT2)#15 allele represents an enhancer trap expressing fluorescent mCherry protein, which allows the easy identification of carriers already at 24 hpf. In contrast, the Tg(hsp70l:mCherry-T2A-CreERT2)#12 allele is fluorescently silent and carriers need to be identified by heat shock or PCR.

In mouse, it is common to use a conditional, tissue-specific Cre-driver line in combination with an effector line driven by a broadly active promoter like the Rosa26 locus (Soriano,1999). Similarly, the reporter line HOTCre has been recently established in zebrafish (Hesselson et al.,2009). In the absence of Cre activity, the reporter line expresses mCherry under the control of the hsp70l promoter, but changes to EGFP fused with the histone subunit H2B after a successful recombination event. Besides this conditional promoter, no constitutively active ubiquitous promoter is available in zebrafish, impeding the generation of generic effector lines. Furthermore, tissue-specific Cre driver lines are currently not available with a few exceptions (Liu et al.,2008; Wang et al.,2008; Hans et al.,2009; Boniface et al.,2009). We, therefore, foresee extensive use of our Tg(hsp70l:mCherry-T2A-CreERT2) alleles and combination of our ubiquitous Cre driver line with tissue-specific effector lines will be a useful approach. In this respect, it is noteworthy that a laser pointer driven microheater has been used for precise local heating and conditional gene regulation in living zebrafish (Placinta et al.,2009). In this pilot study, strong EGFP expression was induced in a variety of tissue types in zebrafish embryos and larvae using the Tg(hsp70l:GFP) transgenic line. However, heat-shock-driven transcription is detectable as soon as 15 min after the beginning of the heat-shock, but transcripts are gradually lost within the 1.5 hr following its end (Scheer et al., 2002; Geling et al.,2003; Hans et al.,2007). Consequently, no new protein product is made and EGFP expression from the Tg(hsp70l:GFP) transgenic line in the before-mentioned study fades away allowing lineage tracings only for a certain amount of time. Given our results that strong activation of the Tg(hsp70l:mCherry-T2A-CreERT2) alleles can trigger CreERT2-mediated recombination in the absence of TAM, laser pointer driven activation of the mCherry-T2A-CreERT2 should be sufficient to allow local recombination, which results in a permanent genetic labeling of the cells. Subsequently, cells could be traced for unlimited times, only depending on the promoter of the effector line.

The use of the viral T2A peptide sequence (Provost et al.,2007) allows the production of mCherry and CreERT2 in the same stoichiometric ratio and, consequently, fluorescent mCherry expression provides a readout for the levels of CreERT2 expression. Because high levels of CreERT2 can result in non-conditional recombination in mouse and zebrafish (Imayoshi et al.,2006; Boniface et al.,2009), the use of the mCherry-T2A-CreERT2 cassette is advantageous. It allows the screening of low- or moderate-expressing integrations, and when applying this strategy, we do not observe non-conditional recombination in other mCherry-T2A-CreERT2 driver lines.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Plasmid Construction

To create the pTol hsp70l:mCherry-T2A-CreERT2 plasmid, the hsp70l promoter was PCR-amplified (hsp70l-for 5′-atatGGGCCCttcaggggtgtcgcttggttatt tc; hsp70l-rev 5′ atatGGCCGGCCttttc tagtcaacaagtgaaattc) flanked by ApaI and FseI restriction sites that allowed substitution of the pax2a promoter of the pTol pax2a:CreERT2 plasmid (Hans et al.,2009). Subsequently, the CreERT2 gene was cloned in using the FseI and AscI sites after PCR amplification (CreERT2-for 5′-atatGGCCGGC CatatGCTAGCtccaatttactgaccgtacaccaa aatttgc; CreERT2-rev 5′-at atggcgcgccgc gaattaaaaaacctc) introducing a NheI site upstream of the CreERT2 gene. Finally, the mCherry gene was PCR-amplified using a primer that contained the T2a self-cleaving peptide sequence (mCherry-for 5′- atatGGCC GGCCaccatggccatcatcaaggagttc; mCherry-rev 5′-atatG CTAGCagggccgggattct cctccacgtcaccgc atgttagaagacttcctctgccc tccttgtacagctcg tccatgccgc) and inserted in frame with the CreERT2 gene using the FseI and NheI sites.

Zebrafish Husbandry and Germ Line Transformation

Zebrafish embryos were obtained by natural spawnings of adult AB wild-type fish maintained at 28.5°C on a 14-hr light, 10-hr dark cycle and staged as described (Kimmel et al.,1995). For germ line transformation, plasmid DNA and transposase mRNA were injected into fertilized eggs (F0), raised to adulthood and crossed to AB wild-type fish as previously described (Kawakami et al.,2004). To identify transgenic carriers, undechorionated F1embryos at 20 hpf were heat shocked, examined under a fluorescent microscope after a 4-hr waiting period, and positive embryos were raised. This way, five independent F0 were identified and the enhancer trap allele Tg(hsp70l:mCherry-T2A-Cre ERT2)#15 and the Tg(hsp70l:mCherry-T 2A-CreERT2)#12 allele were chosen to establish independent lines.

RT-PCR

Fifty embryos were pooled in each experiment for total RNA preparations using Trizol and reverse transcription was carried out using the SuperScript first-strand synthesis system (both Invitrogen, Carlsbad, CA). PCR primers were as follows: Cre-for 5′-aaacatgcttcatcgtcggtcc; Cre-rev 5′-gtatctctgaccagagtcatcc; fgf8a-for 5′-tccttcacctctttgcgttt; fgf8a-rev 5′-tgcgtttagtccgtctgttg; EGFP-for 5′-gt gagcaagggcgaggagct; EGFP-rev 5′-ctt gtacagctcgtccatgc; hsp70l-for 5′-aattt gagctgacgggaattcc; hsp70l-rev 5′-gtt cataactttagtccacctcttc; ef1a-for 5′-tca ccctgggagtgaaacagc; ef1a-rev 5′-acttgc aggcgatgtgagcag. These primers amplify 565-bp (Cre), 576-bp (fgf8a), 714-bp (EGFP), 564-bp (hsp70l), and 693-bp (ef1a) fragments from cDNA. In all RT-PCR experiments ef1a served as positive control. Thirty-five PCR cycles (30 sec/94°C denaturation, 30 sec/59°C annealing, 30 sec/72°C elongation) were used and the amplification products were separated on a 1.2% agarose gel.

Immunocytochemistry and In Situ Hybridization

Antibody staining was carried out as described (Westerfield, 2000). Antibodies were used in the following concentrations: α-GFP (Molecular Probes, Eugene, OR), 1:500; goat α-rabbit Alexa Fluor 488 (Molecular Probes), 1:500. Embryos were analyzed using a Zeiss Axiophot 2 microscope. For probe synthesis the CS2+CreERT2 vector was linearized with BamHI and transcribed with T7 (Hans et al.,2009). Probe synthesis and in situ hybridization were performed essentially as previously described (Westerfield,2000). We purified the in vitro synthesized probe using a RNeasy mini column (Qiagen GmbH, Valencia, CA).

Pharmacological Treatments and Heat Induction

For tamoxifen (Sigma, St. Louis, MO; T5648) treatments, a 50-mM stock solution was made and stored at −20°C. For embryo treatments, tamoxifen was diluted in embryo medium to 0.5 μM. At mid-gastrulation (75% epiboly or 8 hpf), embryos, still in their chorions, were transferred into Petri dishes containing the treatment solution. For control treatments, sibling embryos were incubated in corresponding dilutions of DMSO and ethanol. All incubations were conducted in the dark. For heat shock induction, undechorionated embryos at mid-gastrulation stages, 24 or 48 hpf, were transferred into fresh Petri dishes. After removal of excess embryo medium, 42°C embryo medium was added, incubated for 0.5 hr at 37°C, and the Petri dishes were returned to the 28.5°C incubator. For brief heat induction, Petri dishes were returned to the 28.5°C incubator after application of the 42°C embryo medium. For double-treated embryos (heat and tamoxifen), heat induction was always carried out first to induce uniform CreERT2 expression followed by tamoxifen application.

PCR Analysis of Cre-Mediated Recombination

Transgenic fish containing the red-to-green reporter Tg(EF1α loxP-DsRed2-loxP EGFP) were crossed with the enhancer trap Tg(hsp70l:mCherry-T2A-CreERT2)#15 allele. The resulting embryos were raised until the desired stage (mid-gastrulation, 1 day, 5 days, 10 days) when heat or TAM or both or none was applied and genomic DNA was isolated 24 hr later. Genomic DNA was isolated from pools of 20 of either EGFP- (if possible) or DsRed-positive embryos using the standard DNA isolation method as previously described (Westerfield,2000). The genomic DNA was used as template for PCR amplification of our red-to-green reporter using a forward primer annealing to the 3′ region of the EF1α promoter (Ef1a-for 5′-ccttcttctctttccta cagctcc-3′) and a reverse primer annealing to the 5′ region of the EGFP gene (EGFP-rev 5′-tttacct tcttccgtgctggcaac-3′). Thirty-two PCR cycles (30 sec/94°C denaturation, 30 sec/60°C annealing, 2 min/68°C elongation) were used and the amplification products were separated on a 1.2% agarose gel.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

We thank Drs. J. Kuwada and P. Chambon for sharing reagents, Marika Fischer and Katrin Sippel for excellent zebrafish care, and the members of the Brand laboratory for discussions.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
DVDY_22497_sm_SuppFigS1.tif11779KSupp. Fig. S1. Cre-mediated recombination of the (hsp70l:mCherry-T2A-CreERT2)#12 allele in the red-to-green reporter line in the absence and presence of heat and TAM. A: Scheme of the transgene combination of the embryos depicted in B–E. B: In the absence of heat and TAM, the combination of the Tg(hsp70l:mCherry-T2A-CreERT2)#12 allele with the red-to-green reporter line results in strong DsRed2 but no EGFP expression in double transgenic embryos. C: Application of TAM leads to mosaic EGFP expression in double transgenic embryos at permissive temperatures. D: In the absence of TAM, mosaic EGFP expression can be detected after heat treatment. E: Application of TAM and heat results in strong ubiquitous EGFP expression in double transgenic embryos. B–E: Lateral views of live 24-hpf embryos.
DVDY_22497_sm_SuppFigS2.tif5443KSupp. Fig. S2. Recombination efficiency of the (hsp70l:mCherry-T2A-CreERT2)#12. A: Scheme of the transgene combination and the dissection plane of the embryos depicted in B–D. Cross-sections of double transgenic embryos examined by immunohistochemistry against EGFP showing uniform EGFP expression in the retina (B), diencephalon (C), and hindbrain (D).
DVDY_22497_sm_SuppFigS3.tif14813KSupp. Fig. S3. Recombination of the (hsp70l:mCherry-T2A-CreERT2)#12 allele at later stages. A: Scheme of the transgene combination of the embryos depicted in C–E. B: Expression of DsRed2 in the red-to-green reporter line at 24, 48, and 72 hpf revealed by in situ hybridization. Fluorescent EGFP expression profile in double transgenic embryos after heat induction and TAM treatment at mid-gastrulation stages (C), 24 hpf (D), and 48 hpf (E), respectively.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.