SEARCH

SEARCH BY CITATION

Keywords:

  • hyaluronan;
  • hyaluronan synthase-2;
  • knockout mice;
  • cartilage;
  • skeletogenesis;
  • endochondral ossification

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Mice possessing no Has2 expression in chondrocytes died near birth and displayed abnormalities throughout their skeleton. By embryonic day 18.5, the long bones were short and wide, and possessed excessive mineralization within their diaphysis, with little evidence of diaphyseal bone modeling. However, this does not appear to be associated with an absence of blood vessel invasion or the reduced presence of osteoclasts. There was no evidence for the formation of an organized growth plate between the epiphysis and diaphysis, and while hypertrophic chondrocytes were present in this region they were abnormal in both appearance and organization. There was also increased cellularity in the epiphyseal cartilage and a corresponding decrease in the abundance of extracellular matrix, but aggrecan was still present. Thus, hyaluronan production by chondrocytes is not only essential for formation of an organized growth plate and subsequent long bone growth but also for normal modeling of the diaphyseal bone. Developmental Dynamics 240:404–412, 2011. © 2011 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Hyaluronan (hyaluronic acid, HA) is a linear polysaccharide, composed of alternating glucuronic acid (GlcA) and N-acetyl glucosamine (GlcNAc) residues, which belongs to the family of glycosaminoglycans. It differs from other glycosaminoglycans in its extremely long length and being nonsulfated. While the other glycosaminoglycans (chondroitin sulfate, dermatan sulfate, keratan sulfate, heparan sulfate, and heparin) commonly have molecular masses of less than 50 kDa, the molecular mass of hyaluronan may exceed 5,000 kDa (Fraser et al.,1997). Thus the length of hyaluronan if fully extended can exceed 10 μm. Hyaluronan is present throughout the body, with its abundance being greatest in the skin and skeletal system.

Hyaluronan also differs from other glycosaminoglycans in not being synthesized within the Golgi on a protein primer. Synthesis occurs at the plasma membrane of the cells by means of a membrane-bound hyaluronan synthase (Has), which uses cytosolic UDP-monosaccharides to synthesize hyaluronan (Yoshida et al.,2000). The growing hyaluronan chain is extruded directly through the plasma membrane to the extracellular environment. There appears to be no specific chain termination mechanism for hyaluronan synthesis or a release mechanism from the synthase, and much of the newly synthesized hyaluronan remains in the pericellular environment as a cell coat. When release does occur, hyaluronan may accumulate and function in more remote areas of the extracellular matrix, such as in cartilage, or be secreted into a body fluid, such as in synovial fluid.

Mammals possess three Has, namely Has1, Has2, and Has3, encoded by Has1, Has2, and Has3 genes, respectively (Spicer and McDonald,1998). The three Has genes are located throughout the genome, but share similar exon structures and generate proteins with considerable sequence identity. All the Has consist of transmembrane or membrane-associated domains flanking a large cytosolic catalytic domain (Weigel et al.,1997). While all Has synthesize hyaluronan of an identical composition, they do possess distinct enzymic properties (Itano et al.,1999), differing in the rate of hyaluronan release from the cell surface, the rate of hyaluronan elongation, and the molecular size of the hyaluronan being produced. The Has also differ in the tissues in which they are expressed (Spicer and McDonald,1998), with Has1 and Has3 being more widely expressed than Has2 in different organs.

Message for all three Has genes have been described in cartilage (Recklies et al.,2001), with Has2 expression predominating and Has3 being least expressed. The relative level of Has expression varies with both age and cytokine or growth factor stimulation (Recklies et al.,2001; Hiscock et al.,2000), and under some circumstances Has1 expression may exceed that of Has2. However, in normal chondrocytes, antisense inhibition of Has2 expression severely depletes hyaluronan production (Nishida et al.,1999), suggesting that it is the major isoform responsible for hyaluronan production in cartilage. Within the cartilage, the hyaluronan may serve several roles depending on its location. At the cell surface it may form a protective coat and be involved in the regulation of chondrocyte metabolism by means of interaction with specific receptors (Knudson et al.,1999). Within the extracellular matrix, it forms the large proteoglycan aggregates, in association with aggrecan and link protein (Hascall,1988), that are responsible for the unique osmotic properties needed to allow cartilage to function normally throughout life. The length of the hyaluronan synthesized by chondrocytes shows little variation with age (Holmes et al.,1988), whereas the length of the hyaluronan extracted from the cartilage extracellular matrix decreases with age, indicative of extracellular depolymerization.

It is easy to envisage that depletion in hyaluronan would have severe consequences on cartilage function, and one approach to addressing this topic is by means of the generation of Has knockout mice. It has been reported that Has1 and Has3 knockout mice show no obvious abnormalities (Spicer and Nguyen,1999), suggesting that Has2 is responsible for much hyaluronan synthesis in mice. Thus, it was not surprising that Has2 knockout mice died early during mid-gestation (embryonic day [E] 9.5 to E10; Camenisch et al.,2000). As death occurred before development of the skeletal system, it was not possible to assess the effect of hyaluronan depletion on either cartilage or bone development. To overcome this problem conditional knockout mice have been generated using the Prx1 promoter to drive Cre expression in the limb buds of mice possessing floxed Has2 alleles (Matsumoto et al.,2009). In the present work a similar approach has been used at a later stage of chondrogenesis, with Cre expression being driven by the type II collagen (Col2) promoter, so confining Has2 knockout to cartilages. While the two approaches show some phenotypic similarities, they also show some surprising differences.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Has2 function in chondrocytes was ablated by crossing Has2fl/fl mice with mice expressing Cre recombinase under the control of the mouse Col2 promoter to obtain mice that were either heterozygous or homozygous for the excised Has2 gene. The heterozygotes exhibited mild growth abnormalities that were only apparent after birth (data not shown), whereas the homozygotes showed alterations of the skeleton that began during embryonic development. At E15.5, the exterior appearance of the homozygous embryo was not grossly distinguishable from the control, but by E18.5 the homozygotes exhibited profound dwarfism and a short snout (Fig. 1A,B). All homozygote animals died just before or within several hours of birth.

thumbnail image

Figure 1. The phenotype of mice. A–F: Mice at the day of birth were photographed for external appearance (A,B), and decalcified sections from the proximal tibia were probed with a biotinylated hyaluronan-binding protein to visualize the presence of hyaluronan in the center of the epiphysis for embryonic day (E) 17.5 (C,D) and E15.5 (E,F) embryos. Tissues were taken from control mice (Has2fl/flCre; A,C,E) and homozygous knockout mice (Has2fl/flCre+; B,D,F). Scale bar = 50 μm in C–F.

Download figure to PowerPoint

To confirm that Has2 message depletion resulted in hyaluronan depletion in the cartilage, epiphyseal cartilage from E15.5 and E17.5 long bones were treated with a biotinylated hyaluronan-binding protein (HABP). At E17.5 the control animals showed intense reactivity in both the pericellular matrix of normal chondrocytes and in the extracellular matrix, confirming hyaluronan presence (Fig. 1C), whereas the tissues from the homozygotes exhibited no reactivity in either location (Fig. 1D). At E15.5, the control cartilage also showed intense staining (Fig. 1E), and this staining was reduced in the mutant cartilage, although some HABP staining did persist at this early stage of embryonic cartilage development (Fig. 1F). This presence of HABP staining at E15.5 may reflect the persistence of some Has2-derived hyaluronan from the prechondrocytes that were not yet expressing type II collagen present in the early bone anlagen. Alternatively, it could reflect some hyaluronan synthesis by means of Has1 or Has3 gene expression during early cartilage development, but it is clear that these genes cannot fully compensate for the loss of Has2 gene expression.

The effect of hyaluronan deficiency on the skeleton was examined in mutant and control mice at E15.5 and E18.5. At E15.5, the comparisons revealed that all of the bones of the skeleton developed as recognizable forms, but the ribs and long bones were slightly shorter in the mutant relative to the control mice (Fig. 2A,B). The frontal, parietal, and occipital bones of the skull appeared to develop and mineralize normally. By day 18.5, however, all bones that were formed by means of endochondral bone formation were markedly shortened in the skull and the axial and appendicular skeletons of the mutant mice (Fig. 2C,D).

thumbnail image

Figure 2. Skeleton of embryonic mice. A–D: Whole mouse skeletons from embryonic day (E) 15.5 embryos (A,B) and E18.5 embryos (C,D) were stained with Alcian blue and Alizarin red. Tissues were taken from control mice (Has2fl/flCre; A,C) and homozygous knockout mice (Has2fl/flCre+; B,D).

Download figure to PowerPoint

Histological analysis was used to determine how long bone growth and maturation were affected in the mutants. The analyses were carried out on the femur, where bone growth occurs rapidly and perturbations in endochondral bone formation and modeling would be most apparent. Mutant and normal femurs were examined in sections prepared from paraffin-embedded tissue stained either with Safranin O or Goldner stain to reveal the architecture of either cartilage or bone tissue, respectively. At E15.5, the mutant femur was found to be approximately 25% shorter than the control (Fig. 3A,B), and unlike the normal femur, the primary ossification center within the diaphysis had not yet formed, although hypertrophic chondrocytes were abundant in this region with a surrounding diaphyseal bone collar. By E18.5, significant changes were observed in the length of the normal bone (Fig. 3C), whereas the length of the mutant bone showed little change (Fig. 3D). Comparative measurements revealed that the length of the mutant bone was 45–50% shorter than its normal counterpart by E18.5. Furthermore, while the normal bone possessed a thin diaphyseal bone cortex and a well-formed trabecular marrow cavity (Fig. 3E), the mutant bone possessed an extensively mineralized matrix within the diaphysis, extending from near the center of the diaphysis to the periosteum. The mineralized matrix also extended peripherally into the epiphysis surrounding the region where the growth plate was expected to reside (Fig. 3F). However, this region appeared disorganized, and there was an absence of the columnar arrangement of proliferating chondrocytes.

thumbnail image

Figure 3. Histology of embryonic femurs. A–F: Decalcified femurs were stained with Safranin O (A–D), and nondecalcified femurs were stained with Goldner stain (E,F). Tissues were taken from control mice (Has2fl/flCre; A,C,E) and homozygous knockout mice (Has2fl/flCre+; B,D,F) at embryonic day (E) 15.5 (A,B) and E18.5 (C–F). DB, diaphyseal bone; DBC, diaphyseal bone collar; HC, hypertrophic cartilage; GP, growth plate; GP?, region where growth plate is to be expected in mutant bone. Scale bar = 200 μm in A–F.

Download figure to PowerPoint

The presence of an excessively mineralized matrix in the diaphyseal bone of the E18.5 mutant mice suggests that defective bone modeling may be occurring, resulting in a failure to resorb the initially formed calcified osteoid and cartilage. This could be due to an absence of blood vessel invasion or of osteoclast maturation. However, analysis of platelet endothelial cell adhesion molecule (PECAM) staining (Fig. 4A,B) as a marker of endothelial cells and cathepsin K (Fig. 4C,D) and TRAP (Fig. 4E,F) as markers of active osteoclasts indicate no obvious deficiency in either blood vessels or osteoclasts. Osteoclast density was similar throughout the mineralized matrix of the mutant bone and was generally higher than within the control bone (18 ± 3 vs. 12 ± 2 per 0.1 mm2). The only exception was at the junction between the metaphysis and growth plate of the control bone where osteoclast density was similar to that throughout the mutant bone.

thumbnail image

Figure 4. Analysis of blood vessel and osteoclast presence. A–D: Decalcified sections of the bone adjacent to the distal femoral epiphyses of embryonic day (E) 18.5 embryos were analyzed by immunohistochemistry using an anti-PECAM antibody (A,B) to identify the presence of blood vessels, or an anti-cathepsin K antibody (C,D) to identify the presence of osteoclasts. E,F: The presence of active osteoclasts was also identified by analysis of TRAP activity. Tissues were taken from control mice (Has2fl/flCre; A,C,E) and homozygous knockout mice (Has2fl/flCre+; B,D,F). The bar represents 100 μm (A–F). The dashed line indicates the position of the bone/cartilage junction between the diaphysis and the epiphysis.

Download figure to PowerPoint

Histology of the epiphyseal cartilage in E15.5 femurs at higher resolution showed that the cartilaginous epiphysis of the normal bone possessed a well-organized growth plate with regularly spaced columns of proliferating chondrocytes terminating in hypertrophic cells and a calcified cartilage (Fig. 5A). In contrast, the mutant epiphyseal cartilage lacked this highly organized appearance (Fig. 5B). It exhibited an abnormally high number of chondrocytes per unit area, as well as an extracellular matrix that represented a smaller proportion of total tissue volume and a disorganized arrangement of proliferating and hypertrophic cells where the growth plate was expected to reside. While the cells of the mutant cartilage did exhibit hypertrophy, the resulting hypertrophic cells were substantially smaller and less regular in shape as compared to their normal counterparts (Fig. 5C,D). Furthermore, many of the mutant hypertrophic chondrocytes had no clear separation by extracellular matrix and appeared to occupy the same lacunar space, in contrast to the single cells consistently observed in the normal cartilage. In addition, Alizarin red staining revealed that, while the hypertrophic chondrocytes of the mutant did not effectively calcify their surrounding matrix within the center of the hypertrophic region, there was abundant mineralization at its periphery (Fig. 5E,G).

thumbnail image

Figure 5. Histology of epiphyseal cartilage. Decalcified sections of the distal femoral epiphyses of embryonic day (E) 15.5 embryos were analyzed by high resolution histology following Toluidine blue staining. A,B: Montages show the resting, proliferative (Pro) and hypertrophic (Hyp) zones of the growth plates in normal mice (A) and the equivalent regions in mutant mice (B). C,D: The insets show cells of the hypertrophic zones at high magnification. E–H: The diaphyseal/epiphyseal junctions of nondecalcified femurs from E15.5 embryos were analyzed for mineral content by Alizarin red staining (E,G) and counterstaining with Safranin O (F,H). I,J: Decalcified sections from the proliferative zones of E15.5 epiphyses were also analyzed for cell proliferation by bromodeoxyuridine incorporation. Tissues were taken from control mice (Has2fl/flCre; A,C,E,F,I) and homozygous knockout mice (Has2fl/flCre+; B,D,G,H,J). CB, calcified bone; CC, calcified cartilage. Scale bars = 50 μm in A,B,E–H, 20 μm in I,J, 5 μm in C,D.

Download figure to PowerPoint

Analysis of cell proliferation by bromodeoxyuridine (BrdU) labeling in the proliferative zone of the growth plate in the E15.5 normal bone (Fig. 5I) and in the equivalent region of maximal proliferation in the mutant bone (Fig. 5J) showed that, even although more labeled cells were evident in the mutant, the percentage of cells in the S-phase was unaffected in the mutants (20% in mutants versus 19% in controls). Thus, dwarfism resulting from the ability of the long bones to increase in length cannot be explained by decreased chondrocyte proliferation in the mutant mice, but more likely reflects an inability of the proliferating cells to organize into linear columns which can then further expand in length with cell hypertrophy (Ballock and O'Keefe,2003).

To further identify the presence of the periosteum and periosteal bone, sections from the E15.5 tibia were analyzed by immunohistochemistry using an anti-Bril antibody, recognizing osteoblasts. In the control mice, tissue containing osteoblasts derived from the periosteum surrounds the diaphysis of the bone and extends around the hypertrophic zones of the adjacent growth plate (Fig. 6A). In the mutant mice, the osteoblast-containing tissue derived from the periosteum appears thicker than in the controls and surrounds all the hypertrophic chondrocytes that are forming the primary center of ossification but does not extend toward the epiphyseal cartilage (Fig. 6B).

thumbnail image

Figure 6. Analysis of osteoblast presence. Decalcified sections of the tibia from embryonic day (E) 15.5 embryos were analyzed by immunohistochemistry using an anti-Bril antibody to verify the presence of osteoblasts. A,B: Tissues were taken from control mice (Has2fl/flCre; A) and homozygous knockout mice (Has2fl/flCre+; B). DB, diaphyseal bone; GP, growth plate; DBC, diaphyseal bone collar; HC, hypertrophic cartilage. Scale bar = 100 μm in A,B.

Download figure to PowerPoint

Electron microscopic analysis of the epiphyseal cartilage in the E18.5 mutant bone showed that some of the chondrocytes within the center of the hypertrophic zone adjacent to the diaphysis had a pyknotic appearance (Fig. 7A,B). This suggests that some mutant hypertrophic chondrocytes die prematurely, in contrast to the hypertrophic chondrocytes in the normal growth plate which die only at the metaphyseal border. The presence of excessive cell death in the mutants was supported by TUNEL (terminal deoxynucleotidyl transferase–mediated deoxyuridinetriphosphate nick end-labeling) analysis, which indicated that the hypertrophic chondrocytes exhibited increased apoptosis adjacent to the diaphysis (Fig. 7C,D). There was also evidence of increased apoptosis adjacent to the periosteum (Fig. 7D), although it is not clear if these cells are the same as the pyknotic cells viewed in the electron microscope. These collective observations suggested that a reduction of Has2 activity had deleterious effects on the organization, size, function, and fate of the hypertrophic cells, and led to an uncoupling in the replacement of endochondral cartilage by endochondral bone.

thumbnail image

Figure 7. Analysis of chondrocyte hypertrophy and apoptosis. A,B: Cells in the hypertrophic zone of the growth plate of embryonic day (E) 18.5 embryos were analyzed by electron microscopy. C,D: Sections were also analyzed for cell apoptosis by the TUNEL (terminal deoxynucleotidyl transferase–mediated deoxyuridinetriphosphate nick end-labeling) assay. Tissues were taken from control mice (Has2fl/flCre; A,C) and homozygous knockout mice (Has2fl/flCre+; B,D). PCM, pericellular matrix; HC, hypertrophic chondrocyte; PC, pyknotic cell. Scale bars = 2 μm in A,B, 50 μm in C,D.

Download figure to PowerPoint

Analysis of gene expression by in situ hybridization in the E15.5 femoral epiphyses showed that type II collagen expression was present throughout the cartilage in both the normal and mutant mice (Fig. 8A,B). As expected, a zone of chondrocytes expressing type X collagen was present in the growth plates of the wild-type mice (Fig. 8C), and this was preceded by a zone of cells expressing Indian hedgehog (Fig. 8E). Surprisingly, zones of chondrocytes expressing type X collagen and Indian hedgehog were present at similar sites in the mutant mice (Fig. 8D,F), although their location and demarcation were less well defined. Thus, even though an organized growth plate was not present in the knockout mice, and the hypertrophic chondrocytes remained smaller and misshapen, there was still expression of the genes associated with endochondral ossification.

thumbnail image

Figure 8. Analysis of chondrocyte gene expression. A–F: Decalcified sections of the distal femoral epiphyses of embryonic day (E) 18.5 embryos were analyzed by in situ hybridization using digoxigenin-labeled riboprobes recognizing mRNA for type II collagen (A,B), type X collagen (C,D) and Indian hedgehog (E,F). Tissues were taken from control mice (Has2fl/flCre; A,C,E) and homozygous knockout mice (Has2fl/flCre+; B,D,F). Scale bar = 100 μm in A–F.

Download figure to PowerPoint

The epiphyseal cartilage of both normal and knockout E15.5 mice stained strongly with Safranin O (Fig. 9A,B), suggesting a high abundance of proteoglycan, presumably aggrecan. This is somewhat unexpected in the knockout mice where hyaluronan is expected to be deficient, as aggrecan is thought to be localized in the cartilage extracellular matrix by means of its interaction with hyaluronan. The presence of aggrecan in the cartilage extracellular matrix of both normal and mutant mice was confirmed by immunohistochemical analysis using an antibody recognizing the aggrecan G1 domain (Fig. 9C,D). Immunohistochemical analysis also confirmed the presence of a high content of chondroitin sulfate, typical of aggrecan, in both normal and knockout mice (Fig. 9E,F), which accounts for the strong Safranin O staining observed in both animals. Similar levels of Safranin O staining were also observed in the epiphyseal cartilage of both normal and knockout mice at the day of birth (Fig. 9G,H).

thumbnail image

Figure 9. Analysis of cartilage proteoglycan content. A,B,G,H: Decalcified sections of the distal femoral epiphyses of E15.5 embryos (A,B) and mice at the day of birth (G,H) were stained with Safranin O. C–F: Sections from E18.5 embryos were also analyzed by immunohistochemistry using an anti-aggrecan G1 antibody (C,D) and an anti-ΔC4S antibody (E,F) to verify the presence of aggrecan and chondroitin sulfate, respectively. Tissues were taken from control mice (Has2fl/flCre A,C,E,G) and homozygous knockout mice (Has2fl/flCre+; B,D,F,H). Scale bar = 20 μm in A–H.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

In the present study, long bone development has been analyzed in mice deficient in Has2 gene expression in chondrocytes. The results reveal that hyaluronan deficiency caused by Has2 loss of function has no apparent affect on the shape of the cartilaginous anlagen, but that the anlagen fails to appropriately form either a normal primary ossification center or growth plate. It is therefore apparent that Has2 gene expression by chondrocytes is essential for the normal remodeling of cartilage during long bone development, and that the expression of the Has1 and Has3 genes cannot compensate for an absence of Has2 gene expression in endochondral bone formation. This is not unexpected as even though Has1 and Has3 are expressed at higher levels and in more tissues than Has2 in the adult, they have a more restricted expression than Has2 in the embryo (Spicer and McDonald,1998), and in situ hybridization during mouse development has revealed that Has2 is highly expressed in developing limbs (Tien and Spicer,2005).

Recently, Has2 expression has been ablated in the limb buds of floxed Has2 mice using the limb mesoderm specific Prx1 promoter to drive Cre expression (Matsumoto et al.,2009). This promoter results in high Cre expression in the fore and hind limb mesenchyme and the cranial mesenchyme (Logan et al.,2002), but not in the somites of the developing spine (Martin and Olson,2000). Thus mice will be expected to lack Has2 expression in the skull and developing appendicular skeleton, but not in the axial skeleton, in contrast to the mice where the Col2 promoter is used to drive Cre expression. This difference may explain why the mice in the present work have a severely shortened rib cage and die close to birth, whereas those generated by means of the Prx1 promoter survive postnatally. Also, unlike the Prx1-Cre-generated Has2-deficient mice, the Col2-Cre-generated Has2-deficient mice did not show a patterning defect in limb development, which is consistent with the later stage in embryonic development when Cre is being expressed. While both the Col2- and Prx1-generated Has2 knockout mouse lines exhibit similar severe changes in endochondral bone growth, there appear to be major differences in the modeling of the newly formed bone and the retention of aggrecan in the cartilage.

In normal mouse development at around E13.5 to E14.5, the chondrocytes of the central part of the future diaphysis of the long bones progress toward hypertrophy and eventually undergo apoptosis (Lefebvre and Smits,2005). With the help of multinucleated osteoclasts that invade and degrade the calcified matrix surrounding the hypertrophic cells, endothelial cells, and cells of the osteoblastic lineage are able to invade the anlagen thus giving rise to the primary center of ossification. This process has been well characterized and is regulated by prehypertrophic and hypertrophic chondrocytes. Indian Hedgehog production by the prehypertrophic chondrocytes is essential to initiate osteoblast differentiation within the perichondrium (St Jacques et al.,1999; Chung et al.,2001), thereby converting the perichondrium into a periosteum. In addition, vascular endothelial growth factor (VEGF) produced by the hypertrophic cells regulates the invasion of the vasculature into the cartilage anlagen (Zelzer et al.,2002,2004) and permits the osteoclast-mediated resorption of the calcified cartilage matrix (Blavier and Delaisse,1995; Engsig et al.,2000). The osteoblasts, osteoclasts and the vasculature arise synchronously from the periosteum and co-function within the developing cartilaginous fetal skeleton to initiate bone formation.

In the Col2-Cre-generated Has2-deficient embryo the ossification process described above is not only delayed but is also different in two major areas. First, the diaphyseal bone collar of the mutant bone is thicker than expected at E15.5, possibly due to increased production and retention of cells of the osteoblast lineage, and this may contribute to the excessive amount of mineralized tissue present in the diaphyseal bone by E18.5. However, one cannot exclude the possibility that endochondral bone does contribute to the endosteal surface of the E15.5 bone collar, and also forms the central core of the E18.5 mutant bone. There are several possible mechanisms to account for the mutant bone phenotype at E18.5. The phenotype could be a consequence of the absence of HA within the cartilaginous matrix upon which bone formation and modeling take place. The generation of HA fragments within the cartilage is needed to facilitate vascular invasion, as such fragments are known to be angiogenic (West et al.,1985; Pardue et al.,2008). However, endothelial cells characteristic of vascular invasion do not appear to be deficient in the mutant bones. HA is also known to influence the behavior of both osteoclasts and osteoblasts. HA may participate in osteoclast binding to the extracellular matrix (Prince,2004) and HA fragments induce bone resorption (Ariyoshi et al.,2005), whereas HA has been reported to be an inhibitor of osteoblast differentiation (Falconi and Aubin,2007). However, the identification of abundant osteoclasts within the diaphysis of the knockout bone may favor a greater involvement of the osteoblasts, although at present, one cannot clearly distinguish between increased bone formation by the osteoblasts and decreased resorption by the osteoclasts as there is no guarantee that the observed osteoclasts are actively resorbing the bone on which they reside. There is also the intriguing possibility that the excessive periosteal bone formation could occur due to the decreased production of HA by the osteoblasts themselves, as Col2-driven lacZ expression was transiently detected in the periosteal osteoblasts (Nakamura et al.,2006). For reasons that are not readily apparent, the excessive mineralization of the embryonic diaphyseal bone does not appear to be a feature of the Prx1-Cre-generated Has2-deficient embryo (Matsumoto et al.,2009).

The second difference was that the central core of cartilage that should have been replaced by osseous tissue by E15.5 was still present in the mutant bones, and while the cells exhibited some increases in their diameter indicative of a mild hypertrophy, the central cells had not yet orchestrated the formation of the primary ossification center. Previous work has demonstrated that hyaluronan produced by Has2 is essential for normal growth plate chondrocyte hypertrophy (Alini et al.,1992; Pavasant et al.,1996; Suzuki et al.,2005). Thus, normal chondrocyte differentiation and hypertrophy in fetal bone development and that in juvenile growth both rely upon Has2-mediated hyaluronan production to organize an appropriate extracellular matrix.

With respect to the cartilage itself, one might predict that, in the absence of hyaluronan, proteoglycan aggregates could not form and that free aggrecan may therefore no longer be stably retained in the tissue and so be lost by diffusion. While this is reported to be the case in the Prx1-Cre–generated Has2-deficient embryonic cartilage (Matsumoto et al.,2009), the aggrecan content of the Col2-Cre-generated Has2-deficient embryonic cartilage extracellular matrix did not appear to be severely depleted at either E15.5 or at the day of birth. The reason for this difference is not obvious, but at E15.5, it could reflect the presence of residual hyaluronan in the tissue even though it is no longer being produced by the Has2 gene. It is possible that hyaluronan was produced in the anlagen of the embryonic bone before chondrogenesis and then in part persists in the developing cartilage, so providing sufficient hyaluronan for the retention of aggrecan. However, with embryonic development such hyaluronan is depleted, yet the aggrecan persists. Alternatively, it is possible that the aggrecan in the cartilage of the Col2-driven mice is not stably localized within the extracellular matrix by interaction with hyaluronan, but is localized by interaction of its G3 region with another matrix component (Day et al.,2004) or is undergoing continuous loss by diffusion and replacement by newly synthesized molecules.

It is interesting to note that a chondrodysplastic phenotype is also produced in cartilage matrix-deficiency (cmd) mice (Rittenhouse et al.,1978), which represent a natural aggrecan knockout due to a 76-bp deletion in its hyaluronan-binding domain (Watanabe et al.,1994), and in link protein knockout mice (Watanabe and Yamada,1999). With link protein depletion, proteoglycan aggregate formation may occur but one would expect it to be unstable. Thus, either the absence of aggrecan or its inability to form stable aggregates is detrimental to cartilage development.

It is unlikely that the perturbation of chondrocyte differentiation during cartilage development seen in the present work is due entirely to the inability to form proteoglycan aggregates, as hyaluronan is a multifunctional molecule which is known to influence intracellular signaling by means of interaction with the cell surface receptors CD44 and RHAMM (Lee and Spicer,2000; Tammi et al.,2002; Turley et al.,2002). There are also a variety of other hyaluronan-binding proteins produced by many cells (Day and Prestwich,2002), which play an extracellular, intracellular, or cell surface role. In view of all these potential partners for hyaluronan in cartilage, it is not surprising that chondrocyte differentiation and extracellular matrix production are perturbed in its absence.

To date no human disorder involving a mutation in the Has2 gene has been reported, but it is possible that such patients may exist. While dominant traits involving a mutation in one Has2 allele are unlikely to produce a significant phenotype, recessive mutation affecting both alleles could give phenotypic consequences if they result in marked reduction in the normal level of Has2 activity. It remains to be established whether such individuals would have a major skeletal phenotype or whether defects in other organs would predominate.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Generation of Cartilage-Specific Has2 Knockout Mice

Mice containing the floxed Has2 allele (genotype: Has2fl/+) were mated to Col2-Cre transgenic mice (genotype: Cre+; Jackson Laboratories) to generate mice bearing Col2-Cre and a floxed Has2 allele (genotype: Has2fl/+;Cre+). The generation of the floxed Has2 allele has been described elsewhere (Matsumoto et al.,2009). Chondrocyte-specific inactivation of the Has2 gene was accomplished by mating Has2fl/+Cre+ mice with homozygote floxed mice (Has2fl/fl) to generate offspring with the following genotypes: Has2fl/flCre; Has2fl/+Cre; Has2fl/+Cre+; Has2fl/flCre+. Cre littermates were used as normal controls for the Has2fl/flCre+ mice, which have both alleles inactivated, and the heterozygote Has2fl/+Cre+ mice, which have one allele inactivated. Animals homozygote and heterozygote for Has2 gene inactivation were studied on days E15.5 and E18.5, where day E0.5 was 12 am on the day of detection of a vaginal plug, and on the day of birth.

Mice were genotyped by polymerase chain reaction analysis using tail DNA samples (Laird et al.,1991) and the following primer pairs: 5′-CCT GGAAAATGCTTCTGTCCGTTTGCC and 5′-GATTATAGCTGGCTGGTGGCAGATG, giving a 650-bp product for the Cre transgene; 5′-TGCAGAATTTA GGGGCGAATTGGGAGCTAA and 5′-ATGAGGTTAGAGATTAGCAAGACT GAGTTC, giving products of 441 or 550 bp, respectively, for wild-type and floxed alleles of the Has2 gene; and 5′-TGCAGAATTTAGGGGCGAATTGGG AGCTAA and 5′-CTTGAACCTTGAG TGTGCCATTTTGTAGTC, giving a 346 bp product after Cre excision of the floxed Has2 allele. All mice were housed in a virus-free and parasite-free barrier facility. They were exposed to a 12-hr light–dark cycle and fed tap water and regular chow ad libitum. All procedures involving animals were approved previously by the Institutional Animal Care and Use Committee.

Histological Analysis of Phenotype

For whole skeletal preparations, fetal mice were killed, skinned, and eviscerated, fixed in ethanol, then stained with Alcian blue and Alizarin red (Wallin et al.,1994). The stained skeletons were recovered by incubating the carcass in KOH.

For histology, limbs were fixed overnight in 4% paraformaldeyde buffered in phosphate buffered saline (PBS), pH7.4, and either embedded in methylmethacrylate or dehydrated through a graded alcohol series then embedded in paraffin and sectioned at 6 μm. For decalcification, samples were treated with 10% ethylenediaminetetraacetic acid (EDTA) at 4°C with daily changes until soft, before dehydrating and paraffin embedding. Sections in methylmethacrylate were deplastified and stained by Goldner stain (Schenk et al.,1984). Paraffin embedded samples were stained with Safranin O (Rosenberg,1971).

Hyaluronan was identified in tissue sections incubated overnight with biotinylated HA-binding protein (b-HABP; MJS BioLynx Inc., Brockville, ON) at 2 μg/ml in PBS (Parkkinen et al.,1996). The bound b-HABP was visualized using a biotin/avidin system with a diaminobenzidine (DAB) substrate kit (both from Vector Laboratories, Burlingame, CA).

Immunohistochemistry was performed on tissue sections pretreated with chondroitinase ABC as above, then exposed to primary antibody. Sites of antibody binding were identified using a Vectastain ABC Elite kit or a Vector M.O.M. kit (Vector Laboratories). Primary antibodies were: a rabbit polyclonal anti-aggrecan G1 (Sztrolovics et al.,2002) recognizing the N-terminal globular domain of aggrecan responsible for interaction with hyaluronan; a mouse monoclonal anti-ΔC4S (2-B-6, Seikagaku Corporation, Japan) recognizing the 4-sulfated chondroitin sulfate stubs remaining on the aggrecan core protein after chondroitinase treatment; a polyclonal antibody recognizing PECAM (Santa Cruz Biotechnology, CA) present on blood vessel endothelial cells; a polyclonal antibody recognizing cathepsin K (Anway et al.,2004) present in osteoclasts; and a polyclonal antibody recognizing Bril present on the cell surface of osteoblasts (Moffatt et al.,2008). The presence of tartrate-resistant acid phosphatase (TRAP) activity (Shevde et al.,1994) indicative of active osteoclasts was also determined.

Cells undergoing apoptosis were identified in paraffin-embedded histological sections by detecting DNA fragmentation using a TACS in situ Apoptosis Detection Kit (R&D Systems, Minneapolis, MN). To identify cells undergoing proliferation, mice were injected with Zymed BrdU labeling reagent 2 hr before killing (Invitrogen, Carlsbad, CA), then used to prepare paraffin-embedded histological sections of the long bones. Histological sections were then analyzed for BrdU incorporation using a biotinylated anti-BrdU antibody and a Zymed BrdU staining kit (both from Invitrogen). All procedures were carried out according to the manufacturer's instructions.

In situ hybridization was carried out on paraffin-embedded tissue sections using digoxigenin (DIG) -labeled cRNA probes (Murtaugh et al.,1999). Probes were labeled by in vitro transcription using DIG-UTP and detected by means of an anti-DIG antibody (Roche Diagnostics, Laval, Canada). Riboprobes were used to detect the messages for type II collagen, type X collagen, and Indian hedgehog (Inada et al.,1999).

For electron microscopy, mouse limbs were dissected from embryos removed from pregnant females that had been perfused through the heart with a solution of 5% glutaraldehyde in 0.1 M sodium cacodylate, pH 7.3. Samples were post-fixed in potassium-reduced osmium tetroxide, dehydrated in acetone, and embedded in JEMbed epoxy resin before examination in a Philips 400 electron microscope at 80 kV (Lee et al.,2001). In addition, 1-μm-thick sections were stained with 1% aqueous Toluidine blue (Lee et al.,2001) or 2% aqueous Alizarin red S, pH 5.5–6.5 (Gilmore et al.,1986) for high-resolution histology.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

The authors thank the Shriners of North America for financial support, Judy Grover and Lisa Lamplugh for technical assistance, and Guylaine Bedard for preparing the figures.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES