SEARCH

SEARCH BY CITATION

Keywords:

  • pig;
  • somatic cell nuclear transfer;
  • placenta

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Somatic cell nuclear transfer (scNT)-derived pig placenta tissues of gestational day 30 displayed avascularization and hypovascularization. Most of the cytotrophoblast-like cells of the developing scNT-derived placenta villi were improperly localized or exhibited impaired migration to their targeting loci. Id-2, Met, MMP-9, and MCM-7 were barely detectable in the cytotrophoblast cells of the scNT-derived placenta villi. Active MMP-2 and MMP-9 expression was significantly down-regulated in the scNT-embryo transferred recipient uteri. scNT clones exhibited a hypermethylated pattern within the pig MMP-9 promoter region and the significance of GC box in the regulation of MMP-9 promoter activity. Marked apoptosis was observed in the developing endometrial gland of scNT-embryo transferred recipient uteri. Collectively, our data strongly indicated that early gestational death of scNT clones is caused, at least in part, by disruption of the developing endometrial gland as a result of impaired trophoblast migration and invasiveness due to the down-regulation of active MMP-9 expression. Developmental Dynamics 240:627–639, 2011. © 2011 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Nuclear transfer (NT) technology can be used to clone desirable adult genotypes and phenotypes, and thus is a valuable tool for agriculture and biomedicine (Schnieke et al.,1997; Lai et al.,2002; Wilmut and Paterson,2003). This technology has led to the genetic improvement of farmed pigs, and the production of transgenic pigs for medical use and organ transplantation (Lai et al.,2002). Despite the advantages of somatic cell NT (scNT), this procedure produces normal offspring with a very low efficiency due in part to a high incidence of fetal death caused by a variety of afflictions during pregnancy, including fetal overgrowth and placental malformations (Hiendleder et al.,2004; Lee et al.,2004; Arnoad et al.,2006; Chae et al.,2006).

Early embryonic mortality occurs in high frequency during a period of gestation known as the embryonic period: 20–30% of pig fetuses die between gestational day 12 and 30, and another 10–15% loss occurs at midgestation (Geisert et al.,1982; Pope et al.,1982; Pope and First,1985; Stroband and Van der Lende,1990; Pope,1994; Geisert and Schmitt,2001). The factors implicated as the causes of early embryonic mortality can be broadly categorized as intrinsic (endometritis and periglandular fibrosis) (Parker et al.,2004; Inagaki et al.,2005), extrinsic (environmental or management-related factors, such as stress, poor nutrition, and body condition) (Lucy,2001; Eugster et al.,2004; Campagne,2006), or embryonic factors (Geisert et al.,1982; Pope and First,1985; Geisert and Yelich,1997). Embryonic factors causing early embryonic mortality are the result of abnormalities in the genetic makeup of the embryo. The incidence of genetic abnormalities in pig embryos has not been established, but may be related to the improper timing of insemination, resulting in fertilization with aged sperm and eggs.

Abnormal placental development and associated consequences for maternal–fetal exchange is a main limiting factor in pig scNT pregnancy (Bauersaches et al.,2009). In general, failure of cloning may be attributed to problems with the reprogramming processes, such as DNA methylation and histone modifications. Abnormal patterns of DNA methylation and histone modification have been observed in cloned embryos (Dean et al.,2001; Santos et al.,2003; Shi et al.,2003). Despite its importance to development and the need for a basic understanding of reprogramming processes, the first trimester period after pig scNT embryo transfer into recipients has been inadequately studied. No attempt to examine the origin of the defects observed in the pig placenta during the first trimester has yet been reported. Therefore, we performed histological examinations and gene expression analyses on developing placentas and uteri as a first approach for gaining an insight into the underlying mechanisms of placental malformation and uterus invasion in cloned pigs. The present study showed that early embryonic mortality was caused by disruption of the developing endometrial gland as a result of impaired trophoblast migration and invasiveness.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Cloning and Sequencing of Placenta-Specific Genes in the Control and scNT Pig Placentas

Since the nucleic acid sequences of the porcine matrix metalloproteinase 9 (MMP-9), met protooncogene (Met), transcriptional enhancer factor 5 (Tef-5), Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain (Cited-1), heart and neural crest derivatives expressed 1 (Hand-1), and inhibitor of differentiation (Id)-2 genes have not been reported, the murine and human gene sequences were compared in order to identify a highly conserved region as a basis for a probe to clone the porcine genes. This conserved region was identified by a BLAST search and used to design degenerate PCR primers. A short fragment of each cDNA was initially recovered by RT-PCR using porcine placenta-derived total RNA. The obtained products were cloned into the pGEM T-easy vector. These fragments were confirmed by DNA sequencing. The results of a BLAST search showed that the cloned MMP-9, Met, Tef-5, Cited-1, Hand-1, and Id-2 genes have been very highly conserved among species during evolution. Each full-length cDNA sequence was obtained from the cDNA library and deposited in GenBank (accession numbers: DQ132879 for MMP-9; DQ141604 for Met; DQ132880 for Tef-5; DQ116787 for Cited-1; AY940738 for Hand-1; and DQ116788 for Id-2). The sequences for the RT-PCR primers for urokinase plasminogen activator (uPA, NM_213945), glial cells missing A (Gcm-1, BP444890), platelet-endothelial cell adhesion molecule 1 (PECAM-1, NM_213907), vascular endothelial growth factor (VEGF), angiopoietin-1 (ANG-1) and -2 (ANG-2), type I vascular endothelial growth factor (VEGFRI), type II vascular endothelial growth factor (VEGFRII), tyrosine kinase Tie2 (TIE-2), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, X94251) were obtained from GenBank. The primers used for each placenta-cell specific marker are listed in Table 1.

Table 1. Primer Lists Used for Semiquantitative or Real-Time RT-PCR
GeneDescriptionPrimerLength (bp)Acc. no.
VEGFVascular endothelial growth factorF : CCTTGCTGCTCTACCTCCAC271NM_214084
R : ATGGCGATGTTGAACTCCTC
ANG-1Angiopoietin-1F : GGAGAAGCCACCAAATGAGA163NM_213959
R : TGAACACAGTCACCCCAAGT
ANG-2Angiopoietin-2F : CACTGGCTGGGAAATGAGTT277NM_213808
R : AGCCTCCTGTGAGCATCTGT
VEGFRIIType II VEGF receptorF : GAGTGGCTCTGAGGAACGAG209AJ245446
R : ACACAACTCCATGCTGGTCA
VEGFRIType I VEGF receptorF : AGAGCGACGTGTGGTCCTAC211AJ245445
R : TCCACAAATCTTGGCCTTTC
MMP-9Matrix metalloproteinase 9F : ACGAGGTGAATCAGGTGGAC218DQ132879
R : TTCCAGCAAAAAGGAAGGTG
TIE-2Tyrosine kinase Tie2F : GATGGTGGAGAAGCCTTTCA261AF251494
R : TGCACGCAGAGCTCATATTC
PPAR-γPeroxisome proliferator- activated receptor gammaF : GCCCTTCACCACTGTTGATT210AB097926
R : GAGTTGGAAGGCTCTTCGTG
ID2Inhibitor of differentiationF : CAGCATGAAAGCCTTCAGTC409DQ116788
R : TCAGCCACAGAGCGCTTTGC
METMet protooncogeneF : GAAGCCAAGGGTTAGCACAG244DQ141604
R : GAGAGTTCTTTTGCAGAGCAGA
PECAM-1Platelet-endothelial cell adhesion molecule 1F : ATCCAAGGCCAAGCAGATGC345NM_213907
R : CGGTCCTAAGTCCCATCAAG
uPAPlasminogen activatorF : TCACCACCAAAATGCTGTGT215NM_213945
R : CTCTCCCCCAACATGAGTGT
HAND-1Heart and neural crest derivatives expressed 1F : ACATCGCCTACCTGATGGAC225AY940738
R: CCGCTCACTGGTTTAACTCC
CITED-1Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domainF : AGGATGCCAACCAAGAGATG200DQ116787
R : GTTGAAGGGTGGGGGTTTAT
GCM-1Glial cells missing AF : AATGGCCAGATGCCTATGAG231BP444890
R : GTTTCCTCTGCTGCTTCTGC
TEF-5Transcriptional enhancer factor 5F : AAGTTCTGGGCAGACCTCAA249DQ132880
R : GTGCTTCAGCTTGTGGATGA
GAPDHGlyceraldehyde-3-phosphate dehydrogenaseF : AAGTGGACATTGTCGCCATC318X94251
R : TCACAAACATGGGGGCATC

Derangement or Lack of Cytotrophoblasts in Developing scNT-Derived Placenta Villi

scNT was performed according to one of our established protocols (Yin et al.,2003; Park et al.,2005; Cho et al.,2007; Lee et al.,2007; Hwang et al.,2009; Park et al.,2009; Uhm et al.,2009). scNT eggs at the 1- to 4-cell stage were surgically transferred into the oviducts of the 11 synchronized recipient gilts. Pregnancy was determined by ultrasound visualization of fetuses between days 25 and 28 of gestation. Of the 11 recipients, 5 became pregnant. Among them, 12 fetuses at day 30 posttransfer were recovered (Table 2). Although scNT-derived fetuses were all alive, they were categorized as arresting (5/12, 41.7%; Fig. 1B–E,I) or healthy (7/12, 58.3%; Fig. 1F–I) based on disparity in vasculature and color of the fetal membranes, and in fetal length and weight. Of note, extraembryonic tissue in scNT clones showed abnormally small size and shape, and displayed avascularization and hypovascularization of placenta compared with that in the control, whereas the size and shape of the fetus and amnionic sac of both the control and scNT clones were similar (Fig. 1). While several placenta-related proteins, Id-2, Met, Hand-1, MMP-9, and MCM-7, were normally expressed in cytotrophoblasts of developing control villi (Fig. 2A–E, arrows), the expression was barely detectable in the cytotrophoblast cells located at the basement membrane of the scNT-derived villi (Fig. 2a–e, arrows). In addition, whereas control-derived cytotrophoblast cells were located on the basement membrane of developing villi and showed a round shape (Fig. 2A–E, arrowheads), scNT-derived cytotrophoblast-like cells showed a shallow and irregular shape (Fig. 2a–e, arrowheads). Furthermore, most cytotrophoblast-like cells of the scNT-derived villi were improperly located and exhibited impaired migration to their targeting loci (Fig. 2a–e, arrows).

thumbnail image

Figure 1. Control (A) and scNT (B–H) -derived fetuses and placentas recovered from gestational day 30. Gestational day-30 uterus contains healthy control fetus (A) and arresting (B–E) and healthy fetuses (F–H). a–e: Fetus, amnionic sac, umbilical cord, placenta, and extraembryonic tissue, respectively. I: Normal healthy fetus (n) and arresting abnormal fetus (ab) in scNT recipient uteri.

Download figure to PowerPoint

thumbnail image

Figure 2. Expression analysis of Id-2 (A, a), Met (B, b), Hand-1 (C, c), MMP-9 (D, d), and MCM-7 (E, e) proteins in control and developing scNT pig villi during the first trimester by immunohistochemistry. The expression of each protein in the control was mainly localized in the trophoblast cell located under the basement membrane of developing villi (arrow). However, scNT placentas showed mislocation of cytotrophoblasts or undermigration to the basement membrane of developing villi (arrowhead). Bar = 50 μm.

Download figure to PowerPoint

Table 2. Analysis of Gestational Day-30 scNT Placentas Recovered by Surgical Process
No. of embryo transferredNo. of recipientsNo. of pregnanciesNo. of fetuses recoveredNo. of arresting fetusesNo. of abnormal placentas
1,824115125/1212/12

The placenta-related gene expression pattern was compared by real-time PCR analysis using 4 control and 7 scNT first-trimester-derived placentas (Fig. 3A). Notably, Id-2, Met, and Tef-5 expression from scNT-derived placenta was significantly down-regulated, compared to that of control, whereas Hand-1 gene expression was significantly increased in the scNT-derived tissue. However, the levels of PECAM-1, GCM-1, uPA, and Cited-1 expression in scNT-derived placentas are not significantly different from those in the control placentas. This gene expression pattern strongly correlated with the intensity of immunohistochemical staining, suggesting that the trophoblast defect in scNT clones may result from dislocalization and aberrant gene expression patterns in the cells.

thumbnail image

Figure 3. Differential expression patterns of placenta-related (A) and angiogenesis-related (B) gene in control and scNT-derived recipient placenta samples at day 30 after scNT embryo transfer by real-time RT-PCR analysis. *P < 0.05.

Download figure to PowerPoint

Down-Regulation of Angiogenic-Related Gene Expression in the scNT-Derived Early Gestational Placenta

As shown in Figure 1B–E, cloned porcine placentas at day 30 posttransfer displayed avascularization and hypovascularization of the placenta with normal fetal growth. It is generally known that endothelial cell activation is initiated by the binding of proangiogenic factors such as vascular endothelial growth factor (VEGF) to their receptors on endothelial cells; this induces angiogenic signaling in the cells (Tjwa et al.,2003). To examine scNT-associated angiogenic gene expression, we assessed the expression of VEGF, ANG-1, ANG-2, VEGFR1, VEGFRII, and TIE-2 mRNA in control and scNT placentas by real-time RT-PCR (Fig. 3B). Compared to the control, scNT-derived placentas showed significantly lower VEGF, ANG-1 and -2, MMP-9, and TIE2 mRNA expression, although VEGFRI and VEGFRII mRNA expression levels in scNT clones were significantly increased. Thus, down-regulation of VEGF and/or angiopoietin expression in the scNT-derived placenta may be implicated in pre-eclampsia, which is associated with insufficient adaptations by spiral arteries that theoretically alter haemodynamics within the intervillous space (Wulff et al.,2003). As a result, such changes could damage the syncytiotrophoblast and release factors that instigate maternal endothelial dysfunction.

Disruption of the Developing Endometrial Gland and Severe Apoptosis in scNT-Derived Uteri at Gestational Day 30

In the maternal components of the control, immunoreactive MMP-9 protein was localized to luminal epithelium (LE) (Fig. 4A) and developing endometrial glands (EG) (Fig. 4B). Unlike that of the control, MMP-9 protein in scNT-derived placenta and uteri tissues was weakly localized to LE (Fig. 4a). MCM-7 expression in control uteri was mainly localized to LE and EG (Fig. 4C), whereas MCM-7 expression in scNT clones was localized to LE (Fig. 4c). Also, a marked increase in the frequency of TUNEL-positive cells was observed in the developing scNT-derived EG (Fig. 4d, arrow). In the control, however, strong staining for apoptosis was only observed in mesenchyme or fetal macrophages and villus core fetal vessels within developing EG, but not in the developing LE (Fig. 4D). Considering that survival and elongation are directly related to the degree of glandular development (Gray et al.,2000,2001,2002; Hoffert et al.,2005; Arnold et al.,2006; Burton et al.,2007), developmental arrest during the first trimester in scNT clones may be caused by glandular dysfunction due to a hypoinvasive/hypomigratory phenotype of extravillous trophoblast cells.

thumbnail image

Figure 4. Localization of MMP-9 and MCM-7 expression and Tunnel assay in pig uteri during the first trimester. MMP-9 expression in the control was strongly localized on the luminal epithelium (LE), endometrial glandular (EG), and stroma cells (S) (A, a, B, b). Even though scNT clones mildly expressed MMP protein on the LE and EG, EG was severely disrupted (b). Also, MCM-7 expression (C) in control uteri during the first trimester was mainly localized on LE and EG (arrow), whereas MCM-7 expression in scNT clones was localized on LE (c). Developing EG in scNT clones (d) showed a marked increase of Tunnel-positive cells, whereas apoptosis in control was observed in fetal-derived cells outside or within endometrial glands (D, arrowhead). Bar = 50 μm.

Download figure to PowerPoint

Down-Regulation of MMP-9 in scNT Clones May Inhibit Trophoblast Outgrowth in Early Pregnant Uteri

Given that MMP-9 regulates trophoblast outgrowth during pregnancy (Staun-Ram and Shalev,2005; Cohen and Bischof,2007; Ferretti et al.,2007), we isolated gestational day-30 recipient uteri tissue, which contains predominantly invasive trophoblast giant cells, from littermate attachment sites. In order to assess the significance of MMP-9 expression that we observed at the RNA level, we compared MMP-2 and -9 production in uteri extracts from both scNT- and control-derived littermate attachment sites. Two major bands, 72-kDa pro-MMP-2 and 92-kDa pro-MMP-9, were detected in all scNT-derived groups. However, the expression of 66-kDa active MMP-2 and 83-kDa active MMP-9 was significantly lower in scNT-derived groups (Fig. 5). MMP-9 is a major participant during embryo implantation, degrading collagen IV, the main component of the basement membrane, and thus enabling the invasion of trophoblast cells through the decidua and into the maternal vasculature (Zhou et al.,2003). Therefore, the present study raises the possibility that low-active MMP-2 and MMP-9 expression in the littermate attachment sites of recipient uteri may have an influence in early embryonic loss and could perhaps be a prediction marker of impending embryonic mortality.

thumbnail image

Figure 5. Expression levels of MMP-9 and MMP-2 by gelatin zymography analysis in the extracts of pig control and scNT uteri collected from gestational day 30. Gelatinolytic activity was detected at Pro-MMP-2 (72 kDa), active MMP-2 (66 kDa), pro-MMP-9 (92 kDa), and active MMP-9 (83 kDa). The picture shows representative gelatin zymography obtained from 4 control and scNT uteri samples.

Download figure to PowerPoint

It is well known that the catalytic domain of uPA activates plasmin, which in turn promotes matrix degradation by activating certain matrix metalloproteases (MMPs), as well as by directly degrading certain extracellular matrix components (Isaka et al.,2003). Therefore, the mRNA levels of 2 selected genes involved in MMP-9 regulation were analyzed by quantitative real-time RT-PCR in 7 uterus samples from clone pregnancies and 4 samples from control pregnancies (Fig. 6). Notably, Met and uPA expression from scNT-derived recipient uteri samples was lower relative to that from the control. Taken together, these observations demonstrated that MMP-9 down-regulation was almost invariably accompanied by decreased transcripts of uPA, a protease implicated in the proteolytic activation of MMP-9 via the Met signal cascade.

thumbnail image

Figure 6. Expression analysis of Met and uPA mRNA by real-time RT-PCR using specific primers. Compared to control with normal fetal growth, the scNT-derived clones generally showed significant down-regulation of Met and uPA. However, some scNT clones also showed slight up-regulation of these mRNA.

Download figure to PowerPoint

Abnormal Methylation Within the MMP-9 Gene Promoter May Affect MMP-9 mRNA Down-Regulation in the scNT-Derived Pregnant Pig Uterus

To determine whether aberrant methylation of the MMP-9 gene promoter could contribute to the variation in MMP-9 expression between scNT clones, approximately 1,385 bp of the MMP-9 gene promoter region was obtained from the genomic library and deposited in GenBank (accession number DQ232893). Highly sensitive mapping of the methylated cytosine within the 5′ flanking region −485 to −1 was carried out by bisulfite modification. This subregion was chosen because it contains transcription factor–binding motifs essential for MMP-9 promoter activity, including two GC boxes for the binding of transcription factor Sp1 (designated as GC-1 and GC-2) and two AP-1 binding sites (Fig. 7A). These motifs are highly conserved throughout species (Huhtala et al.,1991; Maure et al.,1993; Sato et al.,1993; Campbell et al.,2001). Porine promoter region harbors 8 CpG sites. Interestingly, the 7th CpG site was overlapped with one of the GC boxes (GC-2), which is a candidate binding site for Sp1 transcription factor. To measure the predominance of CpG methylation, a total of 6 scNT clones and 3 controls were analyzed. scNT-derived clones showed that the 2nd, 4th, 7th, and 8th CpG sites were heavily methylated compared to control, whereas the 1st and 5th CpG sites were heavily methylated in the control group (Fig. 7B and C). To determine the significance of GC boxes in the regulation of MMP-9 gene promoter activity, 2 reporter vectors, each containing a different GC box mutation (Fig. 7D), and a control vector were transfected into NIH3T3 cells. The GC-1 site was mutated from GGGCAGGGGT to GGGAATTCT, and the GC-2 site was mutated from GGGGCGGGG to GGGGAATTCT. As shown in Figure 7D, the MMP-9 promoter construct with a mutated GC-2 site exhibited a significantly lower transcriptional activity compared to that of MMP-9 wild type or with a mutated GC-1, indicating that GC boxes are critical for MMP-9 expression and suggesting that demethylation of the MMP-9 gene promoter might play a key role in the invasion of cytotrophoblasts during early gestation.

thumbnail image

Figure 7. Methylation profile of the porcine MMP-9 gene promoter and the importance of GC boxes for transcriptional activity of the porcine MMP-9 promoter. A: Schematic description of porcine MMP-9 gene promoter sequence (GenBank accession number, DQ232893). Numbers indicate CG dinucleotides, potent candidates for CpG sites. B: Methylation profiles of porcine MMP-9 promoter of control and scNT clones. Lollipops represent all examined CG dinucleotides. Black and white circles represent methylated and unmethylated CpGs, respectively. C: Relative percentage of methylated porcine MMP-9 gene promoter between control and scNT pigs. Among CpG sites in the MMP-9 gene promoter, the 7th CpG, which contains the GC-2 box, was significantly methylated, compared to that of control. D: Effect of GC boxes in the regulation of porcine MMP-9 promoter activity. X indicates disruption of GC boxes by site-directed mutagenesis. Single (*) and double (**) asterisk indicate the statistical significance of P < 0.05 and P < 0.01, respectively.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

A total of 1,824 scNT embryos were transferred into 11 recipients. When pregnancy was determined by ultrasound visualization of fetuses between days 25 and 28 of gestation, 5 of 11 recipients had become pregnant. Only 12 cloned fetuses were recovered. Among them, 7 (58.3%) fetuses were healthy, whereas 5 (48.7%) fetuses were at an arresting state (Table 2). However, analysis of 12 scNT-derived placentas revealed that all fetuses had severe placental abnormality. An early pregnancy loss or first-trimester miscarriage in the control is the most common complication in pig reproduction, with an incidence range between 20 and 30% of all conceptions, and another 10–15% loss occurs at midgestation (Pope et al.,1982; Stroband et al.,1990; Pope,1994). Embryonic loss can be derived from the embryo and/or the uterine environment. Microarray analysis revealed a greater variation in the mRNA profiles for the scNT endometrium group than for the IVF group at as early as day 18 of pregnancy and suggested that placenta failure in bovine clone pregnancies may originate from abnormal embryo–maternal communication (Bauersachs et al.,2009). In the present study, we focused on histological and gene expression analyses of developing placentas and uteri during the first trimester.

In mice, Hand-1, Id-2, and Tef-5 expression are involved in trophoblast giant cell development (Cross,2005). During the first trimester, MMP-2 is expressed in extravillous trophoblasts, whereas MMP-9 is mainly expressed in villous cytotrophoblasts (Isaka et al.,2003). Also, uPA is a typical marker for trophoblast giant cells and spongiotrophoblasts (Cross et al.,1994; Rinkenberger et al.,1997). C-Met and GCM-1 are involved in the development of labyrinthine trophoblasts (Stella and Comoglio,1999; Cross,2005). In this study, placenta defects in scNT clones have been observed. Immunohistochemical analysis showed that cells expressing placenta-related genes Id-2, Met, Hand-1, MMP-9, and MCM-7 were significantly deranged or showed abnormal morphogenesis in scNT-cloned placentas (Fig. 2). Also, Hand-1 gene expression in gestational day-30 scNT placentas was significantly increased, while Met, Id-2, and Tef-5 expression was significantly down-regulated, although PECAM-1, Gcm-1, and Cited-1 mRNA expression was not significantly altered (Fig. 3A). Therefore, our study suggested that the trophoblast defect in scNT clones may be, in part, derived from dislocalization and aberrant gene expression patterns.

Most placentas from sheep at day 30 after scNT embryo transfer display avascularization and hypovascularization (De Sousa et al.,2001) effects that are also observed in our studies with pigs. To confirm the data, the level of angiogenic-related molecules such as VEGF, ANG-1 and -2, VEGFRI, VEGF-RII, and TIE-2 mRNA was determined in control and scNT placentas by real-time RT-PCR (Fig. 3B). Individual clones revealed a strikingly low expression in the level of VEGF, ANG-1 and -2, and TIE-2 mRNA in the placentas of scNT fetuses, whereas VEGFRI and VEGFRII mRNA were expressed at a relatively high level (Fig. 3). Also, ANG-1, a key molecule in the regulation of embryonic vascular development, binds to and activates the endothelial-specific receptor TIE-2, while ANG-2 is required for subsequent postnatal vascular remodeling (Gale et al.,2002). The variation of expression levels in the individual clones may be strongly correlated with placenta morphology, suggesting that deregulation of the VEGF system may contribute to the alterations or malformations in the placenta of pig somatic cell clones.

During early pregnancy, trophoblast invasion is closely correlated with the expression of MMPs (Staun-Ram and Shalev,2005; Cohen and Bischof,2007; Ferretti et al.,2007), which are capable of degrading the extracellular matrix. In this study, recipient uteri at day 30 after scNT-derived embryo transfer showed relatively low expression of active MMP-2 and -9. The underlying mechanisms of how scNT embryos decrease active MMP-2 and -9 expression are still unknown, mainly because the subsequent signaling pathway or methylation profile of MMP promoter genes is poorly understood. To understand these detailed processes, we first examined the methylation profile of the MMP-9 gene promoter. As shown in Figure 7, scNT-originated clones derived from littermate attachment sites exhibited a hypermethylated pattern within the porcine MMP-9 promoter region, compared to that in control (Fig. 7).

Human MMP-9 (hMMP-9) promoter contains cis-acting regulatory elements and binding sites for modulating transcription factors including AP-1 and Sp1, which play an important role in hMMP-9 promoter activity (Sato et al.,1993). In this study, two putative GC boxes for the Sp1 transcription factor–binding site were found within the proximal sites and were highly conserved in humans. Especially, the GC-2 box was a binding site for Sp1 and affects the transcriptional activity of the MMP-9 promoter (Sato et al.,1993). As shown in Figure 7, the GC-2 site was heavily methylated and the GC-2-mutated MMP-9 promoter constructs showed markedly decreased luciferase activity compared with the wild-type MMP-9 promoter, indicating that these binding sites were critical for MMP-9 expression. The GC box appeared to play a crucial role in porcine MMP-9 gene expression and was also very susceptible to methylation. However, even though sequence analysis revealed that the porcine MMP-9 promoter contained the crucial candidate-binding motifs for AP-1 and Sp1, the functional role of each regulatory element and the combined effects need to be determined. Therefore, characterization and functional analysis of AP-1 and Sp1 transcription factors should be elucidated to further understand the porcine MMP-9 gene expression mechanism.

Next, we examined the expression pattern of Met and uPA genes, which are involved in MMP-9 gene expression (Fig. 6). In the recipient uteri at day-30 postembryo transfer, Met and uPA mRNA expression in scNT clones was lower relative to that in the control. Histomorphometric analysis revealed severe disruption of EG in scNT clones. Increased levels of apoptosis were also detected in EGs derived from all scNT clones (Fig. 4). Collectively, these results support the hypothesis that early gestational death of scNT clones is caused, at least in part, by disruption of developing EG as a result of impaired trophoblast migration and invasiveness due to abnormal methylation profiles of the MMP-9 gene promoter or low expression of MMP-9 by aberrant Met-signaling cascade.

Uterine endometrial glands play a primary role in the synthesis and secretion or transportation of substances, which are termed “histotroph” including enzymes, growth factors, cytokines, lymphokines, hormones, transport proteins, and other metabolites essential for conceptus survival and development during the peri-implantation period of pregnancy. Uterine epithelial cells have a high secretory activity at the beginning of implantation and the invading trophoblast seems to have intense pinocytotic activity as the blastocyst develops. Therefore, metabolites necessary for conceptus development may be obtained from uterine histotroph synthesized and secreted from endometrial epithelial cells, which is strongly supported by the ovine uterine gland knockout model. In this model, blastocysts hatch normally but fail to survive or elongate. This peri-implantation defect in ovine uterine gland knockout ewes may be due to the absence of endometrial glands or, alternatively, to the lack of certain epithelial adhesion molecules or the inability of the endometrium to respond to signals from the conceptus (Gray et al.,2000,2001,2002; Spencer et al.,2004; Hoffert et al.,2005; Arnold et al.,2006). Moreover, the success of endometrial gland morphogenesis in neonatal pigs also determines, in part, the embryotrophic and functional capacity of the adult uterus (Bartol et al.,1993,1999; Spencer and Bazer,2010). Even though approximately 58% of scNT embryos in this study are healthy, 48% of recipient uteri at day 30 after scNT embryo transfer displayed severely damaged glands (Fig. 4). Inactivation of plasminogen/plasmin member genes such as uPA, uPA receptor, and MMP-9 does not affect the viability of these knockout mice (Cross et al.,1994; Rinkenberger et al.,1997). These data corroborate our observations that scNT fetuses derived from littermate attachment sites at day 30 posttransfer showed normal growth despite abnormal placenta development. However, there must be considerable functional redundancy in scNT fetuses because proteinase activity is crucial for implantation.

In summary, the risk factors for scNT spontaneous abortion during the first trimester have been reported: first trimester losses of more than 50% of the transferred embryos are common for scNT pregnancies in cattle, sheep, and goats (Wilmut et al.,1997; Wells et al.,1997,1999; Kato et al.1998; Baguisi et al.1999; Heyman et al.2002; Pace et al.,2002; Heyman,2005). Most of these studies, however, focused on the defects observed in the placenta during the first trimester. Correlation between scNT-pig and -nonpig species data suggested that the placenta represents a common site for pathophysiological expression of the etiologies of early pregnancy loss. Unlike nonpig species data that showed fetal retardation or outgrowth, the present study showed that pig scNT fetuses are normal during the first trimester. However, any comparison of data between pig and nonpig species should be limited until other factors, such as recipient age, gestational age, donor cell age, nuclear transfer methodology, and embryo culture system, are assessed. Collectively, our observations suggest that pig scNT clones showed species-specific modification during the first trimester and that early gestational death of scNT clones was caused by disruption of the developing endometrial gland as a result of impaired trophoblast migration and invasiveness.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

Ethics Statement

The treatment of pigs in this research was in accordance with the guidelines of National Institute of Animal Science, Rural Development Administration, Suwon, South Korea, and was approved by the committee (approval number: 2009-004, D-grade).

Isolation and Culture of Porcine Somatic Cells

One male cell line was obtained from F1 fetus derived from a dam (Yorkshire) that was inseminated by a Landrace. Cells were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) under 5% CO2 in air at 37°C. After confluence, cells were subcultured to the next passage. Donor cells were used for NT between passages 8 and 15 within three days after reaching confluence.

In Vitro Maturation of Oocytes

Ovaries were collected from prepubertal gilts at a local slaughterhouse and transported to the laboratory at 25–35°C. Antral follicles (2–6 mm in diameter) were aspirated with an 18-gauge needle. Aspirated oocytes with an evenly granulated cytoplasm and surrounded by at least three uniform layers of compact cumulus cells were selected and washed three times in TL-Hepes with 0.1% polyvinyl alcohol (PVA, Sigma, St. Louis, MO). Oocytes were cultured in four-well plates containing NCSU-23 medium (500 μL/well) supplemented with 10% porcine follicular fluid, 0.6 mmol/L cysteine, 1 mmol/L dibutyryl cyclic adenosine monophosphate (dbcAMP, Sigma), and 0.1 IU/mL human menopausal gonadotropin (hMG, Teikokuzoki, Tokyo, Japan) for 20 hr. Oocytes were further cultured without dbcAMP and hMG for another 18–24 hr, as reported previously (Yin et al.,2003; Park et al.,2005; Chae et al.,2006,2008; Cho et al.,2007; Lee et al.,2007; Hwang et al.,2009; Park et al.,2009).

Somatic Cell Nuclear Transfer (scNT)

scNT was performed as reported previously (Yin et al.,2003; Park et al.,2005; Chae et al.,2006,2008; Cho et al.,2007; Lee et al.,2007; Hwang et al.,2009; Park et al.,2009; Uhm et al.,2009). Briefly, matured eggs with a first polar body were cultured in medium supplemented with 0.05 mol/L sucrose for 1 hr. Sucrose was used to enlarge the perivitelline space of the eggs. Treated eggs were moved to medium supplemented with 5 mg/mL cytochalasin B, and metaphase II oocytes were enucleated 40–42 hr after maturation using a beveled 30 μm diameter glass pipette. A single donor cell was injected into the perivitelline space of each enucleated egg. Groups of oocytes were fused and activated with two direct current pulses of 150 V/mm for 50 μs in 0.28 mol/L mannitol supplemented with 0.1 mM MgSO4, 100 μM CaCl2, and 0.01% PVA using a BTX Electrocell Manipulator 200 (BTX, San Diego, CA). Eggs that were simultaneously activated and fused using fetal pig-derived donor cells were cultured in medium for 1 or 2 days in an atmosphere of 5% CO2 and 95% air at 39°C, followed by transfer into the oviducts of recipient gilts. In the latter case, embryos were either harvested 30 days after embryo transfer or allowed to develop to term.

Embryo Transfer and Pregnancy Determination

Gilts (Duroc × Yorkshire × Landrace) of at least eight months of age were used as recipients. Estrus synchronization of recipients was carried out as reported previously (Onishi et al.,2000; Yin et al.,2003). Somatic cell NT embryos were surgically transferred into oviducts of synchronized recipients. Artificial insemination was performed for control. The pregnancy status of recipients was determined by ultrasound between days 25 and 28, and fetuses were recovered at day 30 after post-transfer. For parentage analysis, DNA was extracted from ear punches or tail clippings of both recipient and newborn piglets, respectively, as well as donor cells. Six porcine DNA microsatellite markers (SWR1120, SWR308, SW66, SW1311, SW1327, and SW936) were used to confirm that the genetic identity of the cloned piglets was that of the donor cells used for NT. Placenta and uterus samples were obtained from 4 controls and 12 scNT-cloned fetuses. The samples were used immediately for immunohistochemistry analysis or immediately stored in liquid nitrogen until use.

Immunoblot Analysis

Eighteen-microgram pig control- and scNT-uteri extracts collected from gestational day 30 were separated by SDS-PAGE, and proteins were transferred to a PVDF membrane (Amersham Biosciences, Piscataway, NJ). Membranes were blocked in 5% nonfat milk and then incubated with MMP-2 and MMP-9 antibodies (Cell Signaling, Danvers, MA), followed by incubation with a horseradish peroxidase-conjugated secondary antibody (Jackson Immunoresearch, West Grove, PA). Immunoreactive proteins were visualized using an enhanced chemiluminescence detection kit (Amersham Biosciences, Piscataway, NJ). Band intensities of each protein expression were quantified by image processing and analysis using Image J 1.23 (NIH image).

Gelatin Zymography

Gelatin zymography was performed based on methods modified from those previously published (Heo et al.,1999). For uteri samples, a volume of supernatant containing 18 μg of protein was diluted in homogenizing buffer and mixed with an equal volume of sample buffer (80 mmol/L Tris-HCl [pH 6.8], 4% sodium dodecyl sulfate [SDS], 10% glycerol, 0.01% bromphenol blue). For electrophoresis, 10% SDS-polyacrylamide resolving gels containing 1 mg/mL gelatin were overlaid with 5% stacking gels, and samples were loaded and run at 4°C (25 mA per gel). After electrophoresis, gels were rinsed with distilled water briefly and washed three times in 150 mL of 2.5% Triton X-100 solution (15 min each) on a rotary shaker. The gels were then incubated in 250 mL of 50 mmol/L Tris-HCl (pH 7.5) containing 10 mmol/L CaCl2 and 0.02% NaN3 at 37°C for 42 hr. After incubation, gels were stained using a silver staining kit (Invitrogen, Carlsbad, CA).

Immunohistochemical Analysis

Met protooncogene (Met), heart and neural crest derivatives expressed 1 (Hand-1), inhibitor of differentiation (Id-2), urokinase plasminogen activator (uPA), matrix metalloproteinase 9 (MMP-9), matrix metalloproteinase 2 (MMP-2), and MCM-7 antibodies were purchased from Santa Cruz (Santa Cruz, CA), Cell Signaling (Danvers, MA), Chemicon (Temecula, CA), and Oncogene (Cambridge, MA). Immunohistochemical staining was conducted as previously described (Choi et al.,2004; Park et al.,2005,2009). Briefly, paraffin sections of placenta and uterus tissue were cleared in Histoclear for approximately 10 min and dehydrated in increasing concentrations of ethanol. Immunohistochemistry was performed with an ABC Kit (Oncogene Science Inc., Cambridge, MA), according to the manufacturer's instructions. Sections were placed in 3% peroxide in pure methanol and 0.1% pepsin in 0.05 N HCl (pH 2.25) for 30 min to reduce background staining. Sections were washed twice (5 min each) in TBS (0.05 M Tris-HCl, pH 7.4, and 0.85% NaCl), blocked with normal horse serum diluted in TBS (1:5; NHS-TBS), and incubated overnight with primary antibody. One drop of horse serum from the ABC Kit was used as a negative control. Excess antibody was removed by washing twice for 5 min with TBS. Biotinylated secondary IgG was added for 30 min, and sections were rinsed with three changes of TBS for 5 min. The sections were then incubated with ABC reagent for 30 min, washed extensively with TBS, and rinsed in 1% Triton-X-PBS for 30 s. The colorimetric reaction was developed with a solution of 0.5% diaminobenzidine in 0.05 M Tris-HCl (pH 7.6) containing 0.01% hydrogen peroxide. Sections were washed in water, dehydrated, and mounted with a cover slip.

TdT-Mediated dUTP-X Nicked End Labeling (TUNEL) Assay

TUNEL assays were performed as described previously (Choi et al.,2004; Park et al.,2009). Tissues fixed in 4% (w/v) paraformaldehyde in 0.01 M PBS (pH 7.4) were washed with PBS, dehydrated in ethanol (70, 90, and 100%), and embedded in paraffin wax. Each 5-μm section was rehydrated (xylene 5 min; ethanol 100%, 95%, 70%, 2 min each), washed in distilled water, incubated for 15 min with proteinase K (20 μg/mL) at room temperature, and washed with PBS (1×). Endogenous peroxidase activity was then blocked with 2% H2O2 for 5 min, after which the sections were washed three times with PBS (1×) and incubated for 60 min at 37°C in a moist chamber with TUNEL mix (0.3 U/μL calf thymus terminal deoxynucleotidyl transferase, 7 pmol/μL biotin dUTP, and 1 mM cobalt chloride in reaction buffer (1×) in distilled water). After washing (four 5-min PBS baths at RT), the sections were saturated in 2% BSA for 10 min at RT and then treated for 30 min at 37°C in a moist chamber with a 1:20 dilution of ExtraAvidin peroxidase antibody. After three PBS washes, detection was performed by using DAB [1.24 mg of DAB, 25 μL of 3% NiCl2, and 152 μL of 1 M Tris-HCl (pH 7.5) in 2 mL of distilled water]. The slides were mounted in crystal mount (Biomeda, Foster City, CA).

cDNA Cloning of Placenta-Specific Genes

[α-32P]dCTP (>3,000 Ci/mmol) was purchased from NEN (Waltham, MA). Modifying enzymes, restriction enzymes, the DNA polymerase I large fragment (Klenow fragment), DNA size markers, and a random labeling kit were from Boehringer Mannheim (Mannheim, Germany). Nitrocellulose membranes were from Millipore Corp. (Billerica, MA), and filter papers were from Whatman Inc. (Piscataway, NJ). Chloroform and methanol were from Merck (Whitehouse Station, NJ). Premix Taq polymerase was from Takara (Otsu, Shiga, Japan), and the pBluescript SK vector was from Promega (Madison, WI). A lambda mini kit and a plasmid isolation kit were from Qiagen (Valencia, CA). All molecular biological procedures, including agarose gel electrophoresis, restriction enzyme digestion, ligation, bacterial transformation, and preparation of competent cells, were performed according to standard methods (Sambrook et al.,1989).

Reverse transcriptase (RT)-PCR was performed with total RNA obtained from porcine term placenta with degenerate primers derived from regions conserved between mouse and human cDNA (Table 1). MuMLV reverse transcriptase was used for the first strand cDNA synthesis after priming with the downstream primer. The second strand cDNA synthesis and subsequent PCR amplification were carried out with Taq polymerase (Gibco BRL, Carlsbad, CA). Amplified DNA was cloned into the pGEM T-easy vector. DNA amplified by degenerate RT-PCR was labeled with [α-32P]dCTP using a random labeling kit according to the manufacturer's instruction. Briefly, 50 ng of DNA was denatured by boiling for 3 min and then cooled on ice. α-32P-labeled DNA was synthesized by the Klenow fragment in a reaction buffer containing random primer, dNTPs, and [α-32P]dCTP (3,000 Ci/mmol) for 1 hr at 37°C, and was purified using a Sephadex G-50 column as described previously (Sambrook et al.,1989). A porcine cDNA library was constructed in the lambda FixII phage vector (Stratagene, Foster City, CA). Membranes containing DNAs were hybridized with labeled probe DNAs (5 × 107 cpm) for 18 hr at 68°C, and then washed twice in 2× SSC containing 0.1% SDS at 65°C. After three rounds of screening, each positive clone was selected and analyzed. DNA of positive clones was purified using the Qiagen lambda mini kit.

RNA Isolation and Real-Time RT-PCR

Total RNA was extracted from placentas and uteri by using a Micro-to-Midi Total RNA Purification System (Life Technologies Inc., Rockville, MD). Real-time RT-PCR was performed as described previously (Choi et al.,2004) by using the Taqman model 7700 sequence Detector (ABI, Perkin-Elmer, Waltham, MA). The porcine gene expression levels were normalized to GAPDH gene expression, which was unaffected in the scNT-derived pigs. The RT-PCR primer sets used for this study are shown in Table 1.

Cloning and Sequence Analysis of MMP-9 Gene Promoter, Bisulfite Treatment, PCR Amplification, and Methylation Pattern Analysis

Approximately 1.3 kb of the pig MMP-9 gene promoter was isolated from a pig Lambda Fix II genomic library (Stratagene), as described in our previous report (Kwon et al.,2006). The nucleotide sequence of DNA templates was determined using the fluorescent dideoxy terminator method on an ABI automated sequencer (ABI377 DNA sequencer, Applied Biosystems, Foster City, CA) according to the manufacturer's protocols. Comparative sequence analysis was performed using BLAST (Altschul et al.,1990), SMART (Schultz et al.,1998), PROSITE (Bairoch and Bucher,1994), NetOGlyc2.0 (Hansen et al.,1998), and PipMaker (Schwartz et al.,2000) programs. Promoter sequence analysis was performed using TFsearch (http://www.cbrc.jp/research/db/TFSEARCH.html) and rVista 2.0 (http://rvista.dcode.org/). The sequence of MMP-9 gene promoter used for this study was deposited in GenBank (accession number DQ232893).

Control and scNT-derived tissues were homogenized and lysed in buffer containing 0.5% SDS, 0.1 M EDTA, 10 mM Tris-Cl (pH 8.0) and 100 ng/mL proteinase K, and then incubated at 55°C for 16 hr. Genomic DNA was purified by phenol/chloroform extraction and digested with BamHI overnight at 37°C prior to denaturation with 0.3 M NaOH. Volumes of 234 μL of 5 M sodium bisulfate (pH 5) and 13.5 μL of 10 mM hydroquinone were added to digested DNA to convert unmethylated cytosines to uracils, and the mixtures were incubated at 55°C for 16 hr. Converted genomic DNA was recovered with a PCR purification kit (Qiagen, Valencia, CA). To remove sulfate, 3 N NaOH was added to the eluted DNA to a final concentration of 0.3 N. Following ethanol precipitation, genomic DNA was resuspended in 35 μL of distilled water. Amplification was performed in a 20-μL reaction mixture containing 2 μL of bisulfate-treated genomic DNA for 40 cycles. The primer set used is shown as follows: forward, 5′-GGGATTATTAGGTTTAGAAAGAGG-3′, and reverse, 5′- CATTACCCACC AACATACCCTA-3′. Amplified products were cloned into a pGEM-T easy vector (Promega, Madison, WI). Individual clones were sequenced using an automatic sequence (ABI PRISM 377).

Construction of Pig MMP-9 Promoter–Reporter Vector

Approximately 485 bp of pig MMP-9 gene promoter region was amplified by PCR from pig genomic DNA and cloned into the multiple cloning sites of the pGL3-basic reporter plasmid (Promega, Madison, WI). Site-directed mutagenesis was performed to disrupt two putative GC boxes using the “QuickChange” method (Stratagene, La Jolla, CA). The primers used to generate mutations in GC-1 and GC-2 sequences (mutant bases are shown in lowercase) are as follows: 5′-CGGC AATGGGGACTGTGGGaAttcTGGGG GGAAAAGGAG-3′ (mutant GC-1) and 5′-CCTGGCGGGGAGGGGaattc TCACTGATTCAGTGACAGT-3′ (mutant GC-2). All constructs were confirmed by DNA sequencing.

Transient Transfection and Luciferase Analysis

For reporter assays, cells were transiently co-transfected with one of the pig MMP-9 promoter–luciferase constructs described above and pRL-SV40 (Renilla luciferase, Promega) using Effectene (Qiagen). Briefly, NIH3T3 cells were plated at a density of 2 × 105 cells per 35-mm dish in DME medium or McCoy's 5A containing 10% FBS. Transient transfections were performed according to the manufacturer's instructions. At 48 hr posttransfection, cell extracts were prepared with 1× lysis buffer, and then 20-μL aliquots of the supernatant were mixed with 100 μL of firefly luciferase assay reagent (Promega) and analyzed on a Microplate Luminometer (Perkin Elmer, Melville, NY). Firefly luciferase activity was normalized to Renilla luciferase (pRL-SV40) activity as an internal control. All transfection experiments were repeated at least three times with different plasmid preparations.

Data Analysis

All experimental data are presented as means ± SD. Each experiment was performed at least three times and subjected to statistical analysis. Gene expression analyses were tested using t-test. Promoter activity was analyzed by one-way ANOVA and confirmed by Duncan's multiple range procedure. A P value below 0.05 was considered significant.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES

This work was partially supported by a BioGreen21 grant (PJ007189 and PJ007065) from the RDA, Republic of Korea. We thank Dr. Patrick Hughes (Bioedit) for assistance with manuscript preparation.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. Acknowledgements
  8. REFERENCES
  • Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215: 403410.
  • Arnold DR, Bordignon V, Lefebvre R, Murphy BD, Smith LC. 2006. Somatic cell nuclear transfer alters peri-implantation trophoblast differentiation in bovine embryos. Reproduction 132: 279290.
  • Baguisi A, Behboodi E, Melican DT, Pollock JS, Destrempes MM, Cammuso C, Williams JL, Nims SD, Porter CA, Midura P, Palacios MJ, Ayres SL, Denniston RS, Hayes ML, Ziomek CA, Meade HM, Godke RA, Gavin WG, Overstrom EW, Echelard Y. 1999. Production of goats by somatic cell nuclear transfer. Nat Biotechnol 17: 456461.
  • Bairoch A, Bucher P. 1994. PROSITE: recent developments. Nucleic Acids Res 22: 35833589.
  • Bartol FF, Wiley AA, Spencer TE, Vallet JL, Christenson RK. 1993. Early uterine development in pigs. Reprod Fertil 48( Suppl): 99116.
  • Bartol FF, Wiley AA, Floyd JG, Ott TL, Bazer FW, Gray CA, Spencer TE. 1999. Uterine differentiation as a foundation for subsequent fertility. J Reprod Fertil 54( Suppl): 287302.
  • Bauersachs S, Ulbrich SE, Zakhartchenko V, Minten M, Reichenbach M, Reichenbach HD, Blum H, Spencer TE, Wolf E. 2009. The endometrium responds differently to cloned versus fertilized embryos. Proc Natl Acad Sci USA 106: 56815686.
  • Burton GJ, Jauniaux E, Charnock-Jones DS. 2007. Human early placental development: potential roles of the endometrial glands. Placenta 28 Suppl A: S6469.
  • Campagne DM. 2006. Should fertilization treatment start with reducing stress? Hum Reprod 21: 16511658.
  • Campbell SE, Nasir L, Argyle DJ, Bennett D. 2001. Molecular cloning and characterization of canine metalloproteinase-9 gene promoter. Gene 273: 8187.
  • Chae JI, Cho SK, Seo JW, Yoon TS, Lee KS, Kim JH, Lee KK, Han YM, Yu K. 2006. Proteomic analysis of the extraembryonic tissue from cloned porcine embryos. Mol Cell Proteomics 5: 15591566.
  • Chae JI, Yu K, Cho SK, Kim JH, Koo DB, Lee KK, Han YM. 2008. Aberrant expression of developmentally important signaling molecules in cloned porcine extraembryonic tissues. Proteomics 8: 27242734.
  • Cho SK, Kim JH, Park JY, Choi YJ, Bang JI, Hwang KC, Cho EJ, Sohn SH, Uhm SJ, Koo DB, Lee KK, Kim T, Kim JH. 2007. Serial cloning of pigs by somatic cell nuclear transfer: restoration of phenotypic normality during serial cloning. Dev Dyn 236: 33693382.
  • Choi YJ, Ok DW, Kwon DN, Chung JI, Kim HC, Yeo SM, Kim T, Seo HG, Kim JH. 2004. Murine male germ cell apoptosis induced by busulfan treatment correlates with loss of c-kit-expression in a Fas/FasL- and p53-independent manner. FEBS Lett 575: 4151.
  • Cohen M, Bischof P. 2007. Factors regulating trophoblast invasion. Gynecol Obstet Invest 64: 126130.
  • Cross JC. 2005. How to make a placenta: mechanisms of trophoblast cell differentiation in mice-a review. Plaecnta 26( Suppl A): S39.
  • Cross JC, Werb Z, Fisher SJ. 1994. Implantation and the placenta: key pieces of the development puzzle. Science 266: 15081518.
  • De Sousa PA, King T, Harkness L, Young LE, Walker SK, Wilmut I. 2001. Evaluation of gestational deficiencies in cloned sheep fetuses and placentae. Biol Reprod 65: 2330.
  • Dean W, Santos F, Stojkovic M, Zakhartchenko V, Walter J, Wolf E, Reik W. 2001. Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc Natl Acad Sci USA 98: 1373413738.
  • Eugster A, Vingerhoets AJ, van Heck GL, Merkus JM. 2004. The effect of episodic anxiety on an in vitro fertilization and intracytoplasmic sperm injection treatment outcome: a pilot study. J Psychosom Obstet Gynaecol 25: 5765.
  • Ferretti C, Bruni L, Dangles-Marie V, Pecking AP, Bellet D. 2007. Molecular circuits shared by placental and cancer cells, and their implications in the proliferative, invasive and migratory capacities of trophoblasts. Hum Reprod Update 13: 121141.
  • Gale NW, Thurston G, Hackett SF, Renard R, Wang Q, McClain J, Martin C, Witte C, Witte MH, Jackson D, Suri C, Campochiaro PA, Wiegand SJ, Yancopoulos GD. 2002. Angiopoietin-2 is required for postnatal angiogenesis and lymphatic patterning, and only the latter role is rescued by angiopoietin-1. Dev Cell 3: 411423.
  • Geisert RD, Schmitt RAM. 2001. Early embryonic survival in pig: can it be improved? J Anim Sci 80( E. Suppl. 1): E5465.
  • Geisert RD, Yelich JV. 1997. Regulation of conceptus development and attachment in pigs. J Reprod Fertil Suppl 52: 133149.
  • Geisert RD, Brookbank JW, Roberts RM, Bazer FW. 1982. Establishment of pregnancy in the pig: II. Cellular remodeling of the porcine blastocyst during elongation on day 12 of pregnancy. Biol Reprod 27: 941955.
  • Gray CA, Bartol FF, Taylor KM, Wiley AA, Ramsey WS, Ott TL, Bazer FW, Spencer TE. 2000. Ovine uterine gland knock-out model: Effects of gland ablation on the estrous cycle. Biol Reprod 62: 448456.
  • Gray CA, Bartol FF, Tarleton BJ, Wiley AA, Johnson GA, Bazer FW, Spencer TE. 2001. Developmental biology of uterine glands. Biol Reprod 65: 13111323.
  • Gray C A, Burghardt RC, Johnson GA, Bazer FW, Spencer TE. 2002. Evidence that an absence of endometrial gland secretions in uterine gland knockout (UGKO) ewes compromises conceptus survival and elongation. Reproduction 124: 289300.
  • Hansen JE, Lund O, Tolstrup N, Gooley AA, Williams KL, Brunak S. 1998. NetOglyc: prediction of mucin type O-glycosylation sites based on sequence context and surface accessibility. Glycoconj J 15: 115130.
  • Heo JH, Lucero J, Abumiya T, Koziol JA, Copeland BR, del Zoppo GJ. 1999. Matrix metalloproteinases increase very early during experimental focal cerebral ischemia. J Cereb Blood Flow Metab 19: 624633.
  • Heyman Y. 2005. Nuclear transfer: a new tool for reproductive biotechnology in cattle. Reprod Nutr Dev 45: 353361.
  • Heyman Y, Chavatte-Palmer P, LeBourhis D, Camous S, Vignon X, Renard JP. 2002. Frequency and occurrence of late-gestation losses from cattle cloned embryos. Biol Reprod 66: 613.
  • Hiendleder S, Mund C, Reichenbach HD, Wenigerkind H, Brem G, Zakhartchenko V, Lyko F, Wolf E. 2004. Tissue-specific elevated genomic cytosine methylation levels are associated with an overgrowth phenotype of bovine fetuses derived by in vitro techniques. Biol Reprod 71: 217223.
  • Hoffert KA, Batchelder CA, Bertolini M, Moyer AL, Famula TR, Anderson DL, Anderson GB. 2005. Measures of maternal-fetal interaction in day-30 bovine pregnancies derived from nuclear transfer. Cloning Stem Cells 7: 289305.
  • Huhtala P, Tuuttila A, Chow LT, Lohi J, Keski-Oja J, Tryggvason K. 1991. Complete structure of the human gene for 92-kDa type IV collagenase. Divergent regulation of expression for the 92- and 72 kilodalton enzyme genes in HT-1080 cells. J Biol Chem 266: 1648516490.
  • Hwang KC, Cho SK, Lee SH, Kwon DN, Choi YJ, Park C, Kim JH, Hwang S, Park SB, Kim JH. 2009. Depigmentation of skin and hair color in the somatic cell cloned pig. Dev Dyn 238: 17011708.
  • Inagaki J, Kondo A, Loppez LR, Shoenfelld Y, Matsuura E. 2005. Pregnancy loss and endometriosis: pathogenic role of anti-laminin-1 autoantibodies. Ann NY Acad Sci 1051: 174184.
  • Isaka K, Usuda S, Ito H, Sagawa Y, Nakamura H, Nishi H, Suzuki Y, Li YF, Takayama M. 2003. Expression and activity of matrix metalloproteinase 2 and 9 in human trophoblasts. Placenta 24: 5364.
  • Kato Y, Tani T, Sotomaru Y, Kurokawa K, Kato J, Doguchi H, Yasue H, Tsunoda Y. 1998. Eight calves cloned from somatic cells of a single adult. Science 282: 20952098.
  • Kwon DN, Choi YJ, Park JY, Cho SK, Kim MO, Lee HT, Kim JH. 2006. Cloning and molecular dissection of the 8.8 kb pig uroplakin II promoter using transgenic mice and RT4 cells. J Cell Biochem 99: 462477.
  • Lai L, Kolber-Simonds D, Park KW, Cheong HT, Greenstein JL, Im GS, Samuel M, Bonk A, Rieke A, Day BN, Murphy CN, Carter DB, Hawley RJ, Prather RS. 2002. Production of alpha-1,3-galactosyltransferase knockout pigs by nuclear transfer cloning. Science 295: 10891092.
  • Lee RS, Peterson AJ, Donnison MJ, Ravelich S, Ledgard AM, Li N, Oliver JE, Miller AL, Tucker FC, Breier B, Wells DN. 2004. Cloned cattle fetuses with the same nuclear genetics are more variable than contemporary half-siblings resulting from artificial insemination and exhibit fetal and placental growth deregulation even in the first trimester. Biol Reprod 70: 111.
  • Lee SY, Park JY, Choi YJ, Cho SK, Ahn JD, Kwon DN, Hwang KC, Kang SJ, Paik SS, Seo HG, Lee HT, Kim JH. 2007. Comparative proteomic analysis associated with term placental insufficiency in cloned pig. Proteomics 7: 13031315.
  • Lucy MC. 2001. Reproductive loss in high-producing dairy cattle where will it end. J Dairy Sci 84: 12771293.
  • Maure S, Nys G, Fiten P, Van Damme J, Opdenakker G. 1993. Mouse gelatinase B. cDNA cloning, regulation of expression and glycosylation in WEHI-3 macrophages and gene organisation. Eur J Biochem 218: 129141.
  • Onishi A, Iwamoto M, Akita T, Mikawa S, Takeda T, Awata T, Hanada H, Perry AC. 2000. Pig cloning by microinjection of fetal fibroblast nuclei. Science 289: 11881190.
  • Pace MM, Augenstein ML, Betthauser JM, Childs LA, Eilertsen KJ, Enos JM, Forsberg EJ, Golueke PJ, Graber DF, Kemper JC, Koppang RW, Lange G, Lesmeister TL, Mallon KS, Misica PM, Pfister-Genskow M, Strelchenko NS, Voelker GR, Watt SR, Bishop MD. 2002. Ontogeny of cloned cattle to lactation. Biol Reprod 67: 334339.
  • Park JY, Kim JH, Choi YJ, Hwang KC, Cho SK, Park HH, Paik SS, Kim T, Park C, Lee HT, Seo HG, Park SB, Hwang S, Kim JH. 2009. Comparative proteomic analysis of malformed umbilical cords from somatic cell nuclear transfer-derived piglets: implications for early postnatal death. BMC Genomics 10: 511.
  • Park MR, Cho SK, Lee SY, Choi YJ, Park JY, Kwon DN, Son WJ, Paik SS, Kim T, Han YM, Kim JH. 2005. A rare and often unrecognized cerebromeningitis and hemodynamic disorder: a major cause of sudden death in somatic cell cloned piglets. Proteomics 5: 19281939.
  • Parker RL, Dadmanesh F, Young RH, Clement PB. 2004. Polypoid endometriosis: a clinicopathologic analysis of 24 cases and a review of the literature. Am J Surg Pathol 28: 285297.
  • Pope WF. 1994. Embryonic mortality in swine. In: ZavyMT, GeisertRD, editors. Embryonic mortality in domestic species. Boca Raton, CRC Press. p 5378.
  • Pope WF, First NL. 1985. Factors affecting the survival of pig embryos. Theriogenology 54: 3545.
  • Pope WF, Maurer RR, Stormashak F. 1982. Intrauterine migration of the porcine embryo: influence of estradiol-17 beta and histamine. Biol Reprod 27: 575579.
  • Rinkenberger JL, Cross JC, Werb Z. 1997. Molecular genetics of implantation in the mouse. Dev Genet 21: 620.
  • Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
  • Santos F, Zakhartchenko V, Stojkovic M, Peters A, Jenuwein T, Wolf E, Reik W, Dean W. 2003. Epigenetic marking correlates with developmental potential in cloned bovine preimplantation embryos. Curr Biol 13: 11161121.
  • Sato H, Kita M, Seiki M. 1993. v-Src activates the expression of 92-kDa type IV collagenase gene through the AP-1 site and the GT box homologous to retinoblastoma control elements. A mechanism regulating gene expression independent of that by inflammatory cytokines. J Biol Chem 268: 2346023468.
  • Schnieke AE, Kind AJ, Ritchie WA, Mycock K, Scott AR, Ritchie M, Wilmut I, Colman A, Campbell KH. 1997. Human factor IX transgenic sheep produced by transfer of nuclei from transfected fetal fibroblasts. Science 278: 21302133.
  • Schwartz S, Zhang Z, Frazer KA, Smit A, Riemer C, Bouck J, Gibbs R, Hardison R, Miller W. 2000. PipMaker-a web server for aligning two genomic DNA sequences. Genome Res 10: 577586.
  • Shi W, Zakhartchenko V, Wolf E. 2003. Epigenetic reprogramming in mammalian nuclear transfer. Differentiation 71: 91113.
  • Schultz J, Milpetz F, Bork P, Ponting CP. 1998. SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci USA 95: 58575864.
  • Spencer TE, Bazer FW. 2010. Uterine and placental factors regulating conceptus growth in domestic animals. J Anim Sci( E-Suppl): E4E13.
  • Spencer TE, Johnson GA, Bazer FW, Burghardt RC. 2004. Implantation mechanisms: insights from the sheep. Reproduction 128: 657668.
  • Staun-Ram E, Shalev E. 2005. Human trophoblast function during the implantation process. Reprod Biol Endocrinol 3: 56.
  • Stella MC, Comoglio PM. 1999. HGF: a multifunctional growth factor controlling cell scattering. Int J Biochem Cell Biol 31: 13571362.
  • Stroband HW, Van der Lende T. 1990. Embryonic and uterine development during early pregnancy in pigs. J Reprod Fertil Suppl 40: 261277.
  • Tjwa M, Luttun A, Autiero M, Carmeliet P. 2003. VEGF and PIGF: two pleiotropic growth factors with distinct roles in development and homeostasis. Cell Tissue Res 314: 514.
  • Uhm SJ, Gupta MK, Chung HJ, Kim JH, Park C, Lee HT. 2009. Relationship between developmental ability and cell number of day 2 porcine embryos produced by parthenogenesis or somatic cell nuclear transfer. Asian-Aust J Anim Sci 22: 483491.
  • Wells DN, Misica PM, Day TA, Tervit HR. 1997. Production of cloned lambs from an established embryonic cell line: a comparison between in vivo- and in vitro-matured cytoplasts. Biol Reprod 57: 385393.
  • Wells DN, Misica PM, Tervit HR. 1999. Production of cloned calves following nuclear transfer with cultured adult mural granulosa cells. Biol Reprod 60: 9961005.
  • Wilmut I, Paterson L. 2003. Somatic cell nuclear transfer. Oncol Res 13: 303307.
  • Wilmut I, Schnieke AE, McWhir J, Kind AJ, Campbell KH. 1997. Viable offspring derived from fetal and adult mammalian cells. Nature 385: 810813.
  • Wulff C, Weigand M, Kreienberg R, Fraser HM. 2003. Angiogenesis during primate placentation in health and disease. Reproduction 126: 569577.
  • Yin XJ, Cho SK, Park MR, Im YJ, Park JJ, Bhak JS, Kwon DN, Jun SH, Kim NH, Kim JH. 2003. Nuclear remodeling and the developmental potential of nuclear transferred porcine oocytes under delayed-activated conditions. Zygote 11: 167174.
  • Zhou Y, Genbacev O, Fisher SJ. 2003. The human placenta remodels the uterus by using a combination of molecules that govern vasculogenesis or leukocyte extravasation. Ann N Y Acad Sci 995: 7383.