SEARCH

SEARCH BY CITATION

Keywords:

  • chondrocyte;
  • growth plate;
  • reporter mice;
  • Col2α1;
  • GFP

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

We report the generation of a new mouse strain harboring a Col2-pd2EGFP reporter transgene; pd2EGFP has a much shorter half-life than EGFP, making it a near real-time reporter for Col2α1 expression in vivo and in vitro. In the post-natal growth plate, pd2EGFP fluorescence was expressed in almost all proliferative chondrocytes and in some hypertrophic chondrocytes based on localization with type X collagen. In articular cartilage, pd2EGFP fluorescence diminished over time, nicely illustrating the decrease of type II collagen synthesis in articular chondrocytes during growth. Monolayers of FACS-sorted chondrocytes from P1-2 mice showed faster loss of pd2EGFP compared to EGFP, reflecting rapid chondrocyte de-differentiation. High-density culture of FACS-pd2EGFP- growth plate chondrocytes revealed the typical temporal expression pattern in which type II collagen preceded type X collagen matrix deposition. The Col2-pd2EGFP reporter mouse will be a valuable tool for studies of growth plate chondrocyte biology. Developmental Dynamics 240:663–673, 2011. © 2011 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Transgenic mouse technology is a powerful tool to study the dynamic gene expression during developmental skeletogenesis and bone growth. Among those, models expressing an inducible gene in relation to a tissue-specific promoter, like the tamoxifen-regulated CreERT lines, have enabled lineage- and fate-mapping studies in mice (Nakamura et al.,2006). Enhanced Green Fluorescent Protein (EGFP) has also been proven to be a valuable reporter for mapping gene expression in vivo in a wide range of physiologic and pathologic settings. We reported the generation and use of a reporter mouse strain harboring a Col2-EGFP transgene driven by the well-characterized 6.3-kb murine Collagen 2α1 (Col2α1) promoter/enhancer (Zhou et al.,1995; Grant et al.,2000). Detection of reporter fluorescence coincided well with the distribution of endogenous Col2α1 transcripts observed by in situ hybridization as well as with the distribution of lacZ staining in a Col2a1-βgal transgenic mouse strain carrying the fusion gene Col2a1-β-galactosidase in which the same promoter/enhancer was employed (Cheah et al.,1991; Metsaranta et al.,1995). The Col2-EGFP transgenic mouse has been useful to visualize Col2α1 expression, as a reporter for chondrocyte differentiation and as a fluorescent label for isolating chondrocytes by fluorescence activated cell sorting (FACS) (Cho et al.,2001; Hoffman et al.,2006).

One of our original goals in generating the Col2-EGFP reporter mouse was to develop a live-cell fluorescent marker that would distinguish proliferating chondrocytes from terminally differentiated hypertrophic chondrocytes in the growth plate. The former cells express high levels of Col2α1, whereas Col2α1 expression is reported to diminish progressively during terminal differentiation (Zhao et al.,1997; Tchetina et al.,2003). A precise marker of Col2α1 expression could provide insight into temporal events of endochondral ossification and how these events were altered by mutations known to disrupt bone growth. However, imaging of long bone growth-plates from late embryo and young postnatal Col2-EGFP reporter mice revealed EGFP fluorescence throughout the growth plate including most of the hypertrophic chondrocytes. We attributed this observation to the recognized long half-life, estimated to be 24 hr or longer, of EGFP protein, i.e., the EGFP protein often was present even after the cells in which it was synthesized had terminally differentiated (Li et al.,1998; Corish and Tyler-Smith,1999).

To circumvent this problem, we generated another strain of Col2α1 transgenic reporter mice in which EGFP was replaced by pd2EGFP, which encodes a destabilized form of EGFP with a half-life of 1–2 hr. The Col2-pd2EGFP transgene contains the same Col2α1 promoter/enhancer as was used to drive original EGFP. Here we describe GFP fluorescence patterns of late embryonic, newborn, and early postnatal skeletal growth plates from mice harboring the Col2-pd2EGFP. We compare the retention of EGFP/pd2EGFP fluorescence of chondrocytes isolated from Col2-EGFP and Col2-pd2EGFP mice and cultured under conditions that promote or prevent dedifferentiation. Furthermore, we employ late postnatal Col2-pd2EGFP mice to study and specifically characterize primary murine growth plate chondrocytes. The Col2-pd2EGFP strain has a different GFP expression pattern compared to the Col2-EGFP strain, reflecting the real-time character of the pd2EGFP. We believe the Col2-pd2EGFP reporter mice will serve as a useful tool for investigating growth-plate biology in a variety of scenarios.

RESULTS AND DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

The Col2-pd2EGFP reporter mouse strain differs from the original Col2-EGFP mouse strain primarily because the pd2EGFP reporter protein has a much shorter half-life than conventional EGFP, 1–2 hr versus 24 hr or longer. Consequently, its fluorescence more accurately reflects the real-time expression of Col2α1 and can be used as such to visualize chondrocyte differentiation in various experimental settings.

In Vivo Expression Patterns of pd2GFP in Col2-pd2EGFP Reporter Mice

In late embryonic mouse tissues and in early post-natal life, confocal microscopy of EGFP/pd2EGFP fluorescence in bones of P1-P2 mice from both strains showed intracellular fluorescence throughout the epiphyseal and growth plate cartilage (Figs. 1 and 2). Bone trabeculae typically exhibited moderate nonspecific fluorescence, which did not interfere with imaging of the intracellular fluorescence of the chondrocytes but made it difficult to evaluate the intracellular fluorescence of the osteoblasts in the primary spongiosum. EGFP fluorescence was detected in almost all proliferative chondrocytes and in many pre-hypertrophic and hypertrophic chondrocytes in the Col2-EGFP mice (Figs. 1 and 2). In contrast, pd2EGFP fluorescence was restricted primarily to the proliferative chondrocytes and some hypertrophic chondrocytes in the Col2-pd2EGFP mice (Figs. 1 and 2) based on immunostaining for type X collagen, a matrix protein marker specific for the hypertrophic zone, and in situ hybridization for Col10α1 (Fig. 1). In line with these findings, few hypertrophic chondrocytes have been reported to display Cre-activity even 6 hr after tamoxifen injection and harversting of the embryos from tamoxifen-regulated CreERT line (Nakamura et al.,2006; Hilton et al.,2007). Furthermore, the pd2EGFP fluorescence more closely resembled the gene expression pattern of col2α1 as determined by the aid of in situ hybridization (Fig. 1). The pd2EGFP fluorescence pattern did not differ between heterozygote and homozygote mice (data not shown) and, therefore, we further describe only the homozygote Col2-pd2EGFP mice here.

thumbnail image

Figure 1. A: Confocal microscopy of stitched composite of the proximal radius of E15.5-old Col2-EGFP and Col2-pd2EGFP reporter mice. The hypertrophic zone (HZ) is defined by type X collagen localization (red) and nuclei were counterstained with TOPRO-3 iodide (blue). Almost all of the flattened proliferative and hypertrophic cells show fluorescence in the Col2-EGFP developing limb, whereas many of the equivalent cells in the Col2-pd2EGFP growth plate do not show fluorescence. B: In situ hybridization with probes for Col2α1 and Col10α1 in Col2-(pd2)EGFP reporter mice of the same age confirm the differentiation stage of the chondrocytes. Col2α1 is expressed also in some hypertrophic chondrocytes (arrows) and the pattern of expression is similar to the fluorescence pattern of the Col2-pd2EGFP reporter mice of the same age.

Download figure to PowerPoint

thumbnail image

Figure 2. Confocal microscopy of composite of the proximal tibia growth plates from 2-day-old Col2-EGFP (left) and Col2-pd2EGFP (right) reporter mice. The hypertrophic zone (HZ) is defined by type 10 collagen localization (red) and nuclei were counterstained with TOPRO-3 iodide (blue). Almost all of the proliferative cells of the epiphyseal cartilage (Ep) and the proliferative zone (PZ) and many of the cells in the hypertrophic zone show fluorescence in the Col2-EGFP growth plate, whereas many of the equivalent cells in the Col2-pd2EGFP growth plate do not show fluorescence. A few cells in the hypertrophic zone show fluorescence in the pd2EGFP growth plate (open white arrowheads). Bar = 100 μm.

Download figure to PowerPoint

During later postnatal skeletal growth, i.e., 1–6 weeks of age, pd2EGFP fluorescence in the growth plate was evaluated along with immunostaining for type X collagen. As with the embryonic and newborn pups, there was strong pd2EGFP fluorescence in the proliferative chondrocytes and in the ossification groove of Ranvier but not in the perichondrial ring of LaCroix (Fig. 3) or periosteum. However, it was also detected in a number of hypertrophic cells at both 2 and 6 weeks of age. Immunostaining for type X collagen and in situ hybridization with probes for Col2α1 and Col10α1 (data not shown) confirmed that pd2EGFP+ cells reside in the hypertrophic zone and pd2EGFP expression corresponds with gene expression of Col2α1 also in postnatal tissues (Fig. 3). This observation raises the possibility that a few terminally differentiating growth plate chondrocytes may re-initiate or most likely may never cease expressing Col2α1 as usually assumed. The latter is further substantiated by the presence of the Col2α1 signal in in situ hybridization of both embryonic and postnatal tissues within the hypertrophic chondrocytes (Figs. 1 and 3). It is also conceivable that a few isolated chondrocytes fail to terminally differentiate within the growth plate. In line with this finding, COL2A1 transcripts have also been demonstrated in human hypertrophic chondrocytes (Sandberg and Vuorio,1987) and to co-localize with transcripts for COL10A1 in chicken and human hypertrophic chondrocytes (Iyama et al.,1994; Reichenberger et al.,1991). However, in growth plates from the 2-week-old mice, which are thicker than in the 6-week-old mice, very little fluorescence was detected in the prehypertrophic zone arguing against continuous expression of Col2α1 during progression from proliferative to hypertrophic chondrocytes. These observations are novel and merit further investigation, but this is beyond the scope of this brief technical report.

thumbnail image

Figure 3. Confocal microscopy of the growth plate of Col2-pd2EGFP reporter mice at 2 and 6 weeks of age displayed against transmitted light images (TLI); the secondary ossification center (OC) is indicated. The top panel (2 weeks) is a composite. As expected, growth plate thickness decreases with age. The reserve zone (RZ) chondrocytes do not exhibit pd2EGFP fluorescence or signal for Col2α1 by in situ hybridization. Note that pd2EGFP fluorescence is present in the proliferative zone (PZ), in some hypertrophic chondrocytes, and in the ossification groove of Ranvier (A; bottom panel) but not in cells in the prehypertrophic zone (PHZ) and the perichondrial ring of LaCroix (B; bottom panel). The expression pattern of pd2EGFP fluorescence resembles that of in situ hybridization with probe for Col2α1 (arrows; bottom panel). The hypertrophic zone (HZ) is defined by type X collagen localization (red) and nuclei were counterstained with TOPRO-3 iodide (blue).

Download figure to PowerPoint

Confocal microscopy of the Col2-pd2EGFP strain revealed a distinct pattern of fluorescence in articular cartilage. In line with conventional fluorescence microscopy observations (data not shown), in the period of 1–4 weeks of age the intensity of pd2EGFP fluorescence diminished with time and articular chondrocytes were “negative” for pd2EGFP fluorescence by 3 weeks of age (Fig. 4). In situ hybridization with a probe for Col2α1 revealed a specific signal in the articular cartilage, even in the 4-week-old mice. However, it should be noted that in situ hybridization is a very sensitive but not a quantitative technique and that the settings for confocal microscopy were set to optimally visualize the fluorescence pattern within the growth plate while diminishing the background fluorescence from trabecular bone. This indicates that compared to growth plate chondrocytes, articular chondrocytes exhibit a relatively low intensity fluorescence and were regarded as “negative” by 4 weeks of age. This decrease in pd2EGFP fluorescence expression in the articular cartilage illustrates the decrease of Col2α1 synthesis in articular chondrocytes during growth (Eyre,2002). It has been suggested that articular chondrocytes attempt to repair damage to the articular surface in early osteoarthritis accompanied by an accelerated Col2α1 production (Eyre et al.,2006) and that this process might be stimulated therapeutically as a treatment strategy for this condition (Aigner et al.,1999). Therefore, the Col2-pd2EGFP reporter mice could potentially be utilized to monitor such therapies in mouse models of osteoarthritis and other joint diseases.

thumbnail image

Figure 4. Confocal microscopy of the knee joint from 1 through 4-week-old Col2-pd2EGFP reporter mice. Top: Transmitted light images (TLI). Bottom: GFP fluorescence. All articular chondrocytes, as well as the fibrochondrocytes of the meniscus (m), show fluorescence at 1 week of age, and do not display pd2EGFP fluorescence by 3 weeks of age. Note that the settings for confocal imaging have been set to be optimal for visualization of the fluorescence within the growth plate (Figs. 1–3), minimizing background fluorescence from bone.

Download figure to PowerPoint

Differentiated EGFP/pd2EGFP+ Chondrocyte Phenotype In Vitro

We have previously reported that EGFP fluorescence can be utilized for FACS harvesting of chondrocytes and as a means to monitor expression of the differentiated chondrocyte phenotype in vitro (Grant et al.,2000). Given its much shorter half-life compared to EGFP, pd2EGFP fluorescence should provide a more temporally accurate readout of Col2α1 expression. To assess its utility in this context, we harvested rib chondrocytes from both Col2-EGFP and Col2-pd2EGFP reporter P1-2 mouse pups by FACS using fluorescence as a marker of the chondrocyte phenotype. Whereas EGFP+ chondrocytes segregated into a distinct peak of fluorescent cells (Fig. 5A, top), the pd2EGFP+ cells appeared as a continuum of fluorescence intensity, consistent with the short half-life of pd2EGFP (Fig. 5A, bottom). To ensure the isolation of similar chondrocyte populations, pd2EGFP+ cells were sorted using identical gating parameters as were used for EGFP+ cells. As expected, the yield was lower for the Col2-pd2EGFP reporter mice, with 61.2% EGFP+ cells sorted from chondrocyte preparations of the P1-2 Col2-EGFP mice but only 25.7% pd2EGFP+ cells sorted from the P1-2 Col2-pd2EGFP mice. Q-PCR analysis of the sorted cells (Fig. 5B) revealed that relative mRNA gene expression levels of (pd2)EGFP were 6-fold higher in the homozygote pd2EGFP versus the heterozygote EGFP mice. Relative gene expression levels of Col2α1 did not differ between heterozygote EGFP and hetero- and homozygote pd2EGFP mice, whereas Col10α1 was significantly ∼ 3-fold lower in the pd2EGFP mice compared to the EGFP mice. The latter supports the notion that the sorted pd2EGFP population of chondrocytes was primarily in the proliferative differentiation stage compared to the EGFP mice and is consistent with the confocal imaging observations (Figs. 1–3).

thumbnail image

Figure 5. Effect of EGFP type and cell culture conditions on sorted chondrocyte phenotype. Chondrocytes from 1–2-day-old Col2-EGFP and Col2-pd2EGFP reporter mice were isolated by FACS; the P3 histogram shows the final population of cells collected (A). Relative gene expression levels are set at 1 for the Col2-EGFP reporter mice and reveal that (pd2)EGFP is significantly higher in the homozygote pd2EGFP mice, with no differences in Col2α1 (B). However, the sorted chondrocytes from the hetero/homo-zygote pd2EGFP mice (n=3) are primarily proliferative compared to those from EGFP mice (n=6), based on the significantly lower Col10α1 gene expression levels (B). *P < 0.05 and **P < 0.01. Sorted chondrocytes were cultured on chambered coverslips not coated or coated with poly-HEMA and the fraction of cells displaying GFP fluorescence was determined on days 2, 4, and 6 (C). Fluorescence is lost within a few days for cells from both sources when cultured directly on coverslips (uncoated), but the drop is much more rapid for cells from the Col2-pd2EGFP pups with less than 20% of cells positive at 4 days compared to about 70% for cells from the Col2-EGFP pups (D, left). In contrast, fluorescence was largely retained for cells from both strains when cultured on poly-HEMA (D, right).

Download figure to PowerPoint

After sorting, cells were cultured for 6 days on chambered coverslips, either untreated or coated with poly-HEMA to prevent attachment and subsequent dedifferentiation (Stokes et al.,2001). The percentage of fluorescent cells was determined on days 2, 4, and 6. When EGFP+ cells from the Col2-EGFP mice were plated on plastic coverslips, the percentage of EGFP+ cells dropped progressively over six days, especially after day 4 (Fig. 5C). The percentage of pd2EGFP+ cells dropped at a much faster rate, i.e., less that 20% pd2EGFP+ cells versus about 70% EGFP+ cells at day 4 (Fig. 5C). When EGFP/pd2EGFP+ cells were cultured on poly-HEMA, essentially all of the surviving cells retained fluorescence regardless of the source of cells (Fig. 5C and D).

Our findings confirm the well-known fact that mouse chondrocytes dedifferentiate in vitro after plating on plastic surfaces. They further show that detection of the virtual “real-time” Col2-pd2EGFP reporter is dramatically reduced after only four days of monolayer culture. However, they also corroborate that culture on poly-HEMA effectively eliminates loss of the transgene reporter expression and presumably dedifferentiation as previously reported (Stokes et al.,2001).

pd2EGFP+ Growth Plate Chondrocyte Culture Under Standard High-Density Conditions

After the age of 3 weeks, the articular chondrocytes of the Col2-pd2EGFP mice did not express pd2EGFP fluorescence as compared to the growth plate chondrocytes (Figs. 3 and 4). Furthermore, epiphyseal ossification is completed by 4 weeks. Therefore, the recovered pdEGFP+ chondrocytes from 4-week-old mice can be assumed to originate almost exclusively from the growth plate and represent a much smaller fraction of the total population of sorted cells (∼ 3%) compared to P1-2 mice (∼ 25%). Based on the fluorescence expression pattern of the Col2-pd2EGFP strain (Fig. 3) and the gene expression pattern of the sorted P1-2 chondrocytes from both strains (Fig. 5B), the recovered cell-population consists mainly of proliferative chondrocytes and some (pre)-hypertrophic chondrocytes. Resorting of the sorted cells revealed >96% GFP+ chondrocytes. In the negative control, enriched growth plate material from wild type mice was sorted and no pd2EGFP+ cells were present within gate 3 (Fig. 6).

thumbnail image

Figure 6. Typical example of gating used for sorting pd2EGFP growth-plate chondrocytes. Left: Growth-plate chondrocyte population from a 4-week-old wild type mouse. Within the gate, no GFP-negative cells are included. Middle: Growth plate chondrocyte population of a 4-week-old Col2-pd2EGFP mouse. Within the gate, ∼ 3% pd2EGFP + chondrocytes are selected. Right: Resorting of the sorted chondrocytes reveals > 96% GFP+ chondrocytes.

Download figure to PowerPoint

As shown in Figure 7, the recovered pd2EGFP growth plate cells were placed in high-density micro-culture in order to maintain the chondrocyte phenotype (Schulze-Tanzil et al.,2002) and cultured for up to 21 days. For screening purposes, we used fewer cells than in classical micromass-culture and refer to this technique as micro-culture. Under standard culture conditions, at T=0 days (16 hr after inoculation), the chondrocytes formed a network of rounded cells, most of which were pd2EGFP positive. At T=2 days, the network became more rigid, filling slowly the gaps between the chondrocytes and a matrix containing type II collagen was deposited. As shown at 7 and 14 days, the chondrocytes grew not only in a monolayer fashion but also formed more than one layer locally, with some pd2EGFP+ cells still evident. The type II collagen matrix was more extensive and pericellular deposition of type X collagen was seen at day 7. Thus, the isolated proliferative zone cells remained chondrocytic and able to terminally differentiate, which in itself is not a novel finding.

thumbnail image

Figure 7. Sorted pd2EGFP+ growth plate chondrocytes were cultured in triplicate in high-density conditions for 21 days and imaged at T=0, 2, 7, 14, and 21 days. Fluorescence is superimposed on transmitted light images in the top panel (GFP_TLI). Immunostaining of types II and X collagen was employed to study the differentiation stage. Under these conditions, a type II collagen matrix was deposited by 2 days of culture, whereas type X collagen was first seen on day 7.

Download figure to PowerPoint

These results also suggest that the Col2α1 transcriptional activity that accounts for the deposition of type II collagen in the cultures occurs in the first few days of culture. To validate this notion and relate expression of pd2EGFP to that of markers of chondrocyte hypertrophy and dedifferentiation, Col10α1 and Col1α1, respectively, RNA from the cultures was assayed by qPCR. Figure 8 shows that the pattern of relative pd2EGFP and Col2α1 expression is remarkably similar to peaking on day 0 and dropping to low levels by day 14. Expression of Col10α1 lagging behind the peak of Col2α1 expression by 2 days and then diminishing over the next 2 weeks as the relative expression of Col1α1 rises is consistent with progressive hypertrophy and dedifferentiation of the cells. This is the sequence of events that would be expected for cells harvested by a protocol that enriches for primarily proliferating growth plate chondrocytes by virtue of their pd2EGFP fluorescence.

thumbnail image

Figure 8. Relative gene expression levels of growth plate pd2EGFP+ chondrocytes in high-density micromass culture sampled in triplicate at: T=0 (16 hr after starting culture), 2, 7, 14, and 21 days. T = −16 hr is set at 1. a–c, P < 0.05 compared to T = 0, 2, and 7 days, respectively.

Download figure to PowerPoint

In conclusion, the principal advantage of the Col2-pd2EGFP over the original Col2-EGFP transgenic mice is that the pd2EGFP reporter appears to provide a near real-time readout of Col2α1 expression both in vivo and in vitro. This property makes it a more accurate reporter of chondrocyte differentiation status in culture. Another advantage is that mice harboring the Col2-pd2EGFP transgene can be bred to homozygosity without apparent deleterious effects on health or fertility. The original Col2-EGFP mouse strain could not attain homozygosity, for reasons that have not been determined. The Col2-pd2EGFP mice can be employed to sort pure populations of growth-plate chondrocytes from post-natal mice. The resulting primary murine chondrocytes are mostly proliferative chondrocytes, which may be more appropriate for in vitro studies of growth plate biology than chondrocytes harvested from rib epiphyseal cartilage, which contains mainly to reserve, i.e., quiescent, chondrocytes. Zone-specific markers have recently been employed to sort enriched chondrocyte populations in respect of their differentiation stage (Belluoccio et al.,2010). This approach and our use of pd2EGFP to harvest growth plate chondrocytes complement each other well.

Finally, although we have discussed the Col2-pd2EGFP transgene reporter in the context of the skeletal growth plate, it potentially has utility in other contexts, such as monitoring fracture repair or repair of damaged articular cartilage in mouse models of osteoarthritis and other forms of joint disease. Overall, we consider the Col2-pd2EGFP reporter mouse to be a new and valuable tool for investigating cartilage biology and disease.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Generation of Transgenic Mice

Protocols for the mouse studies described herein were approved by the Oregon Health and Science University Institutional Review Board and the responsible ethical committee at the Utrecht University as required by Dutch legislation. The Col2-pd2EGFP transgene was constructed as follows. The CMV promoter was removed from pd2EGFP-N1 (Clontech, Palo Alto, CA) by AseI/NheI digestion followed by ligation of the ends filled in by Klenow. A 6.0-kb fragment containing the mouse Col2α1 promoter/enhancer was released from pCol2-EGFP used in the previous transgene construction (Grant et al.,2000) by Asp718/NcoI digestion. After filling in with Klenow, the fragment was blunt-end ligated into the Sma I site in the promoterless MCS of the re-circularized pd2EGFP-N1. Once the proper orientation was verified, the 7.0-kb Col2-pd2EGFP transgene was excised by Sal I/SspI digestion and gel purified. The linearized transgene was injected into fertilized hybrid C57BL/6 × SJL F2 eggs. Microinjection and other methods used to generate the transgenic mice have been described previously (Garofalo et al.,1991; Metsaranta et al.,1995).

Seven transgenic mice in the founder generation were identified by PCR using primers for EGFP as previously described (Grant et al.,2000). Newborn offspring of these founders were sacrificed and ranked by relative intensity of GFP fluorescence in cryo-sectioned limb cartilages using a Nikon E800 epifluorescence microscope. A male founder whose offspring exhibited the strongest cartilage fluorescence was used to develop the mice described in this report. The Col2-pd2EGFP transgenic was bred (6 generations) and maintained on a C57BL/6 genetic background. The Col2-pd2EGFP strain was bred to homozygosity as determined by quantitative-PCR (Q-PCR) using an iQ5 thermocycler (BioRad, Hercules, CA) and the following primers: GFP forward – ATCTGCACCACCGGCAAG CT, GFP reverse – GGGCATGGCGG ACTTGAAGA (optimal annealing temperature (Tm) 58°C, ∼ 129 bp product) and GAPDH forward – TCT GGAAAGCTGTGGCGTGATG, and GAPDH reverse – ACGGAAGGCCA TGCCAGTGA (Tm 58°C, 129 bp product). Homozygosity for the transgene insertion did not lead to obvious adverse affects on health or fertility. The Col2-EGFP strain does not breed to homozygousity.

Tissue Preparation and Processing for Confocal Microscopy

The embryos and long bones of the heterozygote EGFP/pd2EGFP and homozygote pd2EGFP mice were sampled immediately after euthanasia. Tissues were fixed in 4% buffered formalin (pH 7.4, 4°C, 36 hr) and de-calcified in 0.5M EDTA in Ca-Mg free Hanks solution (pH 7.8, 4°C, 7 days). After demineralization and washing in PBS (4°C, 24 hr) tissues were embedded in Tissue Tek (Sakura Ltd., Tokyo) and stored at −70°C until further analysis. Comparative GFP fluorescence between the Col2-EGFP and Col2-pd2EGFP samples was assessed in 20 μm freshly cut cryo-sections using a Leica TCS SP and later on a Leica SPEII confocal laser scanning microscope (Leica Microsystems, Germany). In order to study the GFP expression pattern in relation to the differentiation of growth plate chondrocytes, immunofluorescent labeling of type X collagen was performed. Type X collagen is specifically expressed in the hypertrophic zone of the growth plate. Antigen retrieval was accomplished with 4 mg/ml bovine hyaluronidase (450 IU/mg, Sigma-Aldrich) digestion for 1 hr at room temperature. After blocking with 10% goat serum, sections were incubated with rabbit polyclonal anti-mouse type X collagen (PXNC2, 1:100) overnight at 4°C (Lunstrum et al.,1999). The goat anti-rabbit ALEXA 568 (1:100, Invitrogen, Carlsbad, CA) was employed as secondary antibody. Nuclear counterstaining was performed with TOPRO-3 iodide (Invitrogen) and the slides were mounted in Prolong Gold anti-fade reagent (Invitrogen).

Tissue Preparation and Processing for In Situ Hybridization

Tissues were sampled immediately after euthanasia and fixed in 4% phosphate-buffered formalin for 24 hr at 4°C followed by rinsing and an alcohol series at 4°C for dehydration, i.e., 25% EtOH 2 hr, 50% EtOH 2 hr, 75% EtOH overnight, and 100% EtOH for at least 4 hr and stored at −70°C until further processing. The tissues were embedded in paraffin and 5 μm sections were prepared. The in situ probes for Col2α1 and Col10α1 were kindly provided by Dr. Marcel Karperien (Department of Tissue Regeneration, Institute for Biomedical Technology, University of Twente, The Netherlands). Digoxigenin-labeled single-stranded RNA probes were prepared using a DIG RNA labeling kit (Roche, Indianapolis, IN) following the manufacturers' instructions. In situ hybridization was carried out as described previously (van der Eerden et al.,2002) with some modifications. Briefly, sections were deparaffinized, fixed for 10 min in 4% paraformaldehyde (PFA), incubated in 10 μg/ml proteinase K (Qiagen, Chatsworth, CA) in PBS for 10 min at room temperature. Sections were post-fixed in 4% PFA for 5 min, followed by acetylation for 15 min in 0.25% acetic anhydride in 0.1 mol/L triethanolamine. Hybridization was performed overnight at 65°C. The hybridization mixture consisted of 50% formamide, 10 mmol/L Tris, 600 mmol/L NaCl, 1mmol/L EDTA, 0.25% SDS, 1× Denhardt solution, 10% dextran sulfate, 200 μg/μl yeast tRNA (Invitrogen), and the probe of interest. Thereafter, slides were washed and treated with 20 μg/ml RNAse A (Purelink™ invitrogen), blocked 1 hr in 20% heat-inactivated sheep serum in 200 mmol/L maleic acid, 300 mmol/L NaCl, pH 7.5, followed by overnight incubation at 4°C in anti-DIG (1:2000, Roche) in 2% blocking solution. After washing, staining was performed by incubation at room temperature for 3 hr in BM-Purple AP substrate (Roche). The reaction was stopped with 100 mmol/L NaCl, 100 mmol/L Tris pH 9.5, 50 mmol/L MgCl2, and 0.1% Tween. Finally the sections were fixed in 0.1% Glutaraldehyde /4% PFA for 20 min, rinsed, and mounted with aqueous mounting medium. Representative digital pictures of the tissue sections were taken with an Olympus Colorview 3 (5 megapixels) mounted on an Olympus BX 60 microscope using the same settings.

Tissue Preparation, Cell Sorting, and Culture of Early Post-Natal Col2-EGFP and Col2-pd2EGFP Skeletal Tissues

Rib cages were dissected from P1-P2 heterozygotes expressing either EGFP or pd2EGFP and placed in Hanks buffered saline with 2× penicillin/streptomycin (pen/strep). Enzymatic digestions were carried out in a humidified incubator at 37°C and 5% CO2. Ribs were first digested for 6 hr in 2 mg/ml pronase (Roche) with periodic mechanical disruption. Intact ribs were isolated following filtration through a 70-μm nylon screen to remove digested cells and debris, washed with PBS, and then incubated overnight in 100 IU/ml collagenase II (Worthington, Lakewood, NJ) in 50/50 DMEM/F12 (Invitrogen) containing 10% FBS, 2× pen/strep, and 0.2 mM L-ascorbic 2-phosphate (Sigma-Aldrich, St. Louis, MO). The resulting cell suspension was filtered as above to remove remaining bony pieces. Thereafter, the cell suspension was centrifuged for 5 min at 1,100 rpm and re-suspended in DMEM/F12 (without phenol red) with 10% FCS, 2× pen/strep, and 25 IU/ml collagenase II to prevent clumping of the cells. EGFP- or pd2EGFP-expressing cells were sorted on a Vantage Cell Sorter equipped with an argon laser with 488 nm excitation. A primary gate (P1) based on physical parameters (forward and side light scatter) was set to exclude dead cells, debris, and clumped cells. A secondary gate (P2) was used to exclude autofluorescent cells, where FL1 detects 525 nm maximum emission (EGFP/pd2EGFP) and FL2 detects 575 nm maximum emission. Autofluorescent cells emit equally from both green and orange channels and plot as a diagonal across the graph. The third gate (P3) selected for cells expressing only EGFP/pd2EGF using fluorescence intensity (FL1). In order to verify the correct selection of the gates, samples from wild type mice were also sorted. Recovered cells were either employed for analysis of the relative gene expression levels of (pd2)EGFP, Col2α1, and Col10α1 as described below or cultured in DMEM/F12 (without phenol red) containing 10% FBS in a humidified incubator at 37°C and 5% CO2.

Microscopy of the Recovered EGFP and pd2EGFP Chondrocytes From P1-2-Old-Mice

Poly-2-hydroxyethyl methacrylate (poly-HEMA) was dissolved in ethanol overnight to a concentration of 50 mg/ml. Where indicated, chambered coverslips (LAB-TEK) were treated with poly-HEMA to a depth of 2 mm and allowed to dry overnight. The following day (day 1), freshly isolated cells were plated onto 4-well chambered coverslips coated with or without poly-HEMA. Confocal images were obtained at days 2, 4, and 6 using a Leica TCS SP5 confocal imaging system, with a 20× objective, resulting in an imaging field of 460 × 460 μm field. Illumination was performed by the 488-laser line, and enough fields were collected to evaluate at least 100 cells. Images were imported into Photoshop CS4 and the percentage of green fluorescent-cells determined by counting manually.

Tissue Preparation, Sorting, and Cell Culture of pd2EGFP Late-Post Natal Growth Plate Chondrocytes

As demonstrated in Figure 4, articular chondrocytes do not exhibit GFP fluorescence beyond 3 weeks of age. Thus, the isolation of pd2EGFP-growth plate chondrocytes was performed using the long bones of homozygote 4-week-old Col2-pd2EGFP mice sampled immediately after euthanasia. The growth plates were dissected with the aid of a stereoscope, digested overnight with collagenase II, and sorted as described above. The recovered cells were collected in 50/50 DMEM/F12 media containing 10% FBS and 0.2 mM L-ascorbic 2-phosphate and concentrated to a final concentration of 2 × 106 cells per ml. Single 10-μl droplets were placed on chamber slides and left to incubate in a humidified incubator at 37°C, 5% CO2 for 2 hr. By that time, the cells had attached and formed a high-density micro-culture of approximately 20,000 cells, sufficient for RNA isolation and immunofluorescence imaging. The following times points were sampled: T=0 (16 hr after starting the cultures) and at T=2, 7, 14, and 21 days. At every time point, the micromass cultures were either extracted with 350 μl RLT buffer (Qiagen) containing 1% β-mercaptoethanol (RNA isolation) or fixed for 10 min with 4% buffered formalin (immuno-fluorescence). Immunofluorescent staining of the cultures for type II collagen (clone II-II6B3, Developmental Studies Hybridroma Bank, University of Iowa, Iowa City, IA) and type X collagen matrix deposition was performed as described for the tissues.

Total RNA was isolated with the RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol and was quantified spectrophotometrically using Nanodrop ND-1000 (Isogen Life Science, De Meern, The Netherlands). One microgram of total RNA was used in a cDNA-synthesis reaction (iScriptTM, Bio-Rad) and Q-PCR was performed using IQ SYBR-green supermix (Bio-Rad) according to standard protocols. Standard curves were prepared by plotting the log of the starting amount versus the threshold cycle, using serial 3- or 4-fold dilutions of template. The amplification efficiency, E (%) = (10(1/-s) –1) × 100 (s = slope), of each standard curve was determined and appeared to be >90% and <110%. For each experimental sample, the expression of three reference genes, heat shock protein 86 (hspca), ribosomal protein L32 (rpl32), and tyrosine 3-/tryptophan 5-monooxygenase activation protein (ywhaz), was determined in order to control the quality/quantity of the template and normalize expression. Relative gene expression levels of pd2EGFP, Col2α1, Col10α1, and collagen 1α1 (Col1α1) were determined (Table 1). Col10α1 served as a hypertrophic differentiation marker, whereas Col1α1 served as a de-differentiation marker. Relative quantification was calculated by means of the efficiency corrected delta-delta Ct (ΔΔCt). The efficiency E was calculated according to E=10(−1/slope). The expression ratio was calculated using the following formula: Ratio = (Etarget)ΔCt(target)/(Eref)ΔCt(ref). Statistical analyses were performed using SPSS for Windows 16 (SPSS Inc., Chicago, IL). Differences in relative gene expression between time points were analyzed based on the ΔΔCt in an ANOVA with Bonferoni correction. Values were considered to be significant when P < 0.05.

Table 1. Primer Information of Reference Genes and Genes of Interesta
GeneAmplicon size (bp)Forward (Fw) and reverse (Rv) primer 5′- 3′ExonTm, °C
hspcaa111Fw: AATTGCCCAGTTAATGTCCTTGA260
  Rv: TCGTAACGGATTTTATCCAGAGC3 
rpl32a100Fw: TTAAGCGAAACTGGCGGAAAC2/364
  Rv:TTGTTGCTCCCATAACCGATG3 
ywhaza120Fw: AACAGCTTTCGATGAAGCCAT5/664
  Rv: TGGGTATCCGATGTCCACAAT6/7 
pd2EGFP129Fw: ATCTGCACCACCGGCAAGCT 65.5
  Rv: GGGCATGGCGGACTTGAAGA  
Col2a1b103Fw: ACCATGAACGGTGGCTTCCA52/5364
  Rv: AGCCCTCAGTGGACAGTAGA53 
Col10a1c177Fw:GCAGCATTACGACCCAAGAT360
  Rv:CCTGAAGCCTGATCCAGGTA3 
Col1 a1d99Fw: AACGAGATCGAGCTCAGAGG5066
  Rv: GACTGTCTTGCCCCAAGTTC51 

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

We thank Melissa Rassar for constructing the Col2-pd2EGFP transgene, Dr. Ger Arkesteijn for FACS-mediated sorting of the pd2EGFP-positive chondrocytes (Flow Cytometry unit), and Esther van 't Veld and Rob Bleumink (Center for Cell Imaging) for assistance with microscopy.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES