SEARCH

SEARCH BY CITATION

Keywords:

  • Xenopus;
  • fermitin;
  • Kindlin;
  • Kindler Syndrome

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Fermitin genes are highly conserved and encode cytocortex proteins that mediate integrin signalling. Fermitin 1 (Kindlin1) is implicated in Kindler syndrome, a human skin blistering disorder. We report the isolation of the three Fermitin orthologs from Xenopus laevis embryos and describe their developmental expression patterns. Fermitin 1 is expressed in the skin, otic and olfactory placodes, pharyngeal arches, pronephric duct, and heart. Fermitin 2 is restricted to the somites and neural crest. Fermitin 3 is expressed in the notochord, central nervous system, cement gland, ventral blood islands, vitelline veins, and myeloid cells. Our findings are consistent with the view that Fermitin 1 is generally expressed in the skin, Fermitin 2 in muscle, and Fermitin 3 in hematopoietic lineages. Moreover, we describe novel sites of Fermitin gene expression that extend our knowledge of this family. Our data provide a basis for further functional analysis of the Fermitin family in Xenopus laevis. Developmental Dynamics 240:1958–1963, 2011. © 2011 Wiley-Liss, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

Fermitin family homologues (Fermt1, 2, and 3, also known as Kindlins) are a group of highly conserved proteins, each encoded by a different gene. They share a bipartite FERM domain interrupted with a pleckstrin homology (PH) domain. FERM domain–containing proteins are components of the cytocortex where they function as architectural, signalling, and plasma membrane–associated molecules (Larjava et al.,2008; Tepass,2009). The name FERM is derived from the first four proteins identified in this family (Four-point-one, Ezrin, Radixin, and Moesin). The FERM domain consists of three modules (F1, F2, and F3) that fold independently but interact to generate a clover leaf structure (Pearson et al.,2000). The Fermitins in recent years have been described to function as mediators of integrin inside-out signalling (reviewed in Malinin et al.,2010). The recruitment of Fermitin proteins and Talin (also a FERM domain protein) to the membrane mediates the terminal event of integrin signalling, via interaction with integrin β subunits (Kloeker et al.,2004; Moser et al.,2008; Harburger et al.,2009).

Kindler Syndrome (KS) was first described as a congenital skin disorder characterized by skin blistering, periodontitis, and poikilodermia (Kindler,1954; Jobard et al.,2003; Sharma et al.,2003; Siegel et al.,2003). The clinical manifestations associated with this disease result from mutations in the FERMT1/KIND1 gene, which encodes a membrane-associated structural protein linking actin and the extracellular matrix (ECM) (Jobard et al.,2003; Siegel et al.,2003). In mammalian studies, Fermt1 is generally expressed in epithelial cells, Fermt2 is ubiquitous, and Fermt3 is expressed in hematopoietic lineages (Ussar et al.,2006). Fermitin 1 (Kindlin 1) mutations in mice result in the animals developing severe skin atrophy and dying perinatally (Ussar et al.,2008). Although the mice do not develop blistering, a closer analysis revealed that the mutant mice displayed intestinal defects and inflammation. This is consistent with the finding that a proportion of Kindler patients present with ulcerative colitis.

In this study, the expression of Fermt1, 2, and 3 is characterized in X. laevis embryos using Polymerase Chain Reaction (PCR) and in situ hybridisation. Each of the three family members exhibits distinct expression patterns. During early development, Fermt1 and Fermt2 are expressed maternally, whereas Fermt3 is detected by RT-PCR only after stage 15. Similar to mammalian embryos, Fermt1 is generally expressed in the skin. Expression of Fermt1 is also detected in the pharyngeal arch region, nasal and otic placodes, pronephric duct, and weakly in the somites. Fermt2 expression is observed in the neural crest and somites. The expression of Fermt3 is first detected in the notochord, cement gland, anterior ventral blood islands, and early born myeloid cells. Expression continues in these tissues, and the expression in myeloid progenitors becomes more widespread as development continues. In addition, expression of Fermt3 can later be detected in the central nervous system and in the vitelline veins. Generally speaking, the expression of Fermt1, 2, and 3 in Xenopus embryos mirrors that described for mammalian species and suggests a tightly conserved expression of these genes throughout vertebrate development. However, we report novel sites of expression for each of the three Fermitin genes in Xenopus embryos.

RESULTS AND DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

The expression of each Xenopus Fermt gene was examined initially by RT-PCR from stage 2 to 32. Fermt1 and Fermt2 are expressed maternally, and uniformly throughout development, whereas Fermt3 is expressed from stage 15 onward (Fig. 1). In situ hybridisation of Fermt1 and Fermt2 on bisected embryos at stage 10 and 10.5, respectively, reveals expression throughout the embryo (Fig. 2A, B). RT-PCR confirms that both Fermt1 and Fermt2 are expressed in all three germ layers with the strongest expression in the ectoderm and mesoderm (Fig. 2C).

thumbnail image

Figure 1. Expression analysis of Fermt1, Fermt2, and Fermt3 by RT-PCR. Fermt1 and Fermt2 transcripts are maternally expressed, whereas Fermt3 expression is detectable from stage 15 onwards. Expression of Odc (Ornithine decarboxylase) is analysed as a loading control. Lanes 1, 3, 5, 7, 9, 11, 13, 15, 17, and 19 are samples extracted from stage 2, 6, 9, 10, 13, 15, 18, 20, 23, and 32. Negative controls (minus Reverse Transcriptase) are shown in lanes 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20.

Download figure to PowerPoint

thumbnail image

Figure 2. Expression of Fermt1 and Fermt2 at gastrula stages. A, B: Expression of both Fermt genes is detected throughout the gastrula embryo. Ectoderm, endoderm, and mesoderm were isolated from embryos at stage 10.5 and analysed for Fermt1 and Fermt2 expression by RT-PCR (C). Fermt1 is expressed in the ectoderm (lane 1) and mesoderm (lane 2) and more weakly in the endoderm (lane 3). Fermt2 is expressed in all three germ layers at stage 10.5. ODC serves as a loading control.

Download figure to PowerPoint

Between stage 12 and stage 20, the expression of Fermt1 is restricted to the ectoderm (Fig. 3A–C). At stage 22, expression of Fermt1 is detected uniformly throughout the surface ectoderm and weakly in the somites (Fig. 3D). Fermt1 becomes spatially restricted to a number of ectodermally derived structures by stage 28. This includes the olfactory pit and otic vesicle (Fig. 3E). Expression of Fermt1 can also be detected in the pharyngeal arch region, somites, and pronephric anlagen. Fermt1 continues to be expressed in the olfactory and otic placodes at stage 34 and is enriched in the pharyngeal arch region, heart, and pronephric duct (Fig. 3F). Transcripts are also detected in the surface ectoderm and fin structures. These expression domains are clearly seen in transverse sections through the eye/pharyngeal region (Fig. 3G), the level of the otic pit (Fig. 3H), and pronephric anlagen (Fig. 3I).

thumbnail image

Figure 3. Expression of Fermt1 from stages 12 to 35. A–C:Fermt1 expression at stage 12, 15, and 18, respectively. Expression in the ectoderm is clearly seen in transverse section.

D: Fermt1 expression is detected throughout the ectoderm and weakly in the somites at stage 22. E: At stage 28, Fermt1 becomes restricted to a number of ectodermal derivatives, including otic, olfactory, and pharyngeal placodes, and pronephric anlage. F: By stage 35, Fermt1 transcripts are detected in the otic vesicle (black arrow), olfactory pit (black asterisk), heart (back arrowhead), and in the pronephric duct (white arrowhead). G–I: Transverse sections are observed through the level of the eye/olfactory pit (G), the otic vesicle (H), and the pronephric duct (I). Inset (F) demarcates the levels at which sections were analysed (G–I).

Download figure to PowerPoint

Fermt2 is the only member of the Fermitin family of genes to demonstrate early tissue-specific expression in Xenopus laevis embryos (Fig. 4). Although expression of Fermt2 appears ubiquitous at stage 7 (Fig. 4A) and stage 10.5 (Fig. 2B), expression becomes restricted to the dorso-anterior-most region of the embryo at stage 13 (Fig. 4B and C). By stage 14 (Fig. 4D), and stage 15 (Fig. 4E), Fermt2 expression is highlighted in the head region and neural folds. Fermt2 is detected within the neural crest at stage 16 (Fig. 4F) and stage 17 (Fig. 4H), whilst the earliest expression in the developing somites is observed at stage 16 (Fig. 4G). Expression is robustly detected within the migratory neural crest from stage 20 onwards (Fig. 5A, B). By stage 25, expression persists in the neural crest and is clearly detected within the somites (Fig. 5C and dorsal view, Fig. 5D). Transverse sections at anterior (Fig. 5E) and posterior (Fig. 5F) axial levels of a stage-29 embryo highlight expression in the neural crest and somites. The boxed area in Figure 5B is magnified (inset) to highlight expression within the neural crest. The boxed area in Figure 5E is magnified (inset) to reveal expression of Fermt2 in Rohon Beard sensory neurons, a group of large sensory neurons specified by stage 13. This expression is reminiscent of Runx1, a gene that is expressed in Rohon Beard and other sensory neurons (Park and Saint-Jeannet,2010). Expression of Fermt2 persists in both the neural crest and somites through stage 30 (Fig. 5G) and 34 (Fig. 5 H, I). Cardiac neural crest staining is also observed (white asterisk, H).

thumbnail image

Figure 4. Expression of Fermt2 from stages 7 to 17. A:Fermt2 is ubiquitously expressed at stage 7. By stage 13 (B,C), Fermt2 becomes restricted to the dorso anterior most region of the embryo. D: At stage 14, a clear delineation of Fermt2 is observed in the future head region (white asterisk). E:Fermt2 expression is observed in the neural folds (white asterisk). F,G: Neural crest (white asterisk) and somites (black arrow) express Fermt2 by stage 16. H: Streams of neural crest expressing Fermt2 are evident at stage 17 (white asterisk). In A, animal pole is to the top, and in C, anterior is to the top. In B, D, E, G, and H, anterior is to the left. F represents a frontal view.

Download figure to PowerPoint

thumbnail image

Figure 5. Expression of Fermt2 from stages 22 to 34. A, B: At stage 22, Fermt2 transcripts are detected in the migratory neural crest, clearly revealed by transverse section (B). C: By stage 25, expression persists in the neural crest (arrow) and becomes detectable within the somites (lateral view, C and dorsal view, D). E, F: Transverse sections through mid-axial levels of a stage-29 embryo reveal the somitic expression (F). Fermt2 transcripts are also detected in Rohon Beard neurons (E, boxed area shown in high magnification, inset, black arrows). At stage 30 (G) and 34 (H) expression persists within the neural crest and somites and is clearly seen in a transverse section (I) from a mid axial level. Asterisk in H demarcates cardiac neural crest. White lines in A and H indicate the levels at which sections are shown in B and I, respectively.

Download figure to PowerPoint

Fermt3 is the only gene within this family that is not expressed maternally. By RT-PCR, transcripts are detected after stage 15; however, the expression by whole-mount in situ hybridisation is not detectable until after stage 21, where it is weakly expressed in the anterior ventral blood islands (data not shown). By stage 28, expression of Fermt3 is observed in the cement gland (Fig. 6A, asterisk), anterior ventral blood islands (black arrow), and the notochord. Transcripts are detected in scattered myeloid cells that derive from the anterior ventral blood islands. These cells more densely populate the anterior half of the embryo. At this stage, a transverse section (Fig. 6B) through the embryo shows the expression in these tissues and cells, all of which are mesodermal derivatives (Lane and Smith,1999; Ciau-Uitz et al.,2000). By stage 35, Fermt3 expressing myeloid cells are distributed evenly along the entire axis of the developing embryo (Fig. 6C). Expression of Fermt3 is also detected within the central nervous system (Fig. 6C), in the telencephalon (Fig. 6E) and myelencephalon (Fig. 6F). Additionally, the notochord strongly expresses Fermt3 at stage 35 (Fig. 6C, F, G), and a ventral view (Fig. 6D) of the embryo shown in Figure 6C reveals the expression of Fermt3 in the developing vitelline veins. The overall myeloid lineage expression pattern is similar to that observed for spib and scl, genes expressed in the myeloid cells and ventral blood islands (spib) and notochord and ventral blood islands (scl) (Costa et al.,2008).

thumbnail image

Figure 6. Expression of Fermt3 at stage 28 and 35. A, B:Fermt3 transcripts are detected at stage 28 in the cement gland (asterisk), notochord, anterior ventral blood islands (back arrow), and in early myeloid progenitor cells. White line in A indicates the level at which this section (B) is taken. C–G: By stage 35, expression of Fermt3 is visible in the cement gland (C, asterisk), central nervous system (C, E, F), ventral blood islands and vitelline veins (5C, black arrow, D, F), notochord (C, F, G), and in myeloid cells (C, D, F, G). Ventral view of a stage-35 embryo is shown is D and transverse sections are presented (E–G), the levels of which are demarcated by white lines (C).

Download figure to PowerPoint

In conclusion, our study extends the observations on the expression of Fermitin genes described in mammalian embryos (Ussar et al.,2006; Tepass,2009). In accordance with the fact that Fermitin1 is expressed in the skin in mouse and humans, this is also seen in Xenopus embryos. In addition, we describe a number of novel expression patterns for Fermitin1, namely the olfactory and otic placodes, pharyngeal arches, and the heart. Kindler syndrome patients display an early skin blistering disease that results from a defective anchorage of the actin cytoskeleton network to the underlying matrix. Xenopus embryos may provide an alternative model organism, through the relative ease of gain and loss of function approaches, to investigate the molecular mechanism underlying this defective cell matrix adhesion. Additionally, as Kindler patients develop, their skin pathologies change, and recent data suggest that patients may become susceptible to squamous cell carcinoma (Lotem et al.,2001). Indeed, many clinical manifestations observed within Kindler syndrome patients are poorly understood, and the novel sites of expression observed within Xenopus embryos could be exploited to gain further insight into the role of Fermitin proteins in vivo.

Fermitin 2 is generally thought to be ubiquitously expressed in adult mouse tissue, but closer examination reveals specific expression in smooth and striated muscle tissues. In Xenopus embryos, Fermitin 2 is detected in the somites (a trunk muscle precursor), but we find additional expression in the neural crest. Ablation of pre-migratory neural crest in both Xenopus and avian embryos disrupts ventral myocardial function and/or cardiomyocyte proliferation (Snider et al.,2007). Migfilin, a focal adhesion protein that is essential for Fermt2 binding, has also been implicated in cardiomyocyte differentiation in mouse (Akazawa et al.,2004). It is tempting to invoke an important role for Fermt2 in neural crest differentiation, given that it is expressed in the early emigrating crest streams in Xenopus embryos.

Finally, expression of mammalian Fermitin 3 is associated with hematopoietic lineages, and in accordance with this, we find that Fermitin 3 is expressed in the anterior ventral blood islands, vitelline veins, and early myeloid cells. In Xenopus embryos, we report additional and novel sites of expression, which include the notochord and cement gland. This present study expands the current knowledge of the highly conserved Fermitin gene family expression in a vertebrate species, Xenopus laevis. Functional analyses will determine specifically how these three structurally related genes are integrating signalling within the different tissues described.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

cDNA Isolation, Plasmid Construction, and RT-PCR

Gene reference sequences for Xenopus laevis Fermitin family homologs are Fermt1 (NM_001085963); Fermt2 (NM_ 001093486); Fermt3 (NM_001086554) and were obtained from the NCBI database. To isolate Xenopus Fermitin cDNAs, total RNA from stage- 18 and -25 embryos was extracted with Trizol (Invitrogen, Carlsbad, CA). Primers were designed with Primer3plus and used to isolate the three Fermt genes from total RNA. Primers were as follows: Fermt1F: 5′atcccagtatgccaaatgga3′, Fermt1 R: 5′caa tggcaacctctcgtttt3′, Fermt2F: 5′tct gaatcgggatgttaccc3′, Fermt2R: 5′ggctgactgacggcaagta3′, Fermt3F: 5′ca cgatgggcagtgctacta3′, Fermt3R: 5′ctc tggcctcttctttgctc3′, generating product sizes of 500 bp (Fermt1), 600 bp (Fermt2), and 350 bp (Fermt3). RT-PCR reactions were performed using standard PCR cycling conditions with annealing temperatures of 55°C. The Fermt1 amplicon was cloned into a pDrive Cloning vector (Qiagen, Chatsworth, CA). Fermt2 and Fermt3 amplicons were cloned into pCR 2.1-TOPO vector (Invitrogen). For germ layer–specific RT-PCR, the animal poles were removed from stage-10.5 embryos, followed by careful dissection of the marginal zone (mesoderm) leaving the remaining vegetal endodermal mass. Xbra and Sox17α were enriched specifically in the mesoderm and endoderm, respectively, and neither were detected within the animal hemisphere.

Whole Mount In Situ Hybridization

Anti-sense Digoxigenin-labeled RNA probes were transcribed as per standard procedures (Jones and Smith,2008). Fermt1, Fermt2, and Fermt3 were linearised with BamH1, SacI, and BamH1, respectively, and transcribed with SP6 (Fermt1 and Fermt2), or T7 polymerase (Fermt3). In vitro fertilized Xenopus laevis embryos were incubated at 22°C and fixed at required stages for whole-mount in situ hybridisation as previously described (Jones and Smith,2008). Embryos at stage 7, 10, and 10.5 were bisected for further in situ hybridisation analysis. Briefly, embryos were stored in methanol at −20°C overnight, rehydrated through a graded series of methanol, and washed in PBST. Embryos were proteinase K treated for 10 min at room temperature before being re-fixed and pre-hybridized for at least 4 hr at 60°C. Probes were added and embryos were incubated at 60°C overnight. Embryos were washed through a series of SSC washes at 60°C and blocked before anti-DIG antibody (1:4,000) was added for overnight incubation at 4°C. Embryos were washed four times for 1 hr each in MABT followed by two 5-min washes in alkaline phosphatase buffer. Colour reactions were developed with BM purple substrate (Roche, Indianapolis, IN). Reactions were stopped by washing in PBS, followed by re-fixation. Wild type embryos were bleached in 2:1methanol: hydrogen peroxide (30%) to fully reveal expression patterns. Whole mount pictures were taken on an Olympus MVX10 microscope. Selected embryos from in situ hybridization were embedded in albumin/gelatin and cross-sectioned at 35 μm on a Leica VT1000S vibratome.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES

We acknowledge Sharon White who contributed to the initial phase of this study.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS AND DISCUSSION
  5. EXPERIMENTAL PROCEDURES
  6. Acknowledgements
  7. REFERENCES