SEARCH

SEARCH BY CITATION

Keywords:

  • chondroitin sulfate;
  • polymerase;
  • CSGALNACT;
  • CHSY;
  • CHPF;
  • zebrafish

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Background: Chondroitin/dermatan sulfate (CS/DS) proteoglycans present in the extracellular matrix have important structural and regulatory functions. Results: Six human genes have previously been shown to catalyze CS/DS polymerization. Here we show that one of these genes, chpf, is represented by two copies in the zebrafish genome, chpfa and chpfb, while the other five human CS/DS glycosyltransferases csgalnact1, csgalnact2, chpf2, chsy1, and chsy3 all have single zebrafish orthologues. The putative zebrafish CS/DS glycosyltransferases are spatially and temporally expressed. Interestingly, overlapping expression of multiple glycosyltransferases coincides with high CS/DS deposition. Finally, whereas the relative levels of the related polysaccharide HS reach steady-state at around 2 days post fertilization, there is a continued relative increase of the CS amounts per larvae during the first 6 days of development, matching the increased cartilage formation. Conclusions: There are 7 CS/DS glycosyltransferases in zebrafish, which, based on homology, can be divided into the CSGALNACT, CHSY, and CHPF families. The overlap between intense CS/DS production and the expression of multiple CS/DS glycosyltransferases suggests that efficient CS/DS biosynthesis requires a combination of several glycosyltransferases. Developmental Dynamics 242:964–975, 2013. © 2013 Wiley Periodicals, Inc.


Abbreviations used
CS

chondroitin sulfate

DS

dermatan sulfate

GAG

glycosaminoglycan

GlcA

glucuronic acid

HS

heparan sulfateGal

NAc

N-acetyl galactosamine

INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Chondroitin sulfate (CS) is a polysaccharide of glycosaminoglycan type that consists of repeating disaccharide units of N-acetylgalactosamine (GalNAc) and glucuronic acid (GlcA) that may be sulfated in different positions (Kusche-Gullberg and Kjellen, 2003; Prabhakar and Sasisekharan, 2006). Chains where GlcA residues have been epimerized into iduronic acid (IdoA) are by convention referred to as dermatan sulfate (DS). Six human glycosyltransferases involved in polymerization of the CS/DS backbone have been identified (Fig. 1): the CS N-acetylgalactosaminyltransferases 1 and 2 (CSGALNACT1 and CSGALNACT2), the chondroitin synthases 1 and 3 (CHSY1, previous/alternative name: Chondroitin Sulfate Synthase 1 [CSS1] and CHSY3, previous/alternative name: CS Glycuronyl Transferase [CSG1cAT]), and finally the two chondroitin polymerizing factors (CHPF, previous/alternative name: Chondroitin Sulfate Synthase 2 [CSS2] and CHPF2, previous/alternative names: Chondroitin Synthase 2 [ChSy2]; Chondroitin Sulfate Synthase 3 [CSS3]).

image

Figure 1. Enzymes involved in CS/DS polymerization. Glycosyltransferases involved in CS/DS and HS chain polymerization in human and mouse are shown.

Download figure to PowerPoint

The CSGALNACT1 and CSGALNACT2 enzymes both have a GT7 catalytic domain with β1–4 N-acetylgalactosaminyl transferase (GalNAcT) activity (Cantarel et al., 2009). These enzymes initiate CS/DS formation by the addition of a GalNAc residue to a proteoglycan tetrasaccharide linkage region attached to a core protein, but may also participate in the later steps of CS/DS polymerization (Gotoh et al., 2002; Uyama et al., 2002, 2003; Sato et al., 2003).

The glycosyltransferases CHSY1, CHSY3, CHPF, and CHPF2 all participate in CS/DS polymerization and contain a GT31 domain with β1–3 glucuronosyl transferase (GlcAT) activity as well as a GT7 domain (Kitagawa et al., 2001, 2003; Yada et al., 2003; Izumikawa et al., 2008; Cantarel et al., 2009). Studies of COS-1 cells expressing the different human glycosyltransferases one at a time, suggest that CHSY1, CHSY3, and CHPF2 (but not CHPF) exhibit only weak GalNAcT and GlcAT activity. Interestingly, coexpression of any two of these four glycosyltransferases results in a dramatic increase of the enzymatic activities (Kitagawa et al., 2003; Izumikawa et al., 2007, 2008). This suggests that CS/DS polymerization is carried out by heterodimeric enzyme complexes, similar to what has been shown for HS biosynthesis, where the functional HS-polymerase is a complex of the two glycosyltransferases EXT1 and EXT2 (Fig. 1) (McCormick et al., 2000; Senay et al., 2000).

CS/DS is a ubiquitous component of multicellular organisms with mechanical functions in cartilage, but also suggested to be required for fundamental processes such as cell division and cytokinesis (Prabhakar and Sasisekharan, 2006; Esko et al., 2009; Maeda et al., 2010). It has been difficult to completely and selectively eliminate CS/DS biosynthesis in vertebrates, most likely due to redundancy between the CS/DS glycosyltransferases. For example, CSGALNACT1-deficient mice, which are viable and fertile but show abnormal cartilage development, still produce 50% of the CS/DS of wild-type animals (Watanabe et al., 2010). A complete block of CS biosynthesis was achieved in C. elegans resulting in abnormal cytokinesis and morphogenesis (Hwang et al., 2003; Mizuguchi et al., 2003). The relevance of these findings for higher organisms is, however, unclear since the C. elegans proteoglycans are very different from the vertebrate counterparts; the C. elegans CS backbone lacks sulfate groups, and the core proteins show no homology with the vertebrate proteoglycan core proteins (Olson et al., 2006). Finally, glucuronyltransferase-1-deficient mouse embryos that lack CS die before reaching the 8-cell stage due to failed cytokinesis. Importantly however, these mice also lack HS biosynthesis, which most likely strongly contributes to the severe phenotype (Izumikawa et al., 2010).

Not so much is known about the expression dynamics and activities of the different enzymes involved in CS/DS polymerization during vertebrate embryonic development. Here we report that five of the glycosyltransferases involved in human CS/DS biosynthesis have single zebrafish orthologues, while the chpf gene has been duplicated. We demonstrate that the CS/DS polymerases are expressed in regions where an extracellular matrix particularly rich in CS/DS is formed. Further, we show that whereas the total content of HS per animal reaches a steady-state at around 2 days after fertilization, the relative amount of CS/DS per animal continues to increase throughout the first 6 days of development along with cartilage formation.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Phylogenetic Analyses of Genes Involved in CS/DS Polymerization

BLAST searches using the six previously reported human and mouse CS/DS glycosyltransferase genes as templates were performed to identify orthologous genes in zebrafish (D. rerio), lancelet (B. floridae), fruit fly (D. melanogaster), and nematode (C. elegans). The zebrafish sequences obtained by the in silico search are available under the following UniProt accession numbers; E7F6G2 for csgalnact1, A8E7C8 for csgalnact2, F1Q679 for chpf2, Q6P296 for chsy1, F1QEX3 for chsy3, F1R7L6 for chpfa, and E7F9K2 for chpfb. Except for the orthologue of the human CHPF gene that has been duplicated in zebrafish, the mammalian genes were shown to correspond to single genes in the zebrafish genome (Fig. 2).

image

Figure 2. Phylogenetic analyses of the different CS/DS glycosyltransferases. A Neighbor-Joining phylogenetic tree of glycosyltransferases involved in CS/DS polymerization is shown. Bootstrap values are shown at the nodes. Hs, human (Homo sapiens), Mm, mouse (Mus musculus), Dr, zebrafish (Danio rerio), Bf, lancelet (Branchiostoma floridae), Dm, fruit fly (Drosophila melanogaster) and Ce, nematode (Caenorhabditis elegans). Alternative gene names previously used in the literature are displayed within parentheses for the Dm and Ce sequences. Three subgroups are marked with colors, CHSY (red), CSGALNACT (blue), and CHPF (green).

Download figure to PowerPoint

Four putative CS/DS glycosyltransferases were also identified in lancelet (Fig. 2). Two of these genes, chsya (UniProt: C3YQ05) and chsyb (UniProt: C3Z422), showed orthology to both CHSY1 and CHSY3. A single orthologue named chpf (UniProt: C3ZR58) was identified for the two polymerizing factors, as well as a single orthologue for the two GalNac transferases, named csgalnact (UniProt: C3XQE4).

Nematode sqv5 (UniProt: Q7Z1Z1) (Suzuki et al., 2006) and fruit fly CG9220 (UniProt: Q7KUZ9) (Correia et al., 2003) displayed orthology to both CHSY1 and CHSY3, whereas nematode par2.4, also called mig22 (UniProt: P45895) (Izumikawa et al., 2004), showed orthology to CHPF and CHPF2. Finally, the fruit fly CG12913 (UniProt: A1Z863) (Uyama et al., 2003) is related to both CSGALNACT1 and CSGALNACT2. No new glycosyltransferases in addition to those previously reported were found in the nematode or fruit fly.

Based on sequence similarity and phylogenetic analysis, we conclude that the CS/DS glycosyltransferases can be divided into three main subgroups: the CHSY family, encompassing the CHSY1 and CHSY3 genes; the CHPF family encompassing the CHPF and CHPF2 genes; and finally the CSGALNACT family encompassing the CSGALNACT1 and CSGALNACT2 genes (Fig. 2).

Expression of Genes Involved in CS/DS Synthesis During Zebrafish Development

The expression patterns of all the identified CS/DS glycosyltransferases were next studied. It has previously been shown that overexpression of any combination of CSHY and CHPF proteins in mammalian cells result in synergistic effects on CS/DS polymerization (Kitagawa et al., 2003; Izumikawa et al., 2007, 2008), suggesting that these enzymes likely act together in protein complexes. Thus, overlapping expression in situ of two or more members of the CHSY and CHPF glycosyltransferase families most likely indicates efficient CS/DS polymerization.

Clearly, csgalnact1 mRNA is not maternally deposited (Fig. 3A), instead a rather weak and ubiquitous expression is seen during early somitogenesis (Fig. 3B–D). At 24 hr post fertilization (hpf), csgalnact1 expression is mostly restricted to the notochord and to the otic capsule, but weak staining is also seen in the intermediate cell mass (ICM), a hematopoietic region at this stage (Fig. 4A). At later stages, csgalnact1 expression becomes restricted mainly to cartilage structures, and clear staining can be seen in the regions of the pharyngeal arches, the otic capsule, the pectoral fins, the notochord, and the median fin fold (Fig. 4B,C; see also Fig. 6A,B). At 72 hpf, weak staining in brain tissue and the spinal cord appears, while strong staining is detected in cartilage structures (Figs. 5A,B, 6N) and in the brain ventricular zone (Fig. 5B).

image

Figure 3. Whole mount in situ hybridization of CS/DS glycosyltransferases during the early stages of zebrafish development. All images show lateral views, except for the images in the rightmost column that show dorsal views of the posterior tail part of embryos. Early embryonic expression is demonstrated for csgalnact1 (A–D), csgalnact2 (E–H), chsy3 (I–L), chpf2 (M–P), chpfa (Q–T), and chpfb (U–X). N, notochord; PLM, posterior lateral mesoderm; IM, intermediate mesoderm; PM, paraxial mesoderm; TB, tail bud; S, somites.

Download figure to PowerPoint

image

Figure 4. Whole mount in situ hybridization of CS/DS glycosyltransferases at 24–48 hpf during zebrafish development. All images represent lateral views showing the mRNA levels of csgalnact1 (A–C), csgalnact2 (D–F), chsy3 (G–I), chpf2 (J–L), chpfa (M–O), and chpfb (P–R). Arrows indicate the position for sections shown in Figure 6. FB, forebrain; HB, hindbrain; ICM, intermediate cell mass; MB, midbrain; MFF, median fin fold; MHB, midbrain-hindbrain boundary; NC, neural crest; OC, otic capsule; P, proctodeum; PD, pronephric duct; PF, pectoral fin; PC, pharyngeal cartilage; R, retina; S, somites; TC, trabecula cranii.

Download figure to PowerPoint

image

Figure 5. Whole mount in situ hybridization of CS/DS glycosyltransferases at 72 hpf. Lateral views of larvae (left) and dorsal views of larval heads (right), showing the expression patterns of csgalnact1 (A,B), csgalnact2 (C,D), chsy3 (E,F), chpf2 (G,H), chpfa (I,J), and chpfb (K,L). Arrows indicate the position for sections shown in Figure 6. BVZ, brain ventrical zone; PC, pharyngeal cartilage; EP, ethmoid plate; G, gut; OS, olfactory system; PD, pronephric duct; PZ, proliferating zone of retina; SC, spinal cord.

Download figure to PowerPoint

image

Figure 6. Sections of embryos subjected to in situ hybridization of CS/DS glycosyltransferases. Transversal sections showing the expression patterns of csgalnact1 at 48 hpf (A,B) and 72 hpf (N,O), csgalnact2 at 48 hpf (C,D) and 72 hpf (P,Q), chsy3 at 24 hpf (E), 48 hpf (F,G) and 72 hpf (R,S), chpf2 at 48 hpf (H,I) and 72 hpf (T), chpfa at 36 hpf (J) and 48 hpf (K,L), and chpfb at 48 hpf (M) and 72 hpf (U). The position of each section is indicated with an arrow marked in Figure 4 and figure 5. Magnifications of boxed areas are shown to the right (A–D, F–H, K, N, P, Q). Arrowheads mark pharyngeal cartilage. B, brain; N, notochord; NC, neural crest; PF, pectoral fin.

Download figure to PowerPoint

The csgalnact2 probe strongly stains embryos already at the 2-cell stage indicating maternally deposited mRNA (Fig. 3E). Notochord staining is visible already from the 5-somite stage (Fig. 3F) and expression is apparent at the 15-somite stage in the tail bud and in the notochord (Fig. 3G,H), whereas the expression at 24 hpf is restricted to the brain tissue and the posterior region of the somites and the notochord (Fig. 4D). Expression was further detected in brain tissue at 36 and 48 hpf when staining appeared also in the pectoral fins, the notochord, the otic capsule, and cartilage structures (Figs. 4E,F, 6C,D). By 72 hpf, expression was restricted to the head, the spinal cord, and the pronephric ducts (Figs. 5C,D, 6O).

The expression patterns of zebrafish chsy1 have been reported earlier and the findings of these investigations together with our new results are summarized in Table 1. Table 1 thus provides a comprehensive overview of expression patterns of all CS/DS glycosyltransferases. Briefly, chsy1 is maternally contributed, ubiquitously expressed by the zygote until somitogenesis, and thereafter most prominently expressed in the tissues of the head (Thisse and Thisse, 2004; Li et al., 2010; Tian et al., 2010).

Table 1. Expression of CS/DS Glycosyltransferases in Zebrafish Embryos During Early Developmenta
 csgalnact1csgalnact2chsy1bchsy3chpf2chpfaChpfb
  1. a

    Gray rows indicate anatomical structures where transcripts for all investigated genes were detected by in situ hybridization.

  2. b

    Expression of chsy1 summarized on the basis of previously published data (Thisse and Thisse, 2004; Li et al., 2010; Tian et al., 2010).

Maternal+++++++++++
Posterior lateral mesoderm++++
Posterior intermediate mesoderm+++
Paraxial mesoderm+
Periderm+
Notochord++++++++
Eye++++++++
Somites+++++++
Caudal vein++++++
Posterior ICM+++
Median fin fold++++
Proctodeum+
Pectoral fin+++++++++++++
Telencephalon+++
Diencephalon++++
Midbrain-hindbrain boundary+++++
Midbrain+++++++
Hindbrain+++++
Spinal cord+++
Otic capsule++++++++
Branchial arches+++++++++
Cranial cartilage+++++++

Small amounts of chsy3 mRNA can be detected at the 4 cell stage (Fig. 3I), whereas at the 5-somite and 15-somite stages, chsy3 expression is found in the notochord and also to a lesser extent in the developing somites (Fig. 3J–L). At 24 hpf, expression is restricted to the tail bud and parts of the neural crest (Figs. 4G and 6E), whereas at 48 hpf, chsy3 expression is restricted to cartilage structures, the notochord, the otic capsule, and the pectoral fins (Figs. 4I, 6F,G) with additional staining of the midbrain at 72 hpf (Figs. 5E,F, 6P).

chpf2 mRNA is maternally deposited (Fig. 3M). At the 5-somite and 15-somite stages, expression is limited to the notochord, the tail bud, and somites (Fig. 3N–P). At 24 hpf, expression is restricted to the developing retina, the midbrain, and the rhombomeres (Fig. 4J). At later stages of development, expression appears in brain tissue and cartilage structures and in the otic capsule, the pectoral fins, and the notochord (Figs. 4K,L, 6H,I). By 72 hpf, chpf2 is expressed in cartilage structures and the brain, the gut, and in the proliferating zone of the retina (Figs. 5G,H, 6Q).

chpfa mRNA is maternally deposited (Fig. 3Q). At the 5- and 15-somite stages, expression is restricted to the intermediate and posterior lateral mesoderm and notochord (Fig. 3R–T). Expression at 24 hpf is found in brain tissue and somites in the tail region and in the proctodeum (Fig. 4M). At 36 hpf, staining is visible also in neural crest cells and in the intermediate cell mass (Figs. 4N, 6J) and later in cartilage structures, the otic vesicle, the pectoral fins, and weakly in the somites (Figs. 4O, 5I,J, 6K,L). The expression patterns of chpf2 and chpfa at 48–72 hpf are similar suggesting that these two isoforms may act together during CS/DS formation.

chpfb mRNA is maternally deposited (Fig. 3U). During early somatogenesis, chpfb display a weak ubiquitous expression, with stronger expression at the 15-somite stage in the paraxial mesoderm (Fig. 3V–X). Interestingly, chpfb is the only enzyme of the seven zebrafish glycosyltransferases exhibiting strong expression in the somites at 24 hpf while the head is devoid of expression (Fig. 4P). At this stage, expression can also be seen in the intermediate cell mass (Fig. 4P). At 36 hpf, staining appears in the notochord and the otic capsule (Fig. 4Q) and at 48 hpf in the somites and the notochord (Figs. 4R, 6M). At 72 hpf, staining is most prominent in brain and eye tissues (Figs. 5K,L, 6R).

Increased Accumulation of CS/DS But Not HS During Zebrafish Larval Development

We next investigated the content of CS/DS in larvae during early zebrafish embryo development. Glycosaminoglycans (GAGs) were isolated from zebrafish embryos at different developmental stages and the amount of CS/DS and HS quantified by RPIP-HPLC, as previously described (Ledin et al., 2004). At 24 hpf, each embryo on average contained 3 pmol CS/DS disaccharides, whereas at 6 dpf the content had increased to as much as 220 pmol CS/DS (Fig. 7). We further found that the content of CS/DS and HS in 2-hpf embryos is around one tenth of the content at 24 hpf (see inset, Fig. 7), and thus conclude that the CS/DS and HS content in a developing zebrafish embryo is primarily of zygotic and not maternal origin. The content of HS is similar to that of CS/DS at 24 hpf, but from 48 hpf and onwards the rate of CS/DS and HS accumulation differs distinctly as the CS/DS content increases dramatically while the HS content seemingly reaches a steady-state level (Fig. 7).

image

Figure 7. CS/DS and HS content at different zebrafish developmental stages as measured by RPIP-HPLC.

Download figure to PowerPoint

High Levels of CS/DS in Notochord and Cartilage During Development

Labeling of CS with the anti-CS antibody CS56 revealed a weak staining at 16 hpf (Fig. 8A) in accordance with the HPLC analysis (Fig. 7). Low levels of CS/DS may be present in several tissues, as suggested by the expression of CS/DS glycosyltransferases in various locations (Figs. 3-6) and the weak general immunolabeling of CS (see, e.g., the brain at 30 hpf; Fig. 8D). However, during early development, CS/DS biosynthesis appears to be particularly intense in the notochord and in the pharyngeal cartilage. CS/DS accumulates in the basement membrane surrounding the notochord (Fig. 8A–D) at a time coinciding with the expression of multiple CS/DS glycosyltransferase enzymes in this location (Figs. 3,4,6 and Table 1) as well as in the myosepta (Fig. 8C) (Dolez et al., 2011). Notably, the CS/DS glycosyltransferases are generally expressed in notochord cells, where staining often is accumulated in the central part, and not restricted to notochord sheath cells (Fig. 6B,D,G,I,J,L,M). Subsequently, strong immunolabeling of CS is predominantely found in pharyngeal cartilage and in the developing bone tissues (Fig. 8E and Eames et al., 2010). In the zebrafish larvae, Alcian blue staining of cartilage structures depends on CS/DS synthesis (Holmborn et al., 2012). The pharyngeal cartilage and the developing pectoral fins are strongly stained by Alcian blue from 3–6 dpf (Fig. 8F), correlating with a considerable increase of CS/DS accumulation (Fig. 7). Also, in these tissues, the large amounts of CS/DS are matched by increased expression levels of multiple CS/DS polymerizing enzymes (Figs. 4-6 and Table 1).

image

Figure 8. The notochord and cartilage structures are sites of CS/DS accumulation. A–D: Lateral views of zebrafish embryos and larvae showing CS deposition as detected with the CS-56 antibody. The notochord is weakly stained at 16 hpf (A) and more prominent CS deposition is seen at 24 hpf and 30 hpf (B–D). CS deposition in the myoseptum is shown in C, which is a magnification of the boxed area in B. Brain tissues are weakly stained at 30 hpf (D). E: CS is present in the pharyngeal cartilages (the Meckel's cartilage and the ceratohyal) and in dermal bones (the operculum and the cleithrum) at 5 dpf. F: Ventral and lateral views of a zebrafish embryo stained with Alcian blue to detect CS/DS at 2–6 dpf. B, brain; C, ceratohyal; CL, cleithrum; M Meckel's cartilage; MY, myoseptum; N, notochord; O, operculum.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

This study presents a detailed characterization of what most likely represents the complete set of enzymes involved in CS/DS polymerization during zebrafish development. We have identified single orthologous genes in zebrafish for five of them, designated csgalnact1, csgalnact2, chsy1, chsy3, and chpf2, whereas mammalian CHPF is represented by two copies in the zebrafish genome, named chpfa and chpfb (Fig. 2). In addition, four glycosyltransferase genes in lancelet Branchiostoma floridae have been identified. Detailed phylogenetic analysis revealed that vertebrate glycosyltransferases together with lancelet, fruitfly, and nematode enzymes form three subgroups of homologous genes: CSGALNACT, CHSY, and CHPF. The presence of the CS/DS glycosyltransferases genes in lancelet indicates that the duplication of genes in each subgroup took place after the cephalochordate–vertebrate split, which occurred around 650 million years ago (Panopoulou et al., 2003). This is in agreement with the previously postulated theory that amplification of gene numbers in vertebrates has occurred in the vertebrate lineage after its divergence from lancelet (Holland, 1999).

Izumikawa and coworkers have previously reported that coexpression of CS/DS glycosyltransferases in COS-1 cells results in a dramatic increase in CS/DS synthesis as compared to the expression of single enzymes (Izumikawa et al., 2008). Here, we show that most zebrafish CS/DS glycosyltransferases are expressed in the notochord cells during the segmentation period (Fig. 3 and Table 1) and that the notochord sheath is a major site of CS deposition during early developmental stages (Fig. 8). Similarly, all CS/DS glycosyltransferases are expressed at sites of cartilage formation such as the pharyngeal cartilage, the otic capsule, and the pectoral fins (Figs. 4-6 and Table 1). The simultaneous expression of many enzymes at sites with massive CS/DS deposition (Fig. 8) supports the results previously obtained using cell culture experiments (Izumikawa et al., 2008), suggesting that combinatorial expression of CS/DS polymerizing enzymes regulates CS/DS synthesis in the embryo. The CS/DS glycosyltransferases could possibly be gathered in pairs or in larger multi-component GAGosome complexes, analogous to what has been suggested for biosynthetic enzymes involved in HS biosynthesis (Esko and Selleck, 2002; Ledin et al., 2006; Presto et al., 2008; Victor et al., 2009).

Finally, we show that CS/DS to a large extent is synthesized by the zygote, and that the relative CS/DS content continues to increase after 48 hpf. In contrast, the HS content of the embryo remains stable after 48 hpf (Fig. 7). These results may suggest high turnover of HS-proteoglycans in the early embryo, while CS-proteoglycans instead accumulate to a greater extent in the extracellular matrix of developing cartilages. Alternatively, or in addition, the rate of CS/DS biosynthesis is significantly higher than the rate of HS biosynthesis during the period of cartilage formation.

EXPERIMENTAL PROCEDURES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Animals

Zebrafish (Danio rerio) WIK and AB strain embryos were obtained by natural spawning and maintained at 28.5°C in E3 medium (Nüsslein-Volhard and Dahm, 2002).

In Silico Analysis and Cloning of Zebrafish Chondroitin Sulfate Glycosyltransferases Genes

Amino acid sequences of the human CS/DS glycosyltransferase genes: CSGALNACT1 [UniProt: Q8TDX6], CSGALNACT2 [UniProt: Q8N6G5], CHPF [UniProt: Q8IZ52], CHPF2 [UniProt: Q9P2E5], CHSY1 [UniProt: Q86X52], and CHSY3 [UniProt: Q70JA7] (Prabhakar and Sasisekharan, 2006) were used as queries to identify similar zebrafish genes in the ENSEMBL database (http://www.ensembl.org/Multi/blastview). Seven putative sequences were found and six primer pairs (excluding primers for previously described CHSY1) (Li et al., 2010; Tian et al., 2010) were designed using Primer3, a web-based primer designing tool (Rozen and Skaletsky, 2000) to amplify selected sequences as follows:

F; ATGCTGCGCAGGGGTCTGCTGG and R; AGAAGTGGTAGCGTCCATCAAG for csgalnact1,

F; CCAGGGGAGCACTGATTACA and R;CCCGACAGCGGTACTATGAT for csgalnact2,

F; ATCCCATAGACATTGTGATCG and R; CCTGGACCACCCATACAGAA for chsy3, F; TGAGGAAACCTCAGTCATCCA and R; TTTCGTCTTAACATTGCAGCAT for chpf2,

F; CAGGAAGGTGATACAGTTTCAGG and R; CTTTCAGCATTGCGACTTCA for chpfa, F;GTGTAGCGACGCGGTTCT and R; TTGCTATTGTTTGCTGCTTGA for chpfb.

The PCR products were cloned into the pCR®2.1-TOPO vector.

Alignment and Phylogenetic Analysis

The amino acid sequences of the human CS/DS glycosyltransferases genes were used as queries for Blast searches in UniProtKB database (UniProtConsortium, 2012). Mouse, zebrafish, lancelet Branchiostoma floridae, fruit fly Drosophila melanogaster, and nematode Caenorhabditis elegans amino acid sequences with higher than 50% identity were collected into one fasta file and aligned with human sequences in ClustalX 2.1. The default ClustalW multiple sequence alignment parameters were applied (Thompson et al., 1994). The sequences were realigned and bootstrapped 100 times with the SEQBOOT tool from Win32 version of the Phylip 3.69 program package (Felsenstein, 1989). Protein distances were calculated with PROTDIST from Phylip 3.69. The Jones-Taylor-Thornton matrix was applied for calculation. The Neigbor-Joining trees were calculated from the 100 different distance matrices, previously generated with PROTDIST, using NEIGHBOR from Phylip 3.69. A majority rule consensus tree was constructed with CONSENSE (Phylip 3.69) and plotted using TreeView 1.6.6 (Page, 1996).

Note that all relevant information regarding the CS/DS glycosyltransferases available in the ENSEMBL, GenBank, RefSeq, and Zfin databases can be retrieved using above given UniProt reference numbers obtained from the Protein Knowledgebase (http://www.uniprot.org/).

Whole-Mount In Situ Hybridization of Zebrafish Embryos

In situ hybridisation was performed as previously described (Macdonald et al., 1994). Zebrafish embryos were fixed in buffer containing 4% paraformaldehyde in phosphate buffered saline (PBS), dehydrated with methanol and stored at −20°C until use. Before hybridization, embryos were rehydrated and treated with 5 μg/ml proteinase K in PBST (PBS, 0.1% Tween-20). Plasmids were linearized and antisense riboprobes were synthesized using either SP6 or T7 RNA polymerases and digoxigenin labeling mixes (Roche, Indianapolis, IN). After hybridization, riboprobes were detected using the BM Purple AP Substrate precipitating solution (Roche) according to the manufacturer's recommendations. Embryos were cleared in glycerol in PBS and photographed with a Leica MZFLIII microscope equipped with an ebq 100 camera. Processing of digitalized images was carried out using Adobe Photoshop and Adobe Illustrator. Whole-mount in situ embryos were embedded in 4% low melting agarose and sectioned using a vibrating blade microtome Leica VT1000S.

Antibody Staining

Embryos were fixed at 4°C during an overnight incubation in 4% paraformaldehyde (PFA) in PBS, permeabilized using increasing concentrations of methanol, and stored at −20°C. Before use, embryos were rehydrated and treated with 5 μg/ml proteinase K in PBST. After PBST washing and post-fixation with 4% PFA, embryos were incubated in blocking solution (1% bovine serum albumin, in PBST) at room temperature, followed by incubation with primary antibody (monoclonal anti-chondroitin sulfate CS-56, Sigma) diluted 1:250 overnight at 4°C. After several washes with PBST and a 30-min incubation with blocking solution, embryos were incubated with the secondary antibody Alexa-Flour 488 (Goat anti-mouse, Molecular probes, Invitrogen, Carlsbad, CA) diluted 1:100 overnight at 4°C followed by washing in PBST, post-fixation in 4% PFA for 20 min at room temperature, and cleared in glycerol in PBS.

Alcian Blue Staining

Embryos were fixed and stored as described above for antibody staining. After washing with PBST and bleaching with 30% hydrogen peroxide for 2 hr, embryos were washed with PBST and transferred into an Alcian blue solution (1% concentrated hydrochloric acid, 70% ethanol, 0.1% Alcian blue) and incubated overnight at room temperature. Specimens were then rinsed with acidic ethanol (5% concentrated hydrochloric acid, 70% ethanol). After these procedures, embryos were rehydrated in acidic ethanol of decreasing concentrations and finally cleared in glycerol in PBST.

Structural Analysis of Heparan and Chondroitin Sulfate Using Reversed Phase Ion-Pair (RPIP) HPLC

GAGs were isolated from duplicate or triplicate samples containing either 300 zebrafish embryos at the 4-cell stage, 225 embryos at 18 hpf, 120 embryos at 24 hpf, 250 embryos at 30 hpf, or 100 embryos at 2, 3, 4, 5, and 6 dpf. Structural analysis was carried out according to the previously published protocol (Ledin et al., 2004). Briefly, GAGs were isolated after proteolytic cleavage, nuclease treatment, and DEAE ion-exchange chromatography. The isolate was subjected to chondroitinase ABC treatment and 10% of the sample was saved for analysis of CS content. HS was purified from the GAG fraction by a second DEAE purification step before the isolated HS chains were cleaved with heparitinase I-III. The generated samples of HS and CS disaccharides were analyzed by RPIP-HPLC followed by post-column detection. By comparing the samples with HS and CS disaccharide standards, both the identity and the amount of the disaccharides were determined.

ACKNOWLEDGMENTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

This work was supported by grants from the Knut and Alice Wallenberg Foundation (to J.L.), the Swedish Research Council (to T.H., J.L., J.K., and L.K.), the Linnaeus Framework Grant “Genomics of Phenotypic Diversity in Natural Populations”(to J.L.), the Swedish Cancer Society (to J.K. and L.K.), the Swedish Childhood Cancer Foundation (to J.K.), the Swedish Foundation for Strategic Research (project no A3 05:207g; to J.K.), Polysackaridforskning AB (to J.K. and L.K.), and Uppsala University (to J.L., J.K. and L.K.).

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information
  • Cantarel BL, Coutinho PM, Rancurel C, Bernard T, Lombard V, Henrissat B. 2009. The Carbohydrate-Active EnZymes database (CAZy): an expert resource for Glycogenomics. Nucleic Acids Res 7:D233238.
  • Correia T, Papayannopoulos V, Panin V, Woronoff P, Jiang J, Vogt TF, Irvine KD. 2003. Molecular genetic analysis of the glycosyltransferase Fringe in Drosophila. Proc Natl Acad Sci USA 100:64046409.
  • Dolez M, Nicolas JF, Hirsinger E. 2011. Laminins, via heparan sulfate proteoglycans, participate in zebrafish myotome morphogenesis by modulating the pattern of Bmp responsiveness. Development 138:97106.
  • Esko JD, Selleck SB. 2002. Order out of chaos: assembly of ligand binding sites in heparan sulfate. Annu Rev Biochem 71:435471.
  • Esko JD, Kimata K, Lindahl U. 2009. Proteoglycans and sulfated Glycosaminoglycans. In: Varki A, Cummings RD, Esko JD, Freeze HF, Stanely P, Bertozzi CR, Hart WH, Marilynn EE, editors. Essentials of glycobiology. Cold Spring Harbor, NY: Cold Spring Laboratory Press.
  • Eames BF, Singer A, Smith GA, Wood ZA, Yan YL, He X, Polizzi SJ, Catchen JM, Rodriguez-Mari A, Linbo T, Raible DW, Postlethwait JH. 2010. UDP xylose synthase 1 is required for morphogenesis and histogenesis of the craniofacial skeleton. Dev Biol 341:400415.
  • Felsenstein J. 1989. PHYLIP: Phylogeny Inference Package (v. 3.2). Cladistics 5:164166.
  • Gotoh M, Yada T, Sato T, Akashima T, Iwasaki H, Mochizuki H, Inaba N, Togayachi A, Kudo T, Watanabe H, Kimata K, Narimatsu H. 2002. Molecular cloning and characterization of a novel chondroitin sulfate glucuronyltransferase that transfers glucuronic acid to N-acetylgalactosamine. J Biol Chem 277:3817938188.
  • Holland PW. 1999. Gene duplication: past, present and future. Semin Cell Dev Biol 10:541547.
  • Holmborn K, Habicher J, Kasza Z, Eriksson AS, Filipek-Gorniok B, Gopal S, Couchman JR, Ahlberg PE, Wiweger M, Spillmann D, Kreuger J, Ledin J. 2012. On the roles and regulation of chondroitin sulfate and heparan sulfate in zebrafish pharyngeal cartilage morphogenesis. J Biol Chem 287:3390533916.
  • Hwang HY, Olson SK, Esko JD, Horvitz HR. 2003. Caenorhabditis elegans early embryogenesis and vulval morphogenesis require chondroitin biosynthesis. Nature 423:439443.
  • Izumikawa T, Kitagawa H, Mizuguchi S, Nomura KH, Nomura K, Tamura J, Gengyo-Ando K, Mitani S, Sugahara K. 2004. Nematode chondroitin polymerizing factor showing cell-/organ-specific expression is indispensable for chondroitin synthesis and embryonic cell division. J Biol Chem 279:5375553761.
  • Izumikawa T, Uyama T, Okuura Y, Sugahara K, Kitagawa H. 2007. Involvement of chondroitin sulfate synthase-3 (chondroitin synthase-2) in chondroitin polymerization through its interaction with chondroitin synthase-1 or chondroitin-polymerizing factor. Biochem J 403:545552.
  • Izumikawa T, Koike T, Shiozawa S, Sugahara K, Tamura J, Kitagawa H. 2008. Identification of chondroitin sulfate glucuronyltransferase as chondroitin synthase-3 involved in chondroitin polymerization: chondroitin polymerization is achieved by multiple enzyme complexes consisting of chondroitin synthase family members. J Biol Chem 283:1139611406.
  • Izumikawa T, Kanagawa N, Watamoto Y, Okada M, Saeki M, Sakano M, Sugahara K, Sugihara K, Asano M, Kitagawa H. 2010. Impairment of embryonic cell division and glycosaminoglycan biosynthesis in glucuronyltransferase-I-deficient mice. J Biol Chem 285:1219012196.
  • Kitagawa H, Uyama T, Sugahara K. 2001. Molecular cloning and expression of a human chondroitin synthase. J Biol Chem 276:3872138726.
  • Kitagawa H, Izumikawa T, Uyama T, Sugahara K. 2003. Molecular cloning of a chondroitin polymerizing factor that cooperates with chondroitin synthase for chondroitin polymerization. J Biol Chem 278:2366623671.
  • Kusche-Gullberg M, Kjellen L. 2003. Sulfotransferases in glycosaminoglycan biosynthesis. Curr Opin Struct Biol 13:605611.
  • Ledin J, Staatz W, Li JP, Gotte M, Selleck S, Kjellen L, Spillmann D. 2004. Heparan sulfate structure in mice with genetically modified heparan sulfate production. J Biol Chem 279:4273242741.
  • Ledin J, Ringvall M, Thuveson M, Eriksson I, Wilen M, Kusche-Gullberg M, Forsberg E, Kjellen L. 2006. Enzymatically active N-deacetylase/N-sulfotransferase-2 is present in liver but does not contribute to heparan sulfate N-sulfation. J Biol Chem 281:3572735734.
  • Li Y, Laue K, Temtamy S, Aglan M, Kotan LD, Yigit G, Canan H, Pawlik B, Nurnberg G, Wakeling EL, Quarrell OW, Baessmann I, Lanktree MB, Yilmaz M, Hegele RA, Amr K, May KW, Nurnberg P, Topaloglu AK, Hammerschmidt M, Wollnik B. 2010. Temtamy preaxial brachydactyly syndrome is caused by loss-of-function mutations in chondroitin synthase 1, a potential target of BMP signaling. Am J Hum Genet 87:757767.
  • Macdonald R, Xu Q, Barth KA, Mikkola I, Holder N, Fjose A, Krauss S, Wilson SW. 1994. Regulatory gene expression boundaries demarcate sites of neuronal differentiation in the embryonic zebrafish forebrain. Neuron 13:10391053.
  • Maeda N, Ishii M, Nishimura K, Kamimura K. 2010. Functions of chondroitin sulfate and heparan sulfate in the developing brain. Neurochem Res 36:12281240.
  • McCormick C, Duncan G, Goutsos KT, Tufaro F. 2000. The putative tumor suppressors EXT1 and EXT2 form a stable complex that accumulates in the Golgi apparatus and catalyzes the synthesis of heparan sulfate. Proc Natl Acad Sci USA 97:668673.
  • Mizuguchi S, Uyama T, Kitagawa H, Nomura KH, Dejima K, Gengyo-Ando K, Mitani S, Sugahara K, Nomura K. 2003. Chondroitin proteoglycans are involved in cell division of Caenorhabditis elegans. Nature 423:443448.
  • Narimatsu H. 2006. Human glycogene cloning: focus on beta 3-glycosyltransferase and beta 4-glycosyltransferase families. Curr Opin Struct Biol 16:567575.
  • Nüsslein-Volhard C, Dahm R. 2002. Zebrafish: a practical approach. Oxford: Oxford University Press.
  • Olson SK, Bishop JR, Yates JR, Oegema K, Esko JD. 2006. Identification of novel chondroitin proteoglycans in Caenorhabditis elegans: embryonic cell division depends on CPG-1 and CPG-2. J Cell Biol 173:985994.
  • Page RD. 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12:357358.
  • Panopoulou G, Hennig S, Groth D, Krause A, Poustka AJ, Herwig R, Vingron M, Lehrach H. 2003. New evidence for genome-wide duplications at the origin of vertebrates using an amphioxus gene set and completed animal genomes. Genome Res 13:10561066.
  • Prabhakar V, Sasisekharan R. 2006. The biosynthesis and catabolism of galactosaminoglycans. Adv Pharmacol 53:69115.
  • Presto J, Thuveson M, Carlsson P, Busse M, Wilen M, Eriksson I, Kusche-Gullberg M, Kjellen L. 2008. Heparan sulfate biosynthesis enzymes EXT1 and EXT2 affect NDST1 expression and heparan sulfate sulfation. Proc Natl Acad Sci USA 105:47514756.
  • Rozen S, Skaletsky H. 2000. Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132:365386.
  • Sato T, Gotoh M, Kiyohara K, Akashima T, Iwasaki H, Kameyama A, Mochizuki H, Yada T, Inaba N, Togayachi A, Kudo T, Asada M, Watanabe H, Imamura T, Kimata K, Narimatsu H. 2003. Differential roles of two N-acetylgalactosaminyltransferases, CSGalNAcT-1, and a novel enzyme, CSGalNAcT-2. Initiation and elongation in synthesis of chondroitin sulfate. J Biol Chem 278:30633071.
  • Senay C, Lind T, Muguruma K, Tone Y, Kitagawa H, Sugahara K, Lidholt K, Lindahl U, Kusche-Gullberg M. 2000. The EXT1/EXT2 tumor suppressors: catalytic activities and role in heparan sulfate biosynthesis. EMBO Rep 1:282286.
  • Suzuki N, Toyoda H, Sano M, Nishiwaki K. 2006. Chondroitin acts in the guidance of gonadal distal tip cells in C. elegans. Dev Biol 300:635646.
  • Thisse B, Thisse C. 2004. Fast release clones: a high throughput expression analysis. ZFIN Direct Data Submission.
  • Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:46734680.
  • Tian J, Ling L, Shboul M, Lee H, O'Connor B, Merriman B, Nelson SF, Cool S, Ababneh OH, Al-Hadidy A, Masri A, Hamamy H, Reversade B. 2010. Loss of CHSY1, a secreted FRINGE enzyme, causes syndromic brachydactyly in humans via increased NOTCH signaling. Am J Hum Genet 87:768778.
  • UniProtConsortium. 2012. Reorganizing the protein space at the Universal Protein Resource (UniProt). Nucleic Acids Res 40:D7175.
  • Uyama T, Kitagawa H, Tamura Ji J, Sugahara K. 2002. Molecular cloning and expression of human chondroitin N-acetylgalactosaminyltransferase: the key enzyme for chain initiation and elongation of chondroitin/dermatan sulfate on the protein linkage region tetrasaccharide shared by heparin/heparan sulfate. J Biol Chem 277:88418846.
  • Uyama T, Kitagawa H, Tanaka J, Tamura J, Ogawa T, Sugahara K. 2003. Molecular cloning and expression of a second chondroitin N-acetylgalactosaminyltransferase involved in the initiation and elongation of chondroitin/dermatan sulfate. J Biol Chem 278:30723078.
  • Victor XV, Nguyen TK, Ethirajan M, Tran VM, Nguyen KV, Kuberan B. 2009. Investigating the elusive mechanism of glycosaminoglycan biosynthesis. J Biol Chem 284:2584225853.
  • Watanabe Y, Takeuchi K, Higa Onaga S, Sato M, Tsujita M, Abe M, Natsume R, Li M, Furuichi T, Saeki M, Izumikawa T, Hasegawa A, Yokoyama M, Ikegawa S, Sakimura K, Amizuka N, Kitagawa H, Igarashi M. 2010. Chondroitin sulfate N-acetylgalactosaminyltransferase-1 is required for normal cartilage development. Biochem J 432:4755.
  • Yada T, Gotoh M, Sato T, Shionyu M, Go M, Kaseyama H, Iwasaki H, Kikuchi N, Kwon YD, Togayachi A, Kudo T, Watanabe H, Narimatsu H, Kimata K. 2003. Chondroitin sulfate synthase-2. Molecular cloning and characterization of a novel human glycosyltransferase homologous to chondroitin sulfate glucuronyltransferase, which has dual enzymatic activities. J Biol Chem 278:3023530247.

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. RESULTS
  5. DISCUSSION
  6. EXPERIMENTAL PROCEDURES
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Additional supplementary information may be found in the online version of this article.

FilenameFormatSizeDescription
dvdy23981-sup-0001-suppinfo.pdf2325KSupp. Fig. S1. Structural relationship between the identified CS/DS glycosyltransferases. Alignments of CS/DS glycosyltransferases in the (A) CHPF, (B) CHSY, and (C) CSGALNACT families. White letters on black background indicate identical amino acid sequences, white letters on dark gray background indicate conserved sequences, black letters on light gray background indicate blocks of similar sequences. Red letters indicate the conserved motif present in members of the β4-glycosyltransferase family and green letters indicate conserved motifs specific for the β3-glycosyltransferase family (Narimatsu, 2006).

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.