Phylogeny and expression of canonical transient receptor potential (TRPC) genes in developing zebrafish

Authors


Abstract

Background: Canonical transient receptor potential (TRPC) channels are nonselective, calcium-permeable cation channels that are expressed in a great variety of organisms, tissues, and cell types. TRPC channels are known to be involved in the transduction of polymodal sensory input. Additionally, they are implicated in a variety of developmental processes. Distinct gating mechanisms have been elucidated so far, but their exact functional role in vertebrate organisms still needs to be resolved. Results: We now used the teleost Danio rerio to perform a comprehensive expression analysis of the trpc gene subfamily. Based on the sequence homology to the seven described mammalian TRPC channels, we identified 12 trpc genes in the zebrafish genome. All but trpc1 and trpc3 are represented by two paralogs. We further describe the specific expression patterns of trpc transcripts in whole-mounts during the first 5 days of development. Conclusions: Consistent with their proposed role in sensory transduction zebrafish trpcs are predominantly expressed in neural structures such as the olfactory, visual, mechanosensitive, and motor systems. Intriguingly, zebrafish paralogs show mainly nonoverlapping expression patterns, suggesting that duplicated genes have either split their functions or have adapted new ones. Developmental Dynamics 242:1427–1441, 2013. © 2013 Wiley Periodicals, Inc.

INTRODUCTION

Many physiological and cellular processes, such as changes in membrane potential and increase in intracellular calcium, rely on the action of ion channels. The transient receptor potential (TRP) channel proteins are a distinct superfamily of widely expressed, nonselective cation channels that comprises six subfamilies in mammals (Ramsey et al., 2006; Venkatachalam and Montell, 2007; Nilius and Owsianik, 2011). The subgroup of canonical TRP channels (TRPCs) has the closest homology to the original Drosophila trp gene, which when mutated lead to a transient receptor potential in the visual signal transduction cascade of the fruit fly and gave the whole family its name (Minke, 2010). Seven mammalian TRPC genes have been described so far, all of which code for channel proteins containing a short, hydrophobic, pore-forming sequence between the last two of the six transmembrane domains. Homo- or heterotetrameric assembly of TRPC subunits allows the generation of a large variety of functional channels with different properties and specificities. Heteromerization with more distantly related subunits of different subfamilies has also been described, adding even more diversity (summarized by Cheng et al., 2010). TRPCs have been shown to be expressed in a broad range of different tissues, in both excitable and nonexcitable cells (Kunert-Keil et al., 2006; Abramowitz and Birnbaumer, 2009). However, an extensive expression study localizing TRPC transcripts in a whole-mount organism has not yet been carried out.

Gating mechanisms of TRPC channels are the best understood among the TRP superfamily. Channel properties were most often studied in exogenous expression systems leading to sometimes contradictory findings regarding their mode of activation (Putney, 2004; Lev et al., 2012). But the main trigger for TRPC channels is phospholipase C (PLC)-dependent, receptor-operated activation downstream of G-protein coupled receptors (GPCR), or receptor tyrosine kinases. The subsequent generation of diacylglycerol and inositol triphosphate has been implicated in direct and indirect channel activation mechanisms, respectively (reviewed by Soboloff et al., 2007; Albert, 2011). Another model linking agonist-induced receptor activation to channel gating is the regulated delivery of the TRP protein to the plasma membrane (Bezzerides et al., 2004).

Recently, investigations in different organisms have shed light on functional implications of these cation channels. Many TRPC channels are involved in the integration of sensory information where they function as both external and internal sensors (reviewed in Clapham, 2003; Damann et al., 2008). Moreover, they play important roles during development by regulating aspects of apoptosis, neurite outgrowth, axon guidance, and synapse formation (summarized in Vennekens et al., 2012). Hence, it is not surprising that they have been linked to several human neurological diseases such as Parkinson's disease or cerebellar ataxia (Selvaraj et al., 2010). Due to their effect on proliferation and cell death, TRPC channels have also been linked to cancer (reviewed in Shapovalov et al., 2011). The vertebrate model organism zebrafish (Danio rerio) displays many features, including an established tool kit to study and manipulate gene expression and function as well as easy accessibility to neurons for electrophysiological recordings, which make it amenable for studies on TRPC channels.

A first step toward functional investigations, the thorough description of trpc genes and expression, is presented here. We report the identification of a total of 12 zebrafish orthologs. Moreover, whole-mount in situ hybridization (WISH) analyses of the entire trpc gene subfamily during the first 5 days of development enabled the description of distinct and dynamic expression patterns in diverse neural structures of zebrafish embryos and early larvae.

RESULTS AND DISCUSSION

The TRPC Family in the Zebrafish Danio rerio

Using the seven human and murine TRPC sequences as initial queries, we identified and annotated 12 trpc genes in the zebrafish genome (Fig. 1). Molecular cloning of the coding sequences confirmed that all of our annotated sequences are transcribed. Subsequent phylogenetic analysis indicated that all but trpc1 and trpc3 have retained duplicates after the teleost specific genome duplication (reviewed by Meyer and van de Peer, 2005). As duplicated genes are liberated from selective pressure due to initial functional redundancy, duplicates are often lost during evolution. However, the fact that many trpc genes have retained their duplicates indicates that the gene functions of these paralogs have diverged in so called sub- and/or neofunctionalization events (Postlethwait, 2007). To enable functional studies, we have now performed WISH experiments analyzing the expression patterns of canonical trp genes during embryonic and early larval development.

Figure 1.

Several of the zebrafish trpc genes have retained duplicates. TRPC amino acid sequences of the following species were used in phylogenetic reconstructions (hs = Homo sapiens; mm = Mus musculus, and dr = Danio rerio). While zebrafish TRPCs are shown in red, mouse TRPCs are given in light gray and human TRPCs in dark gray. The human TRPM1 gene, which shares approximately 20% homology with human TRPC5, was used as an outgroup to root the tree. Note that, except trpc1 and trpc3, the zebrafish has retained gene duplicates for all other trpcs.

Broad Expression of trpc1

Previous studies have described trpc1 expression in the zebrafish head, retina, inner ear, and outflow tract of the heart (Möller et al., 2008; Petko et al., 2009). We extend these previous expression studies by analyzing larvae 5 days postfertilization (dpf) and add new data to a more precise expression analysis in the brain. We observe transcripts of trpc1 to be distributed ubiquitously in the brain at 24 hr postfertilization (hpf) with stronger expression in the telencephalon and diencephalon as well as in presumptive cranial sensory ganglia (CSG), (Fig. 2A,B). Staining in cranial sensory ganglia becomes even more pronounced around the third day postfertilization (Fig. 2D,E) before it ceases by 5 dpf.

Figure 2.

Expression patterns of trpc1 in whole-mount zebrafish. A: Dorsal view of embryonic brain expression 24 hr postfertilization (hpf). B: Lateral close-up of trpc1 expression in CSG 24 hpf. C: Expression of trpc1 in the retinal neuroepithelium in higher magnification 48 hpf; anterior points to the top. D: Lateral view of a larva 3 days postfertilization (dpf) is shown with different focal planes in D and D′. E: Dorsal view of brain expression 3 dpf. F: Staining in the eye of larvae 3 dpf; anterior is up. G: Focus on expression in the habenulae 3 dpf in a dorsal view corresponding to the boxed region in E. Note the differential expression in the left (lHa) and right (rHa) habenula. H: Brain staining in a larva 5 dpf is shown in a lateral view. J.K: Dorsal views on larvae 5 dpf. More cells expressing trpc1 are present in the left compared with the right habenula. Anterior is to the left unless otherwise stated. CSG, cranial sensory ganglia; Die, diencephalon; GCL, ganglion cell layer; INL, inner nuclear layer; Tel, telencephalon; TeO, optic tectum; TG, trigeminal ganglia. Scale bars of 100 μm are indicated in the first picture of a series until changed. The scale bars = 50 μm in G,K.

Consistent with earlier reports, we detect retinal expression within the inner nuclear layer (INL) and ganglion cell layer (GCL). Expression is first observed at 48 hpf (Fig. 2C) and becomes prominent by day 3, when the formation of retinal layers commences (Fig 2D–F). trpc1-expressing cells are likely amacrine and retinal ganglion cells based on their location in the INL and GCL, respectively. In mice retinal expression of TRPC1 is strongly enriched in photoreceptor inner segments but also present in other retinal layers (Gilliam and Wensel, 2011). Promising candidates for upstream activators of TRPC1 are metabotropic glutamate receptors linked to the PLC pathway as well as sphingosine-1-phosphate receptors (Morgans et al., 2009; Shen et al., 2009; Koike et al., 2010; Gleason, 2012).

From 3 dpf onward, cells in the optic tectum (TeO) and both habenulae (Ha) start to express trpc1 (Fig. 2G–K). Of interest, expression in the habenulae is clearly asymmetric at 5 dpf, with higher expression levels in the left hemisphere (Fig. 2J,K). As the habenulae are known to be highly asymmetric structures with respect to their connectivity, development and molecular signature, differential gene expression patterns are often observed (reviewed by Roussigne et al., 2012). Moreover, various developmental processes such as cell proliferation, axonal pathfinding, synaptogenesis, and cell survival depend on calcium signaling trough store-operated calcium channels, and TRPC1 has been identified as an important contributing channel to these events (reviewed by Tai et al., 2009, Vennekens et al., 2012). In summary, the broad expression of trpc1 in the developing zebrafish brain suggests a role in neural development. Moreover, Yu and colleagues observed severe defects in angiogenic sprouting of intersegmental vessels upon gene knockdown of trpc1 (Yu et al., 2010).

Expression of trpc2 Paralogs in the Zebrafish Olfactory System

The teleost fish olfactory system consists of an olfactory epithelium (OE) containing both ciliated and microvillous olfactory sensory neurons (OSNs; reviewed by Touhara and Vosshall, 2009). Using a transgenic approach, Sato and colleagues have demonstrated that the two kinds of OSNs operate through distinct types of transduction machineries with microvillous OSNs relying on V2R receptor signaling upstream of TRPC2 channels (Sato et al., 2005). The gene sequence they used (NCBI GenBank accession number AY974804) corresponds to our trpc2a paralog. Consistent with their work, our analysis shows that OSNs start to express trpc2a from the first day of development up to at least 5 dpf (Fig. 3A–E). Expression of trpc2b shows a similar time course but is confined to a different subpopulation of OSNs comprising fewer cells located in the distal part of the OE (Fig. 3F–K).

Figure 3.

Expression of zebrafish trpc2 paralogs in the olfactory system. A–E: Images show transcript localization of trpc2a in the olfactory epithelium in frontal (A–C), lateral (D) and dorsal (E) views at the developmental stages indicated. F–H,J,K: Expression of trpc2b in a distal subpopulation of olfactory sensory neurons (OSNs) shown in frontal (F–H), lateral (J), and dorsal (K) whole-mount views. Scale bar = 100 μm in A (applies to all pictures shown).

In rodents, TRPC2 has been shown to play a crucial role in pheromone detection by the microvillous sensory neurons of the vomeronasal organ, which express genes of the V1R- or V2R-families of putative pheromone receptors as well as TRPC2 (Liman et al., 1999; Dulac and Torello, 2003). Several studies have shown remarkable defects in social and sexual behavior in TRPC2 deficient mice (Leypold et al., 2002; Stowers et al., 2002; Lucas et al., 2003). In contrast, human TRPC2 is only present as a pseudogene whose inactivation likely occurred during primate evolution (Liman and Innan, 2003). Even though zebrafish do not possess a vomeronasal organ, there is evidence that they use a wide range of chemicals as pheromone signals (Sorensen and Stacey, 2004; Hashiguchi et al., 2008). The physiological segregation of olfactory pathways in zebrafish points toward a functional separation in the perception of different chemical compounds, suggesting pheromone sensing to be mediated at least partially by trpc2-expressing microvillous OSNs. The identity of the V2R receptors acting upstream of the channel and especially activators of the signal transduction cascade remain to be determined.

trpc3 Is Expressed in Major Motor Components

Our in situ hybridization experiments revealed a highly dynamic expression of trpc3 during the first days of development. At 24 hpf, trpc3 is expressed in two small, bilateral cell clusters in the dorsal telencephalon and the ventral diencephalon (Fig. 4A,B). Further staining can be found in bilaterally arranged cells in rhombomeres 5 and 6 (R5, R6) and in a population of primary motor neurons aligned in a segmented manner along the spinal cord (Fig. 4C–E). At 48 hpf, expression in spinal motor neurons persists and several additional expression domains in the hindbrain become detectable, including staining in several clusters of presumptive reticulospinal neurons (Fig. 4F–J). Low levels of trpc3 transcripts are also detected in the pretectum (Pr) and the olfactory bulb (OB, Fig. 4F,G). Expression in sparse cells within the eye, located ventrally to and in proximity of the lens was detected transiently at 48 hpf (asterisks in Fig. 4K). Based on the location near the optic fissure and the temporally restricted expression, these cells might represent a subset of differentiating retinal neurons. At 3 dpf, only reticulospinal cell clusters and hindbrain motoneurons still express trpc3 (Fig. 4L). Expression drastically changes on the fifth day of development when it becomes confined to cerebellar regions including the cerebellar plate (CeP) and the valvula cerebelli (Va; Fig. 4M,N).

Figure 4.

Dynamic trpc3 expression in zebrafish whole-mounts. A: Shows an embryo 24 hr postfertilization (hpf) expressing trpc3 in different forebrain clusters. B: The bilateral neural clusters in the diencephalon expressing trpc3 are shown from dorsal. C: Dorsal view of the hindbrain region. Dashed lines mark approximate boundaries of rhombomeres 5 and 6 (R5, R6). D,E: Dorsal (D) and lateral (E) views of zebrafish tail region 24 hpf with expression in motoneurons. F,G: Expression in the brain at 48 hpf. Dotted field in F shows the same embryo in a different focal plane. F′ depicts a more dorsal plane of the hindbrain region. H,J: trpc3 staining in motoneurons 48 hpf in dorsal (H) and lateral (J) views. K: Lateral view on retinal cells (asterisks) expressing trpc3 transiently around 48 hpf. L: Hindbrain expression of trpc3 in larvae 3 days postfertilization (dpf). M,N: Cerebellar cell clusters expressing trpc3 at 5 dpf shown in dorsal (M) and lateral (N) views. Anterior is always left. CeP, cerebellar plate; Die, diencephalon; dTel, dorsal telencephalon; Mn, motoneurons; OB, olfactory bulb; Pr, pretectum; RSN, reticulospinal neurons; Va, valvula cerebelli. Scale bar = 100 μm in A (for all pictures without scale bar), C,K.

Reverse transcriptase-polymerase chain reaction (RT-PCR) and immunohistochemical analysis in mice located TRPC3 in the whole brain with especially high levels in cerebellar Purkinje cells (Huang et al., 2007; Hartmann et al., 2008). Of interest, mGluR1-mediated slow mixed-cation excitatory postsynaptic conductance is abolished in TRPC3 deficient mice, leading to a phenotype showing impairment of motor control and coordination (Rodríguez-Santiago et al., 2007; Hartmann et al., 2008; Becker et al., 2009). The fact that transcripts of all type I mGluRs (most prominently mglur1a) have been located to the zebrafish cerebellar region (Haug et al., 2013) suggests that mGluR1 signaling upstream of TRPC3 is a conserved mechanism.

Transcript Distribution of trpc4 Paralogs

Despite 70% sequence homology between the two zebrafish trpc4 paralogs, their expression patterns are very distinct and hardly overlapping, suggesting nonredundant functions. We found trpc4a to be expressed in the olfactory bulb (Fig. 5A–C). This is in line with observations showing that TRPC4 expression is especially high in the murine OB (Zechel et al., 2007; Dong et al., 2012). Detection of two types of group I mGluR transcripts (mglur1a and -5b) in zebrafish OB granule cells (Haug et al., 2013) raises the appealing possibility that TRPC4 channels could function downstream of these GPCRs and hence be implicated in modulation of odor signal processing. This hypothesis is further supported by findings showing that mGluR5 participates in the regulation of excitability of murine OB granule cells (Heinbockel et al., 2007), and that group I mGluRs are involved in synchronization and generation of slow rhythmic oscillations in the OB glomerular network (Dong et al., 2009). In addition, there is recent evidence that TRPC4 can be activated in an ionotropic NMDA-receptor-dependent pathway in OB granule cells (Stroh et al., 2012).

Figure 5.

Expression patterns of trpc4 paralogs during development. A–C: Expression of trpc4a was exclusively found in the olfactory bulb. Dorsal (A,B) and lateral (C) views of representative embryonic and larval stages are shown. D–G: Images showing trpc4b staining in embryonic head (D,E) and tail (F,G) region 24 hr postfertilization (hpf) were taken dorsally (D,F) and laterally (E,G). H,J: Whole-mount zebrafish 48 hpf, shown in dorsal (H) and lateral (J) views. Prime figures show the same embryo in different focal planes with H″ focusing on hindbrain expression. K–M: Lateral (K,M) and dorsal (L) views on trpc4b expression in 3 days postfertilization (dpf) whole-mount larvae. Dotted box in K has a more lateral focal plane compared with core image. L–L″: different focal planes of the same larva with L′ and L″ focusing on trigeminal and hindbrain expression, respectively. N: Expression of trpc4b spreads to all cranial sensory ganglia around 5 dpf. Anterior is always left. FSG, facial sensory ganglia; GSG, glossopharyngeal sensory ganglia; OB, olfactory bulb; P, pallium; RB, Rohon-Beard neurons; TG, trigeminal ganglia; VSG, vagal sensory ganglia. Scale bar = 100 μm in A (applies to all images if not otherwise indicated), F,G,M.

Cells expressing trpc4b mRNA are first observed in the trigeminal nuclei as early as 24 hpf (Fig. 5D,E). By 48 hpf, staining appears in the pallial region (Fig. 5H,J) and in the hindbrain (Fig. 5J″,L″). In early larvae, trpc4b expression in the head has expanded to additional cranial sensory ganglia, including now the trigeminal, glossopharyngeal, and vagal ganglia (Fig. 5 K,L,L′). While expression spreads to neurons in all epibranchial ganglia at the fifth day of development, pallial expression is down-regulated (Fig. 5N). Up to 3 dpf, high transcript levels are also apparent in Rohon-Beard neurons (RB, Fig. 5F,G,M).

RB neurons are a transient cell population, which is only present until approximately 3 dpf before they are replaced by dorsal root ganglia (DRGs) (Bernhardt et al., 1990). Of interest, quantitative RT-PCR analyses showed expression in trigeminal ganglia and additionally significant variations in the mRNA levels of TRPC4 between DRGs isolated from different segments of adult mice suggesting functional variability (Vandewauw et al., 2013). Both cell types, trigeminal and RB neurons, convey diverse sensory information delivered to the trunk and tail regions (Clarke et al., 1984; Sneddon, 2003). If and how TRPC4 is involved in somatosensory information processing in zebrafish is an interesting topic for future investigations.

Neural Expression of trpc5

Cloning of the trpc5a paralog was reported previously by Petko and colleagues (Petko et al., 2009). Their study aimed at identifying binding partners of neuronal calcium sensor-1, which is involved in inner ear development. However, no trpc5a expression was detected in the zebrafish ear. In analogy to their data, we found trpc5a transcripts in a subset of motoneurons in the hindbrain (Fig. 6A–C,G″). By 48 hpf, diffuse staining is visible in large parts of the diencephalon and in the caudal region of the telencephalon (Fig. 6C,D). In the hindbrain, a distinct pattern in various nuclei becomes apparent, probably including populations of reticulospinal neurons (Fig. 6D,F). In early larvae, expression in the eye can be detected most pronounced in the GCL, but also at lower levels in the INL (Fig. 6E). By 5 dpf, expression has spread to large parts of the brain, most prominently in the mid- and hindbrain. Widespread expression in the hindbrain, including a population of motoneurons located in rhombomere 8, can now be observed; however, the strongest staining is still seen in the nuclei of putative reticulospinal neurons. While riboprobes are now absent in the telencephalon, pronounced expression has started bilaterally in both habenulae (Fig. 6G,H).

Figure 6.

A–O: Transcript distribution of trpc5a (A–H) and trpc5b (J–O). A,B: Dorsal (A) and lateral (B) views on the hindbrain region of 24 hr postfertilization (hpf) embryos. C,D: trpc5a expression in brain regions and spinal cord of zebrafish 48 hpf shown dorsally (C) and laterally (D). E: Retinal expression in 3 days postfertilization (dpf) larvae, anterior is up. F: Dorsal view on hindbrain region showing expression in reticulospinal neurons (RSNs) at 3 dpf. G,H: Dorsal (G) and lateral (H) views on 5 dpf larvae with G, G′ and G″ showing different focal planes. J,K: Expression of trpc5b in the diencephalon and hindbrain. J and K show dorsal and lateral views, respectively. L,M: Lateral views on retinal trpc5b expression. N,O: Lateral (N) and dorsal (D) views of whole-mount in situ staining with white asterisks labeling midbrain cells expressing trpc5b 5 dpf. Prime images show different focal planes of the same larvae as in N and O, respectively. Black asterisks in J, K, N′, and O′ mark trpc5b-expressing cell clusters in the hindbrain. Die, diencephalon; GCL, ganglion cell layer; Ha, habenula; Hb, hindbrain; INL, inner nuclear layer; Mn, motoneurons; Tel, telencephalon; TeO, optic tectum. Scale bar = 100 μm in A (for all images without scale bar); 50 μm in E,L,M.

Expression of the trpc5b paralog is weak and diffuse during the first 2 days of development. Transcripts can be detected in large parts of the diencephalon, but to a weaker extend also in the telencephalon and the hindbrain (black asterisks in Fig. 6J,K). This expression remains essentially unchanged on the third day but additional staining can be detected in the retinal INL (Fig. 6L). By 5 dpf, retinal expression has become more prominent (Fig. 6M), and staining in two distinct bilateral midbrain (white asterisks in Fig. 6N,O) and hindbrain nuclei is visible (see black asterisks in Fig. 6N′,O′).

Based on studies in different model systems, a role in regulation of neurite length and growth cone morphology has been proposed for TRPC5 (summarized in Vennekens et al., 2012). The widespread distribution of both zebrafish orthologs in the embryonic and larval brain is consistent with such a function in neuronal development. We also found both trpc5 paralogs to be expressed in a similar pattern as trpc1 in the zebrafish retina. There seems to be at least a partial overlap of these different channel subunits in the inner retina. Of interest, the distribution of trpc5 paralogs differs with trpc5a showing elevated expression in the GCL and trpc5b being restricted to the INL, while trpc1 is equally expressed in both of these retinal layers. In general, there appears to be an important overlap of trpc5a and trpc1 expression domains also in other tissues (compare Fig. 6J–O with Fig. 2). This raises the possibility of heteromere formation by these two channel subunits. In heterologous expression systems, such an interaction has been demonstrated to form a functional channel with unique electrophysiological properties, distinct from any other TRPC homomere (Strübing et al., 2001).

Neural and Nonneural Expression of trpc6 Paralogs

Several mutations in human TRPC6 have been linked to kidney pathologies such as familial focal segmental glomerulosclerosis (Winn et al., 2005). In zebrafish, an earlier study failed to detect substantial levels of trpc6a transcripts in the kidney but could locate trpc6a expression to the head, pectoral fins, aortic endothelial cells, and gastrointestinal smooth muscle cells (Möller et al., 2008). We could not detect any trpc6 expression during the first 2 days of development. We found expression in the gut and the cloaca in early larvae (Fig. 7A,B); however, no staining in the pectoral fins and the aorta was observed. By 5 dpf, trpc6a mRNA staining was visible in the heart ventricle (Fig. 7C). Recent reports indicate that TRPC channels may play a key role in regulation of cardiac pacemaking, ventricular activity, and contractility in the developing chick heart (Sabourin et al., 2011). Furthermore, TRPC channels have been linked to several heart diseases including cardiac hypertrophy and heart failure (reviewed in Watanabe et al., 2009).

Figure 7.

A–G: Expression pattern of trpc6a (A–C) and trpc6b (D–G). trpc6a expression is not detectable before 3 days postfertilization (dpf). A: Lateral overview of WISH in a larva 3 dpf. B: Expression of trpc6a in the gut is shown in a lateral view. C: The heart ventricle (V) expresses the gene, too. Insert is a ventral view on the heart to compare with the lateral view in the main image. D: Expression of trpc6b is present in the hindbrain region 24 hr postfertilization (hpf), lateral view. E,F: Expression of trpc6b in embryos 48 hpf shown in dorsal (E) and lateral (F) views. G: Dorsal head view on the expression in larvae 3 dpf. Anterior is always left. Cl, cloaca; Va, anterior clusters of trigeminal motor neurons; Vp, posterior clusters of trigeminal motor neurons. Scale bar = 100 μm in A (for all pictures of not otherwise indicated), B,G.

Expression of trpc6b is restricted to two clusters in the hindbrain, likely the anterior and posterior motor nuclei of branchiomeric nerve V (Fig. 7D–G). This expression pattern is already visible at 24 hpf and remains stable up to 3 dpf. On the fifth day of development, expression of trpc6b is not detectable anymore. The temporally restricted expression of trpc6b points to a possible role in development. Axons arising from the two bilateral trigeminal motor nuclei located in the hindbrain innervate the mandibular arch muscles (Higashijima et al., 2000). In neural cell culture experiments using rat pheochromocytoma 12 cells, TRPC6 and TRPC1 have been reported to balance neurite outgrowth velocity thereby maintaining optimal conditions for establishing functional neuronal networks (Kumar et al., 2012). Axonal outgrowth from the zebrafish trigeminal motor neurons starts approximately 28 hpf, and axons reach their targets around 72 hpf (Higashijima et al., 2000) matching the timing of trpc6b expression.

Transcript Distribution of the trpc7 Paralogs

TRPC7 is the most recently cloned member of the canonical subfamily of TRP channels. In mice, Northern blot analysis demonstrated high expression levels in the heart, lung, and eye. Tissue samples from the brain, spleen, and testes contain lower levels of TRPC7 mRNA (Okada et al., 1999). Expression of human TRPC7 is highly enriched in the pituitary and kidney, but was also found in brain tissues by RT-PCR (Riccio et al., 2002).

Zebrafish TRPC7 has not been characterized previously. We identified two paralogs with nonoverlapping expression patterns. A small subset of cells located in the proximal part of the ventral OE expresses trpc7a (Fig. 8A–H). These cells presumably represent a subpopulation of OSNs distinct from the trpc2a- or trpc2b-expressing population (compare Fig. 8A–H with Fig. 3). The expression starts on the first day of development and is maintained at least up to 5 dpf. Between 2 and 3 dpf, trpc7a transcripts are transiently observed in some midbrain cell clusters (see asterisks in Fig. 8C,D,F).

Figure 8.

A–P: Whole-mount in situ hybridization of zebrafish trpc7a (A–H) and trpc7b (J–P). A–D: trpc7a-expressing olfactory sensory neurons (OSNs) in embryos shown laterally (A,C) and dorsally (B,D). Asterisks mark expression domains in the midbrain. The focal plane in D′ differs from D. E,F: Frontal (E) and ventral (F) views on 3 days postfertilization (dpf) whole-mount larvae, F′ shows a different focus to F. Asterisk in F′ labels midbrain cell clusters expressing trpc7a transiently. G,H: Dorsal (G) and frontal (H) views on larvae 5 dpf. J,K: Dorsal (J) and lateral (K) view of the telencephalic cell clusters expressing trpc7b in embryos 24 hr postfertilization (hpf). L,M: Expression of trpc7b as detected in zebrafish 48 hpf shown in dorsal (L) and lateral (M) views. Focus in L′ is more dorsal compared with L. N,O: Expression in 3 dpf larvae, shown in dorsal (N) and lateral (O, O′) views. P: Dorsal whole-mount view on trpc7b expression in larvae 5 dpf. Die, diencephalon; dTel, dorsal telencephalon; Hb, hindbrain; Mn, motoneurons; RSN, reticulospinal neurons. Scale bar = 100 μm in A (applies to all images without scale bar), L′, P.

While expression of trpc7b is first found bilaterally in the dorsal telencephalic region 24 hpf (Fig. 8J,K), expression domains including bilateral nuclei in the diencephalon as well as reticulospinal cell clusters and motoneurons in the hindbrain were observed in later developmental stages (Fig. 8L–O). Starting at 3 dpf, a prominent staining in the rostral hindbrain is detected (Fig. 8N–P). Most expression domains vanish after 3 dpf but the hindbrain cell clusters persist at least until 5 dpf.

Comparing our expression analysis to previously published reports (Okada et al., 1999; Riccio et al., 2002) suggests that trpc7 expression in the brain is conserved among vertebrates. It has been reported that TRPC7 prefers to form heteromers and builds for example functional channels with TRPC1 and TRPC3 in heterologous expression systems (Lievremont et al., 2004; Zagranichnaya et al., 2005). A recent study suggested that a heteromeric TRPC6/7 channel is involved in the depolarization of intrinsically photosensitive retinal ganglion cells (Xue et al., 2011). These specialized cells serve in the retina for nonimage forming visual functions, such as the entrainment of biological rhythms. However, the existence of equivalent cells in the zebrafish retina is still under debate (Matos-Cruz et al., 2011). As several trpc channels show overlapping expression domains with trpc7 in zebrafish, heteromeric channel formation seems likely. Unfortunately, functional studies of TRPC7 might be complicated by this fact.

Various aspects of sensory and motor processing in developing zebrafish seem to rely partially on signaling through canonical TRP channels. The dynamic spatial and temporal expression patterns of trpcs hint at an involvement in developmental processes. Table 1 represents an overview of zebrafish trpc expression in all examined stages. Of interest, with the exception of trpc6a, the detectable expression of the entire zebrafish trpc subfamily seems to be confined to the nervous system during development even though the possibility of an expression in nonneural structures cannot be completely ruled out. Notably, maybe with the exception of broadly expressed trpc5 genes, all other identified trpc paralogs show an entirely nonoverlapping expression pattern strongly arguing for neo- and/or subfunctionalization events during zebrafish evolution (Postlethwait, 2007). However, functional studies of TRPC channels have not been done so far, and it remains to be determined where functional shifts indeed occur in this animal.

Table 1. Overview of Zebrafish trpc Expression Domains During the First 5 Days of Developmenta
Gene24 hpf48 hpf3 dpf5 dpfMammalian mRNA expression
  1. a

    Mammalian expression from references cited in the text was added for comparisons.

t rpc1brain (ubiquitous), cranial sensory ganglia (CSG)brain (ubiquitous), cranial sensory ganglia, retinal neuroepitheliumbrain (ubiquitous), cranial sensory ganglia, retina: ganglion cell layer (GCL) and inner nuclear layer (INL)brain (ubiquitous), cranial sensory ganglia, retina: ganglion cell layer and inner nuclear layerbrain, kidney, lung, skeletal muscle (Kunert-Keil et al., 2006), retina (Gilliam and Wensel, 2011), ubiquitous (Nilius and Owsianik, 2011)
trpc2aolfactory sensory neurons (microvillous)olfactory sensory neurons (microvillous)olfactory sensory neurons (microvillous)olfactory sensory neurons (microvillous)mouse vomeronasal sensory neurons (Liman et al., 1999)
trpc2bolfactory sensory neuronsolfactory sensory neuronsolfactory sensory neuronsolfactory sensory neurons
trpc3dorsal telencephalon (dTel), diencephalon, rhombomeres 5/6, motoneurons (Mn)pretectum (Pr), olfactory bulb (OB), retinal neuroepithelial cells, reticulospinal neurons (RSN), motoneuronsreticulospinal neurons, motoneuronscerebellum (CeP & Va)brain (Huang et al., 2007; Hartmann et al., 2008)
trpc4aolfactory bulbolfactory bulbolfactory bulbolfactory bulbbrain (Vennekens et al., 2012), olfactory bulb (Zechel et al., 2007; Dong et al., 2012), trigeminal and dorsal root ganglia (Vandewauw et al., 2013)
trpc4btrigeminal ganglia (TG), Rohon-Beard neurons (RB)pallium (P), trigeminal ganglia, Rohon-Beard neuronspallium, cranial sensory ganglia, Rohon-Beard neuronscranial sensory ganglia
trpc5amotoneuronsbrain, reticulospinal neurons, motoneuronsbrain, reticulospinal neurons, motoneurons, retina: INL, GCLbrain, reticulospinal neurons, motoneurons, retina: INL, GCLWhole brain, especially fetal brain (summarized in Nilius and Owsianik, 2011; Vennekens et al., 2012)
trpc5bbrainbrainbrain, retina: INLbrain, retina: INL
trpc6ano expression detectableno expression detectablegut, cloaca (Cl)heart ventricle (V)brain, heart, kidney, lung, smooth muscle cells (Kunert-Keil et al., 2006), spleen, ovary, small intestine, neutrophils (reviewed in Nilius and Owsianik, 2011)
trpc6btrigeminal motor nucleitrigeminal motor nucleitrigeminal motor nucleino expression detectable
trpc7aolfactory sensory neuronsolfactory sensory neurons, midbrain cell clusterolfactory sensory neurons, midbrain cell clusterolfactory sensory neuronsPituitary, kidney, heart, lung, brain (Okada et al., 1999; Riccio et al., 2002)
trpc7bdispersed neural clusters in the brainbrain, reticulospinal neurons, motoneuronsbrain, reticulospinal neurons, motoneuronshindbrain nuclei

EXPERIMENTAL PROCEDURES

Fish Maintenance and Breeding

Zebrafish (Danio rerio) were kept at a 14:10 hr light/dark cycle at 28°C as previously described (Westerfield, 2007). Embryos of WIK wild-type fish were raised in E3 medium containing 0.01% methylene blue as well as 0.2 mM PTU (1-phenyl-2-thiourea; Sigma-Aldrich) to avoid pigmentation.

Annotation of trpc cDNAs

As gene predictions within GenBank are produced by automated processes which have been shown to contain numerous errors, trpc cDNA sequences used in this study were manually annotated. Sequences were identified and annotated using combined information from expressed sequence tags and genome databases (GenBank, http://www.ncbi.nlm.nih.gov; Ensembl, http://www.ensembl.org/index.html). Human and mouse sequences were used as initial query (for more details on sequence annotation see Gesemann et al., 2010).

Phylogeny

The phylogenetic analysis was performed on the Phylogeny.fr platform (http://www.phylogeny.fr/) comprising the following steps (Dereeper et al., 2008). Sequences were aligned using MUSCLE (v3.7) (Edgar, 2004) configured for highest accuracy (MUSCLE with default settings). Sequences length varied between 793 and 1602 amino acids. After alignment, ambiguous regions (i.e., containing gaps and/or poorly aligned) were removed using Gblocks (v0.91b) (Castresana, 2000). The following parameters were implemented. The minimum length of a block after gap cleaning was set to 5; positions with a gap in less than 50% of the sequences were selected in the final alignment if they were within an appropriate block; all segments with contiguous nonconserved positions bigger than 8 were rejected; minimum number of sequences for a flank position were 55%. After curation, 451 amino acids were chosen for further analysis. The phylogenetic tree was reconstructed using the maximum likelihood method implemented in the PhyML program (v3.0 aLRT) (Guindon and Gascuel, 2003). The default substitution model was selected assuming an estimated proportion of invariant sites (of 0.000) and four gamma-distributed rate categories to account for rate heterogeneity across sites. The gamma shape parameter was estimated directly from the data (gamma = 0.728). Reliability for internal branch was assessed using the aLRT test (Anisimova and Gascuel, 2006). Graphical representation and edition of the phylogenetic tree were performed with TreeDyn (v198.3) and the svg file imported into CoralDraw (version X5; Coral Corporation Ottawa, Canada) for final editing.

Cloning of trpc Genes and In Situ Probe Synthesis

Total RNA was extracted from WIK larvae at 5 dpf using the RNeasy Mini kit (Qiagen) and cDNA was synthesized using the SuperScript II Reverse Transcriptase kit (Invitrogen) following the manual. To isolate sequences of interest from each trpc gene, specific primers were designed and used for polymerase chain reaction (PCR) amplification with the Jump Start Taq Polymerase kit (Sigma). Forward and reverse primers for PCR amplification of in situ probes are listed in Table 2. Appropriately sized PCR products were purified with the Nucleo Spin Extract II kit (Macherey-Nagel) and subcloned into the pCR II vector (TOPO TA Cloning Kit, Invitrogen). The resultant plasmids were transformed into TOP10 Escherichia coli cells, and at least three independent clones were sequenced to confirm annotated trpc sequences. Our sequences were subsequently submitted to GenBank under the following accession numbers: trpc1 KF446627, trpc2a KF446628, trpc2b KF446629, trpc3 KF446630, trpc4a KF446631, trpc4b KF446632, trpc5a KF446633, trpc5b KF446634, trpc6a KF446635, trpc6b KF446636, trpc7a KF446637, and trpc7b KF446638. Plasmids were linearized with the appropriate restriction enzymes and sense and antisense in vitro transcription for RNA probe preparation was performed in the presence of digoxigenin (DIG) coupled nucleotides (Roche). Longer RNA probes (trpc2a and b; trpc3; trpc4a, and b) were subsequently hydrolyzed with 200 mM Na2Co3 and 200 mM NaHCO3 to yield fragments of approximately 500–600 nucleotides in length. For in situ hybridization experiments, probes were diluted to a concentration of approximately 4 ng/μl.

Table 2. Primer List for the Generation of In Situ Hybridization Probesa
GeneForward primer 5'-3'Reverse primer 5'-3'Length
  1. a

    trpc1, trpc5a, trpc5b, and trpc6a have two probes, which were both used in the WISH experiment.

trpc1 probe1TCAGTGCTTTGCCGTATTCCTTGGCAAGTTCTTCATAATC776 bp
trpc1 probe2CTGCTAGTGCTCATCTCTTTCCATGCTGGGTCACTTTAAA836 bp
trpc2aGCACGTTCCAAGCTTTACCGGATTTAATTGTAATATTGTG1490 bp
trpc2bCGAACCACTTGGAAACTGGCTTGTTTTTCAGGAATGG1618 bp
trpc3GGTCTTCGGGAGCAAACCAGTGCTGATGCTCATGG1535 bp
trpc4aGTGGGATGGTGGATTTCAGCCGTGGTTACAAAAGAAAG2518 bp
trpc4bGAACTCAGACTGCAAAAACGCTGCTAGTTTCACCTTCATTTC2611 bp
trpc5a probe1CTCAAGGAGCTCAGCAAAGGGCGATGGCAAACAAAG778 bp
trpc5a probe2GCCAAGGGCGTCTCTTTCAGGATCGGTTGTCGTTAAG799 bp
trpc5b probe1TGTGCCGTCTCATTCAAAGCTACGCGCCTGATCAAGAAG816 bp
trpc5b probe2AGAGCCCAACAACTGCAAAGCAAGCCTGTGGTTTCTTTC1755 bp
trpc6a probe1GAAAGGATGAATCAAAGAAGAGCAAGGATGCGAGCTCATTG874 bp
trpc6a probe2CGGCCTCCTTTACTATTTTCCGATGACCACTGTGACATTG1816 bp
trpc6bCGCTGACCGTTTTGAAGGCGATGAGCATGTTGAGTAAG1786 bp
trpc7aATGGTCTTTCTTGCCTTCATGGCTCTAGGACACTTTCAGCTAC1836 bp
trpc7bACCACCCTGCGAGAGAAGAGAACGCCCACCACAAAG791 bp

Whole-Mount In Situ Hybridization

Whole-mount in situ hybridization was performed as described by (Thisse and Thisse, 2008) with the following adaptations. Larvae 3 and 5 dpf were permeabilized by proteinase K treatment for 60 and 90 min, respectively. Temperature for hybridization and stringency washes was 65°C for all probes. A 1% Roche blocking reagent was used for blocking and dilution of alkaline-phosphatase-conjugated anti-DIG antibody 1:5,000 (Roche). The staining solution contained 1mM levamisol to quench endogenous peroxidase activity.

Imaging

To enhance visibility under the microscope, the yolk was gently removed before mounting on an adapted glass slide in 100% glycerol. Images of embryos were taken using a light microscope (BX61, Olympus) with DIC filter and a CCD camera (ColorView III, Olympus). Adobe Photoshop and Adobe Illustrator software were used to adjust levels and assemble figures, respectively.

ACKNOWLEDGMENTS

We thank Kara Dannenhauer for expert maintenance of zebrafish and technical assistance, and members of our laboratory for discussion. E.K. was funded by EMBO.

Ancillary