SEARCH

SEARCH BY CITATION

Keywords:

  • micropropagation;
  • MEP pathway;
  • rebaudioside A;
  • Stevioside

ABSTRACT

  1. Top of page
  2. ABSTRACT
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgment
  8. References

Background: Stevioside is a diterpene glycoside found in Stevia rebaudiana Bertoni (Asteraceae) and is 200–300 times sweeter than sucrose. It is synthesized through a plastid localized 2-C-methyl-D-erythritol-4-phosphate (MEP) pathway. Fifteen genes are involved in the formation of steviol glycosides (stevioside and rebaudioside A). In the present investigation, micropropagated plants were allowed to harden for one month during which transcriptional profiling of candidate genes was carried out. Sampling from all the plants was carried out during hardening at different time intervals (day 10, 20, and 30) along with control plants (day 0). Stevioside content was also measured. Results: Of 15 genes, 9 were up-regulated two-fold or greater. Nine genes were expressed at higher levels after 30 days than in the untreated controls. Moreover, these transcriptional differences were correlated with a significant enhancement in stevioside content from 0- (11.48%) to 30- (13.57%) day-old plants. Conclusions: MEP pathway genes in stevia are expressed at higher levels during hardening, a change to vegetative growth from reproductive growth. Although there were higher transcript levels of candidate genes at the initial phase of hardening, the highest stevioside content was found after 30 days of hardening, suggesting translational/posttranslational regulatory mechanisms. Developmental Dynamics 243:1067–1073, 2014. © 2014 Wiley Periodicals, Inc.


Introduction

  1. Top of page
  2. ABSTRACT
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgment
  8. References

Three species of plants Stevia rebaudiana, Chinese sweet tea (Rubus sauvissimus S.), and the Japanese perennial herb Angelica keiskei contain the natural, low caloric sweetening agents known as steviol glycosides (SGs) (Richman et al., 1999; Ceunen and Geuns, 2013a). Although it was previously reported that Stevia phlebophylla contained SGs, these could not be detected by Ceunen and Geuns (2013a). They found similar compounds but no SGs. Structurally, steviosides are very similar to the plant growth hormone gibberellic acid. The concentrations of SGs are 10,000 times higher than gibberellic acid, which shows the major effort plants take to form SGs. The major SGs are steviolmonoside, steviolbioside, stevioside. and rebaudioside-A. Stevioside is the most abundant and has 143-fold the sweetening power as normal sucrose, whereas rebaudioside-A is up to 320 times sweeter but lower in abundance (Richman et al., 1999). The World Health Organization (WHO) has accepted SGs as a dietary supplement at a concentration of 0–4 mg per kg of body weight (Beneford et al., 2006). Apart from these SGs, plants also contain other secondary metabolites including alkaloids, phenolics, and flavonoids with potential medicinal properties for the treatment of hypertension, hyperglycemia, and rotavirus. SGs from Stevia rebaudiana are also used in food industries to sweeten soft drinks, soy sauce, yogurt, and other foods in Japan, Korea, and Brazil (Tadhani et al., 2007).

SGs share a common pathway with gibberellic acid (GA3) as they are terpenoid and both are derived from the 2-C-Methyl-d-erythritol-4-phosphate (MEP) pathway (Fig. 1) also known as the MEP pathway. This pathway takes place within plastids and mainly in leaves (Brandle and Telmer, 2007). Not all the genes involved in the glycosylation of steviol are characterized, but a few major genes have been characterized biochemically. In addition, new SGs in which the sugar units were rhamnose and xylose were reported recently (Ceunen and Geuns, 2013a). The gene responsible for the synthesis of steviolbioside, which is shown as UGT in Figure 1, has not been completely characterized yet.

image

Figure 1. The MEP pathway leading to the formation of steviol glycosides in Stevia rebaudiana Bertoni. Each enzyme involved in the pathway is denoted by a number.

Download figure to PowerPoint

The conventional methods of plant propagation through seeds or cuttings are less reliable than micropropagation methods (Mitra and Pal, 2007). Formation of SGs varies greatly with the treatment of growth regulators like gibberellic acid (Modi et al., 2011; Hajihashemi et al., 2013), treatment with chemicals like paclobutrazol, polyethylene glycol (PEG), and methyl jasmonate (Kumar et al., 2011; Hajihashemi et al., 2013), the day length and axial position of leaves on plants (Mohamed et al., 2011; Ceunen and Geuns, 2013b), and most importantly during ontogeny (Ceunen and Geuns, 2013c). Likewise, the diterpene glycoside content and the transcript accumulation patterns of biosynthesis genes also vary with the developmental stage of a plant, and this has been observed in tomato (Scolnik and Giuliano, 1994), Arabidopsis (Che et al., 2006), and cotton (Ghazi et al., 2009).

Methods such as determining the relative gene transcript accumulation profiles of a secondary metabolite biosynthesis pathway should be conducted in the laboratory or greenhouse to minimize the variation caused by environmental factors. The aim of the present investigation was to determine the stages with the highest transcript levels of candidate genes. Therefore, we designed an experiment to study the relative transcript profiles of all the genes involved in the biosynthesis of steviol glycosides in leaves of plants collected at different time intervals.

Results

  1. Top of page
  2. ABSTRACT
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgment
  8. References

Hardened stevia plants showed increased vigor (visually) from the time that hardening was initiated to 30-day-old plants (Fig. 2). Transcript accumulation profiling of fifteen genes revealed two categories, i.e., genes which showed up regulation in all the treatments, and genes with a differential pattern of transcript accumulation (up/down regulation in one/more treatments). Transcript levels of these genes were calculated with the reference gene ubiquitin (Fig. 3) which showed a single gene product and no amplification in the no template control (Fig. 4). Similar results were observed in all the samples for the candidate genes (data not shown). A detailed description of these genes is summarized below.

image

Figure 2. Representative plants of Stevia rebaudiana Bertoni at different times during hardening.

Download figure to PowerPoint

image

Figure 3. Deviation value plot of three endogenous control genes viz., ACT, UBQ, and GAPDH in all the treatments. Values in the bracket represent standard deviation of respective genes.

Download figure to PowerPoint

image

Figure 4. Melt curve analysis showing single product and no product in all the samples and No Template Control (NTC), respectively, for the endogenous control gene (ubiquitin) in leaf samples of Stevia rebaudiana Bertoni.

Download figure to PowerPoint

Consistently Up-regulated Genes

Nine genes showed up-regulation during hardening in which the highest transcript accumulation was seen in 10-day-old plants then the transcript accumulation level decreased but was still higher than control plants, and the transcript level again increased in 30-day-old plants. This phenomenon was observed with the DXS, DXR, MCS, HDS, HDR, GGDPS, KS, KAH, and UGT74G1 genes (Fig. 5). Among the up-regulated genes, three genes (CDPS, KO, and UGT76G1) showed a slightly different pattern of transcript accumulation in which after the initial increase in transcript levels, the levels gradually decreased with time (Fig. 6a).

image

Figure 5. Relative quantification (RQ) plot of nine up-regulated genes viz., DXS, DXR, MCS, HDS, HDR, GGDPS, KS, KAH, and UGT74G1 in leaf samples of Stevia rebaudiana Bertoni.

Download figure to PowerPoint

image

Figure 6. Relative quantification (RQ) plot of (A) three up-regulated genes viz., CDPS, KO, and UGT76G1 and (B) three differentially expressed genes viz., CMS, CMK, and UGT85C2 in leaf samples of Stevia rebaudiana Bertoni.

Download figure to PowerPoint

Differentially Expressed Genes

The remaining three genes viz., CMS, CMK, and UGT85C2 showed a different response. For example, CMS showed up-regulation in 10 day old plants, but levels in 20- and 30-day-old plants were similar to untreated controls (Fig. 6b). Relative accumulation of CMK gene transcripts in 10-day-old plants showed more than a 23-fold change as compared to control; however, the transcript accumulation level decreased just as quickly with these time points. A similar pattern of transcript accumulation was also observed with both CMK and UGT85C2 in 30-day-old plants, with 0.83- and 0.70-fold changes, respectively.

Stevioside Content

A calibration curve for stevioside was obtained from six levels of standards as described in Experimental Procedures section. The results showed an R2 value of 0.9997 (Fig. 7) and thus the line equation derived from the graph was used further for the quantification of stevioside from all the samples. The stevioside concentration was found to increase during the hardening time course. The lowest concentration was recorded in 0-day-old plants (11.5%) and the highest in 30-day-old plants (13.6%). A statistically significant enhancement in the stevioside content was observed only in leaves of 30-day-old hardened plants (Table 1).

image

Figure 7. Calibration curve for the linearity study of stevioside standards showing R2 value and line equation (y = mx + c).

Download figure to PowerPoint

Table 1. Stevioside Content in Leaves of Stevia Plants Harvested at 0, 10, 20 and 30 Days After Initiation of Hardening
Sr. no.TreatmentStevioside content (% dry weight ± SD)
1T-0 (0 days old-control plants)11.48 ± 0.46
2T-1 (10 days old plants)12.06 ± 0.94
3T-2 (20 days old plants)12.58 ± 1.71
4T-3 (30 days old plants)13.57 ± 1.21
5S. Em.0.48
6C.D.0.051.41
7CV %8.10

Discussion

  1. Top of page
  2. ABSTRACT
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgment
  8. References

In the present investigation, genes of the stevioside biosynthesis pathway in Stevia rebaudiana Bertoni, during the hardening phase of micropropagation, showed two kinds of transcript accumulation patterns viz., up-regulation and then different rates of down-regulation. Among the up-regulated genes, the highest levels of transcript were observed in the leaves of the plants collected at an early stage of hardening (10 days) and then the levels gradually decreased followed by a slight increase/decrease in the transcript levels. Increased transcript accumulation patterns during hardening suggest increased accumulation of secondary metabolites synthesized by the pathway. However, stevioside content was enhanced significantly only after 30 days of hardening and the value remained consistent after 10 and 20 days, the result of which is in contradiction with the transcript accumulation pattern of the corresponding gene (UGT74G1) in which an almost two-fold change was observed in 10-day-old plants and subsequent samples showed almost the same level of transcript accumulation as found in control plants. This phenomenon suggests that there might be some regulatory mechanisms at the translational level which need further investigation. Similar results were obtained by Jiang et al. (2013) who examined different stages of leaf development of tea plants, and found that flavonol glycoside content was increased. Similar results were obtained in the experiments conducted by Mir et al. (2012) in which they studied crocin, picrocrocin, and safranal content in saffron during three developmental stages of stigma viz., yellow, orange, and scarlet stage of stigma. They observed that all the three compounds were increased significantly from the yellow to orange and orange to scarlet stages. However, they found a correlation with the transcript accumulation pattern of the gene CsZCD during stigma development. In the present investigation, most of the genes of the MEP pathway are up-regulated during initial stages of hardening that establish vegetative growth. Stevia plants showed reduced levels of sweeteners when transitioning from vegetative stage to the reproductive stage (Ceunen and Geuns, 2013c). Thus, higher accumulation of transcripts of these genes is expected at the early stage of hardening.

Experimental Procedures

  1. Top of page
  2. ABSTRACT
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgment
  8. References

Plant Materials and Treatments

Stevia plants were procured from the Directorate of Medicinal and Aromatic Plants (ICAR), Anand, and plant micropropagation was carried out as described by Modi et al. (2012). Plants raised from tissue culture were hardened at intervals of 10 days up to 30 days. On the final day, all of the plants were sampled, generating three treatment time points for hardened plants while leaf samples from the plants not hardened were taken as control samples.

RNA Extraction and cDNA Preparation

RNA extraction from the leaf samples was carried out according to the method described by Ghawana et al. (2011) with minor modifications. Leaf samples were crushed in liquid nitrogen in Tris-saturated phenol extraction buffer (containing 3M sodium acetate, 10% sodium dodecyl sulfate, and 0.5 M ethylenediaminetetraacetic acid). The samples were then mixed with chloroform and centrifuged at 13,000 rpm for 10 min. The upper aqueous phase was mixed with 0.6 volume of iso-propanol and centrifuged and the precipitate was rinsed with 75% ethanol. The resulting RNA was dissolved in DEPC (diethylpyrocarbonate) treated water. Complementary DNA strand was prepared from these samples using the First Strand cDNA Synthesis Kit (Fermentas) according to the manufacturer's instructions. Reaction mixtures (20 µl) containing 5 µg of total RNA, reverse transcriptase, dNTP mix, oligo dT primers and RNase inhibitor were incubated at 37°C for 60 min followed by 65°C for 10 min to denature the enzyme. The sample was then diluted five times and used as a working solution.

Primer Design and Quantitative Real-Time Polymerase Chain Reaction

Primers for the candidate genes were designed from expressed sequence tag (EST) sequences of stevia (Brandle et al., 2002). From these ESTs sequences, based on similarity with other gene sequences from model organisms, the regions with the greatest similarity were selected and used to design the primers for the genes of the MEP pathway. From the known sequences of model organisms, BLAST was performed to find ESTs representing the respective housekeeping genes. Details of selected primers are given in Table 2. Prepared cDNAs from both the control as well as the treatments were subjected to quantitative real-time polymerase chain reaction (RT-PCR) using SYBR Green chemistry in the 7500 Fast system (ABI). Melt curve analysis was also performed to confirm that a single PCR product was made from each gene.

Table 2. List of Gene-Specific Primers (With Accession Numbers) With Sequences and Their Respective Product Sizes for 3 Control and 15 Target Genes
Gene name (accession no.)Corresponding enzymePrimer sequenceIn silico product size
ACT (AF548026)ActinFCGCCATCCTCCGTCTTGATCTTGC100
RCCGTTCGGCGGTGGTGGTAA
UBQ (AF548026)UbiquitinFTCACTCTTGAAGTGGAGAGTTCCGA90
RGCCTCTGTTGGTCCGGTGGG
GAPDH (AF548026)Glyceraldehyde – 3 –phosphate dehydrogenaseFCCGTGAGGTTGGAAAAAGCTGCC97
RCGCCATCCTCCGTCTTGATCTTGC
DXS (AF548026)Deoxyxylulose – 5 – phosphate synthaseFAAGGTCGAATTCGCTGGGG89
RTCCTGAGTGGTGAGGTTTTTCA
DXR (AF548026)Deoxyxylulose – 5 – phosphate reductaseFGAACGGCGCTGGTTGAC93
RGTGTCTGAGTCCCAATTGAACC
CMS (AF548026)4-diphosphocytidyl-2-C-methyl-D-erythritol synthaseFTTGACCTGTACCGGCATCCT107
RACAAGTGACTGTAAAACCGCTACA
CMK (AF548026)4-diphosphocytidyl-2-C-methyl-D-erythritol kinaseFTGCCAAATCATGAAACCCATCTG116
RTGAGGTGGATATGAATGCTGGAT
MCS (AF548026)4-diphosphocytidyl-2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthaseFCTCTCCCATTTCTCTCCGGC130
RACCATGGCCGACTCGAAAC
HDS (AF548026)1-hydroxy-2-methyl-2(E)-butenyl 4-diphosphate synthaseFTCTCCAACCATAACTGTGCGT86
RGGAAGTCCTCTGTTAGTTCCTGT
HDR (AF548026)1-hydroxy-2-methyl-2(E)-butenyl 4-diphosphate reductaseFGCGGAGACTCTTCTTCACCG108
RCCGAACCCTTTCCGGTTGT
GGDPS (AF548026)Geranyl geranyl diphosphate synthaseFACGGAAAAACACCAATCAAACCC123
RGGCGTCCAGAGCTTCATTCA
CDPS (AF548026)Copalyl diphosphate synthaseFCGGTGTAAAGCGGTATCCAAAG102
RTGTGTCCAAATGGTCCTTCACTT
KS (AF548026)Kaurene synthaseFACCAAAGAACGGATCCAAAAACTG125
RAGACACTCAGGGAAACAAGGC
KO (AF548026)Kaurene oxidaseFAGCTATGAGACAAGCATTGGGA128
RCGACGTCAATTGCACCCATC
KAH (AF548026)Kaurenoic acid hydroxylaseFAACTCTGGCACTCCTACGTG119
RCAAAACGGTCGCCAAACAAC
UGT85C2 (AF548026)UDP glucosyltranserase – 85C2FCATCGGGCCCACATTGTCTA99
RCTCTGATTGGGATGCTCGCT
UGT74G1 (AF548026)UDP glucosyltranserase – 74G1FACCACAGTAACACCACCACC97
RTCCAAATATGATTCTCCTGCACTCA
UGT76G1 (AF548026)UDP glucosyltranserase – 76G1FCACCATCTTTCACACCAACTTCA91
RATGCGTTCGTCTTGTGGGT

Stevioside Content

Stevioside content was estimated from aqueous extracts of dried leaf samples according to the method described by Bovanova et al. (1998). Reverse phase high performance liquid chromatography was performed using a C18 column as stationary phase and methanol:water (70:30) as the mobile phase at the rate of 1 ml/min at room temperature. Six stevioside standards (SIGMA-ALDRICH) viz., 312.5, 625, 1,250, 2,500, 5,000, and 10,000 ppm were sampled for the linearity study, and the equation with R2 value close to one was taken for the quantification of stevioside from the unknown samples.

Statistical Analysis and Relative Quantification of Genes

Measurements of stevioside content were taken in six replications (biological replicates) and were analyzed using a completely randomized design at 5% level of critical difference (C.D.) (Compton, 1994). Assessment in RT-PCR was performed with three repetitions (technical replicates) of individual samples with all the genes in all the treatments. Relative quantification of the candidate genes in all the treatments was carried out using DataAssist tool v3.01 (Applied Biosystems).

Acknowledgment

  1. Top of page
  2. ABSTRACT
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgment
  8. References

We thank Dr. R.S. Fougat, Head, Department of Agricultural Biotechnology for providing the research facility as well as greenhouse and poly-house facilities for hardening of micropropagated plants.

References

  1. Top of page
  2. ABSTRACT
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgment
  8. References
  • Beneford DJ, DiNovi M, Schlatter J. 2006. Steviol glycosides. Safety evaluation of certain food additives. WHO Food Additive Series. Geneva: WHO. p 117.
  • Bovanova L, Brandstetarova E, Baxa S. 1998. HPLC determination of stevioside in plant material and food samples. Z Lebensm Unters Forsch A 207:352355.
  • Brandle JE, Richman A, Swanson AK, Chapman BP. 2002. Leaf ESTs from Stevia rebaudiana: a resource for gene discovery in diterpene synthesis. 50:613622.
  • Brandle JE, Telmer PG. 2007. Steviol glycosides biosynthesis. Phytochemistry 68:18551863.
  • Ceunen S, Geuns JMC. 2013a. Steviol glycosides: chemical diversity, metabolism, and function. J Nat Prod 76:12011228.
  • Ceunen S, Geuns JMC. 2013b. Spatio-temporal variation of the diterpene steviol in Stevia rebaudiana grown under different photoperiods. Phytochemistry 89:3238.
  • Ceunen S, Geuns JMC. 2013c. Influence of photoperiodism on the spatio-temporal accumulation of steviol glycosides in Stevia rebaudiana (Bertoni). Plant Sci 198:7282.
  • Che P, Lall S, Nettleton D, Howell SH. 2006. Gene transcript accumulation programs during shoot, root, and callus development in Arabidopsis tissue culture. Plant Physiol 141:620637.
  • Compton ME. 1994. Statistical method suitable for the analysis of plant tissue culture data. Plant Cell Tissue Organ Cult 37:217242.
  • Ghawana S, Paul A, Kumar H, Kumar A, Singh H, Bhardwaj PK, Rani A, Singh RS, Raizada J, Singh K, Kumar S. 2011. An RNA isolation system for plant tissues rich in secondary metabolites. BMC Res Notes 4:8589.
  • Ghazi YA, Bouro S, Arioli T, Dennis ES, Danny J. 2009. Transcript profiling during fiber development identifies pathways in secondary metabolism and cell wall structure that may contribute to cotton fiber quality. Plant Cell Physiol 50:13641381.
  • Hajihashemi S, Geuns JMC, Ehsanpour AA. 2013. Gene transcription of steviol glycoside biosynthesis in Stevia rebaudiana Bertoni under polyethylene glycol, paclobutrazol and gibberellic acid treatments in vitro. Acta Physiol Plant 35:20092014.
  • Jiang X, Liu Y, Li W, Zhao L, Meng F, Wang Y, Tan H, Yang H, Wei C, Wan X, Gao L, Xia T. 2013. Tissue-specific, development-dependent phenolic compounds accumulation profile and gene transcript accumulation pattern in tea plant [Camellia sinensis]. PLoS One 8:e62315.
  • Kumar H, Kaul K, Gupta SB, Kaul VK, Kumar S. 2011. A comprehensive analysis of fifteen genes of steviol glycosides biosynthesis pathway in Stevia rebaudiana (Bertoni). Gene 492:276284.
  • Mir JI, Ahmed N, Wafai AH, Qadri RA. 2012. Relative expression of CsZCD gene and apocarotenoid biosynthesis during stigma development in Crocus sativus L. Physiol Mol Biol Plants 18:371375.
  • Mitra A, Pal A. 2007. In vitro regeneration of Stevia rebaudiana (Bert.) from nodal explants. J Plant Biochem Biotechnol 16:5962.
  • Modi AR, Shukla YM, Litoriya NS, Patel NJ, Narayanan S. 2011. Effect of gibberellic acid foliar spray on growth parameters and stevioside content of ex vitro grown plants of Stevia rebaudiana Bertoni. Med Plants 3:157160.
  • Modi AR, Patil G, Kumar N, Singh AS, Subhash N. 2012. A simple and efficient in vitro mass multiplication procedure for Stevia rebaudiana Bertoni and analysis of genetic fidelity of in vitro raised plants through RAPD. Sugar Tech 14:391397.
  • Mohamed AAA, Ceunen S, Geuns JMC, Ende WV, Ley MD. 2011. UDP-dependent glycosyltransferases involved in the biosynthesis of steviol glycosides. J Plant Physiol 168:11361141.
  • Richman SA, Gijzen M, Starratt AN, Yang Z, Brandle JE. 1999. Diterpene synthesis in Stevia rebaudiana: recruitment and up-regulation of key enzymes from the gibberellin biosynthetic pathway. Plant J 19:411421.
  • Scolnik PA, Giuliano G. 1994. Regulation of carotenoid biosynthesis genes during plant development. Pure Appl Chem 66:10631068.
  • Tadhani MB, Patel VH, Subhash R. 2007. In vitro antioxidant activities of Stevia rebaudiana leaves and callus. J Food Composit Anal 27:323329.