SEARCH

SEARCH BY CITATION

Keywords:

  • signal transduction;
  • vulval development;
  • cell polarity;
  • nuclear localization

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgments
  8. References

Background: Ryk is a subfamily of receptor tyrosine kinases, which along with Frizzled and Ror, function as Wnt receptors. Vertebrate Ryk intracellular domain (ICD) is released from the cell membrane by a proteolytic cleavage in the transmembrane region and localizes to the nucleus. In C. elegans, Ryk is encoded by the lin-18 gene and regulates the polarity of the P7.p vulval cell. Results: Based on Western blots, we were unable to detect the presence of the cleaved LIN-18 ICD fragment. Functional assays found that LIN-18 intracellular domain is not absolutely required for LIN-18 function, consistent with previous results. However, overexpression of the LIN-18 intracellular domain fragment (LIN-18ICD) weakly enhanced the phenotype of lin-18 loss-of-function mutants. Furthermore, this activity was specific to the serine-rich juxtamembrane region. We also found that the nuclear localization of LIN-18ICD fragment can be regulated by Wnt pathway components including CAM-1/Ror, and by PAR-5/14-3-3. Conclusions: Release of LIN-18ICD by cleavage at the membrane is not the main mechanism of LIN-18 signaling in vulval cells. However, our results suggest that LIN-18 intracellular domain interacts with Wnt pathway components and a 14-3-3 protein and likely plays a minor role in LIN-18 signaling. Developmental Dynamics 243:1074–1085, 2014. © 2014 Wiley Periodicals, Inc.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgments
  8. References

The development of a multicellullar organism is a complex process regulated by a multitude of molecular signals. Wnt signaling plays crucial roles in various developmental processes through regulation of cell proliferation, differentiation and migration (Logan and Nusse, 2004). In turn, deregulation of Wnt signaling can cause diseases such as cancer (Logan and Nusse, 2004). Traditionally, Wnt signaling pathways have been divided into canonical and noncanonical Wnt pathways. The canonical Wnt signaling is β-catenin dependent. In the absence of the Wnt signal, β-catenin is phosphorylated by the destruction complex formed by Adenomatous Polyposis Coli (APC), Axin and glycogen synthase kinase-3β (GSK-3β). The phosphorylated β-catenin is subjected to ubiquitination and degradation. Upon Wnt binding to the Frizzled (Fz) receptor and the low density lipoprotein (LDL) receptor-related protein (LRP6) co-receptor, β-catenin degradation is prevented and β-catenin accumulates in the cytoplasm. β-catenin is then translocated into the nucleus and binds to lymphoid enhancer-binding factor 1/T cell-specific transcription factor (LEF/TCF) to activate transcription of target genes (Logan and Nusse, 2004; Niehrs, 2012). In contrast to the canonical Wnt signaling pathway, the noncanonical Wnt signaling is a collective term referring to several β-catenin independent signaling mechanisms. There are various types of noncanonical Wnt signaling pathways which involve different Wnt receptors, Frizzled, Ryk and Ror (Gordon and Nusse, 2006; Niehrs, 2012).

Ryk (related to tyrosine kinase) is a transmembrane receptor that belongs to the receptor tyrosine kinase superfamily (Hovens et al., 1992; Fradkin et al., 2009). The Ryk protein consists of an extracellular Wnt inhibitory factor domain (WIF), a transmembrane region (TM), and an intracellular domain (ICD). The extracellular WIF domain binds to Wnt proteins. The intracellular domain can be further divided into a serine-rich juxtamembrane region (JM) and a kinase domain (KD). The kinase domain is catalytically inactive (kinase dead) due to several amino acids substitutions (relative to the presumed active ancestral kinase) in the catalytic domain (Katso et al., 1999).

The signaling mechanism of Ryk is not fully understood, although several proteins that interact with Ryk have been discovered in different systems. In mice, Ryk binds to, and is phosphorylated by Eph receptor tyrosine kinase (Halford et al., 2000). Ryk also forms a complex with Fz and Wnt and interacts with Dishevelled (Dvl) (Lu et al., 2004). In Drosophila, Ryk interacts with Src family kinases to mediate chemorepulsive axon guidance (Wouda et al., 2008). Recently, Ryk was found to play a part in planar cell polarity by regulating Vangl2 protein stability (Andre et al., 2012; Macheda et al., 2012). It is likely that, as with Frizzled and Ror, multiple mechanisms of signaling exist for Ryk (Gordon & Nusse, 2006; Green et al., 2008b).

One important unanswered question is the function of the Ryk intracellular domain. The interaction of Ryk with Eph suggests that one mechanism of Ryk signaling involves phosphorylation of Ryk by a different kinase, similar to other kinase-inactive receptors such as ERBB3 (Pinkas-Kramarski et al., 1996). However, an alternative function of the Ryk intracellular domain was reported by Lyu et al. (2008). They found that in mouse neural progenitor cells, Ryk is cleaved at the membrane by γ-secretase (Lyu et al., 2008). Following the cleavage, the Ryk intracellular domain (ICD) was released into the cytoplasm and translocated into the nucleus. This nuclear localization is induced by Wnt3. Moreover, the membrane-detached Ryk ICD is required for neural progenitor cell differentiation.

In C. elegans, lin-18 encodes the sole Ryk ortholog (Inoue et al., 2004). During vulva development, loss-of-function mutations in lin-18 reverse the P7.p vulval cell polarity and cause a morphological defect called the P-Rvl phenotype (posterior reversed vulval lineage) (Sternberg & Horvitz, 1988; Inoue et al., 2004). Loss-of-function mutations in lin-17/Frizzled cause a similar phenotype (Sternberg & Horvitz, 1988; Sawa et al., 1996). However, based on genetic interactions, lin-18 and lin-17 appear to function independently (Inoue et al., 2004). Of interest, expression of the LIN-18 protein fragment containing the extracellular domain and the transmembrane domain only (LIN-18ECD-TM) was sufficient to rescue the phenotype of the lin-18 loss-of-function mutant (Inoue et al., 2004). Because this construct completely lacks the intracellular domain, this indicated that the LIN-18 intracellular domain is not essential for LIN-18 function. However, the experiment did not rule out the possibility that the intracellular domain plays a minor role during vulval development.

In addition to lin-18/Ryk and lin-17/Frizzled, vulval development is also regulated by cam-1, encoding a member of the Ror family of receptor tyrosine kinases. Ror receptors are distinct from Ryk receptors by sequence and domain structure, but also function as Wnt receptors. In C. elegans, cam-1/Ror signaling antagonizes lin-18 and lin-17 signaling. As a consequence, loss-of-function mutations in cam-1 suppress the P-Rvl phenotype caused by lin-18 or lin-17 mutations (Green et al., 2008a). How signals from distinct Wnt pathways (Ryk, Frizzled, and Ror) are integrated is not well understood.

In this study, we investigated the function of the LIN-18 intracellular domain. Western blot experiments failed to convincingly show the presence of a cleaved ICD fragment, suggesting that this fragment is either absent or present in low abundance. The effect of various truncated LIN-18 fragments on vulval development was tested in multiple genetic backgrounds. These experiments confirmed that LIN-18 intracellular domain is not required for normal P7.p vulval cell polarity. However, we also found that overexpression of the LIN-18 intracellular domain fragment or the juxtamembrane region affected the P7.p cell polarity, suggesting that LIN-18 intracellular domain interacts with other proteins regulating vulval cell polarity. Finally, by looking for genes that regulate the GFP-tagged LIN-18 intracellular domain, we identified Wnt, Ror and the 14-3-3 protein as possible regulators of the LIN-18 intracellular domain.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgments
  8. References

Function of LIN-18 ICD in P7.p Vulval Cell Polarity

Loss-of-function mutations in lin-18/Ryk cause a reversal of P7.p polarity and a morphological phenotype called the P-Rvl phenotype (posterior reversed vulval lineage) in which an ectopic invagination is formed posterior to the normal vulva (Green et al., 2008a). Previously, it was found that LIN-18ECD-TM (LIN-18 fragment lacking the ICD) could rescue this mutant phenotype (Inoue et al., 2004).

To determine the function of LIN-18 intracellular domain in P7.p polarity, we generated transgenes that express various sub-fragments of LIN-18 tagged with GFP (Fig. 1) (Experimental procedures), and tested whether these LIN-18 fragments affect the P-Rvl phenotype in wild-type, lin-18(e620), lin-17(n671), and cam-1(gm122) mutant backgrounds (Table 1). Specifically, we tested the full-length LIN-18 tagged with GFP (LIN-18FL), the extracellular domain and the transmembrane region (LIN-18ECD-TM), the entire intracellular region (LIN-18ICD), the serine-rich juxtamembrane region (LIN-18JM) and the kinase domain without the JM region (LIN-18KD). In addition, we constructed an altered version of the full-length LIN-18 in which the transmembrane region was substituted with the transmembrane region of the human EGFR, which should be resistant to cleavage (LIN-18RC) (Lyu et al., 2008).

image

Figure 1. The domain structure of LIN-18/Ryk and GFP tagged LIN-18 fragments used in this study. If C. elegans LIN-18 is cleaved by γ-secretase as are its vertebrate homologs, the intracellular domain (ICD) fragment would be released into the cytoplasm. However, we found no evidence that this form of LIN-18 exists in C. elegans.

Download figure to PowerPoint

Table 1. Effect of LIN-18 Fragment Overexpression on Vulval Developmenta
GenotypeFragment%A-Rvl%P-Rvl%AP-RvlnP-Value*
  1. a

    The A-Rvl phenotype is the presence of an ectopic invagination anterior to the main vulval invagination, whereas the AP-Rvl phenotype represents the presence of ectopic invaginations on both anterior and posterior sides (see Green et al. 2008a). *Calculated using Fisher's exact test for the frequency of P-Rvl and AP-Rvl for comparisons against corresponding non-transgenic animals. All animals were kept at 25°C.

Wild-type 000110 
qwEx111LIN-18FL0101131.0000
qwEX60LIN-18RC0001021.0000
qwEx109LIN-18ECD-TM0001201.0000
qwEx110LIN-18ICD0001171.0000
qwEx100LIN-18JM0001021.0000
qwEx12LIN-18KD0001011.0000
lin-18(e620) 0440209 
lin-18; qwEx111LIN-18FL010087<.0001
lin-18; qwEx51LIN-18FL050110<.0001
lin-18; qwEx114LIN-18RC0170102<.0001
lin-18; qwEx60LIN-18RC0170640.0001
lin-18; qwEx109LIN-18ECD-TM05073<.0001
lin-18; qwEx8LIN-18ICD0650630.0038
lin-18; qwEx100LIN-18JM0680155<.0001
lin-18; qwEx12LIN-18KD04501930.7641
lin-17(n671) 0770202 
lin-17; qwEx111LIN-18FL0950106<.0001
lin-17; qwEx60LIN-18RC09001030.0049
lin-17; qwEx109LIN-18ECD-TM01000198<.0001
lin-17; qwEx110LIN-18ICD08301560.1837
lin-17; qwEx100LIN-18JM08701000.0461
cam-1(gm122) 101109 
cam-1; qwEx111LIN-18FL050590.1249
cam-1; qwEx60LIN-18RC030600.2874
cam-1; qwEx109LIN-18ECD-TM0101001.0000
cam-1; qwEx110LIN-18ICD050630.1399
cam-1; qwEx100LIN-18JM0101591.0000
cam-1; lin-18 2230154 
cam-1; lin-18; qwEx111LIN-18FL040101<.0001
cam-1; lin-18; qwEx60LIN-18RC0901020.0039
cam-1; lin-18; qwEx109LIN-18ECD-TM000110<.0001
cam-1; lin-18; qwEx110LIN-18ICD03601390.0144
cam-1; lin-18; qwEX100LIN-18JM6317940.0095
lin-17; cam-1 1445170 
lin-17; cam-1; qwEx111LIN-18FL1841144<.0001
lin-17; cam-1; qwEx60LIN-18RC0772110<.0001
lin-17; cam-1; qwEx109LIN-18ECD-TM0892103<.0001
lin-17; cam-1; qwEx110LIN-18ICD14611210.8123
lin-17; lin-18 0100026 
lin-17; lin-18;qwEx111LIN-18FL09901001.0000
lin-17; lin-18;qwEx109LIN-18ECD-TM010001001.0000

In the lin-18(e620) mutant background, LIN-18ECD-TM and LIN-18FL rescued the mutant phenotype to approximately 5% P-Rvl, which is consistent with results reported in Inoue et al. (2004) (Table 1). In addition, LIN-18RC also significantly rescued the mutant phenotype. These results confirm that the intracellular domain (either as a detached ICD fragment or as a domain of the membrane bound full-length LIN-18 protein) is not required for the rescue of the lin-18(e620) mutant phenotype. Unexpectedly, we found that LIN-18FL, LIN-18RC, and LIN-18ECD-TM all enhanced the P-Rvl phenotype of the lin-17(n671) mutant and the lin-17(n671); cam-1(gm122) double mutant. A possible cause of this enhancement is that overexpression of these fragments partially interferes with other Wnt signaling pathways controlling P7.p polarity (e.g., mig-1 signaling) (Gleason et al., 2006) by competing for ligand binding. Such negative effect of Wnt receptor overexpression has been observed for the CAM-1/Ror receptor (Green et al., 2007). However, expression of LIN-18 fragments in wild-type animals caused no obvious phenotype.

In contrast to ECD-containing fragments of LIN-18, the expression of LIN-18ICD enhanced the phenotype of the lin-18(e620) mutant and the cam-1(gm122); lin-18(e620) double mutant (Table 1). Expression of LIN-18JM also enhanced the mutant phenotype, but the LIN-18KD did not, indicating that the effect is due to the juxtamembrane region. This is the first phenotypic evidence of LIN-18 intracellular domain function in C. elegans. The LIN-18ICD fragment may suppress signaling that promotes the anterior orientation of P7.p, or enhance signaling which promotes the posterior orientation of P7.p. However, it is unclear whether this effect is related to an endogenous function of a cleaved LIN-18 ICD fragment, because it is also possible that the overexpressed LIN-18ICD fragment interferes with proteins that interact with the intracellular domain of the full-length LIN-18 protein.

LIN-18 ICD Fragment in C. elegans

The truncated form of Ryk consisting of the intracellular domain detached from the membrane (Ryk ICD) is found in mice, zebrafish and human cell lines (Lyu et al., 2008; Berndt et al., 2011). This form is produced by γ-secretase cleavage in the transmembrane region. We investigated whether the C. elegans Ryk (LIN-18) undergoes similar processing. First, Western blot experiments using an anti-LIN-18 antibody did not detect a protein of the size expected for the ICD fragment, although the result was inconclusive due to the low quality of the available antibody (Experimental Procedures). Therefore, we compared worms expressing the full-length GFP-tagged LIN-18 protein (LIN-18FL) with worms expressing cleavage-resistant GFP-tagged LIN-18 (LIN-18RC) using an anti-GFP antibody (Experimental Procedures). We found no obvious band corresponding to the cleaved form (Fig. 2). Although a faint band perhaps consistent with the ICD fragment was detected in animals expressing LIN-18FL, a similar faint band was also present in animals expressing LIN-18RC, indicating that this does not correspond to the Ryk ICD fragment produced by γ-secretase cleavage. These results suggest that, in C. elegans the cleaved ICD fragment of LIN-18 is either not present or present in much lower amount than the full-length LIN-18 protein. However, the artificial nature of the system does present caveats. For example, because GFP-tagged proteins were overexpressed, it is possible that the cleavage was limited by the low amount of γ-secretase present in the cell.

image

Figure 2. GFP-tagged LIN-18 fragments detected using an anti-GFP antibody. No obvious band corresponding to the cleaved ICD fragment was detected in animals expressing LIN-18FL.

Download figure to PowerPoint

Nuclear Localization of the LIN-18 ICD Fragment

Mammalian Ryk ICD is nuclear localized and is regulated by Wnt signaling (Lyu et al., 2008). To determine whether LIN-18ICD has the tendency to localize to the nucleus, we compared the subcellular localization of various LIN-18 fragments tagged with GFP (Fig. 3A,C). Consistent with previous studies, the lin-18 promoter drove expression in neurons and vulval precursor cells. Additionally, in the terminal bulb of the pharynx, we found that the lin-18 promoter drove expression in pm7 pharyngeal muscle cells (Fig. 3C). Because pm7 cells are large and its nucleus can be clearly differentiated from the cytoplasm and the cell membrane, we examined the subcellular localization of LIN-18 fragments in pm7 cells. We also examined the localization of LIN-18 fragments expressed under the control of a pharyngeal muscle specific promoter, myo-2. We measured the level of nuclear LIN-18 fragment using two approaches. First, we made a semi-quantitative assessment of the nuclear GFP level based on visual observations (Tables 2, 3) (see Experimental Procedures). Second, we quantified the relative levels of nuclear and cytoplasmic GFP using image analysis (Fig. 4; Tables 4, 5) (see Experimental Procedures).

image

Figure 3. Expression of GFP-tagged LIN-18 fragments in the pharynx. Corresponding fluorescence and Nomarski images are shown. The position of the pm7 nucleus is indicated by the white arrow and by magenta circle in panels A and B. The approximate outline of the pm7 cell is indicated in green in panel A. Scale bars represent 10 μm. A: GFP-tagged LIN-18 fragments expressed under the control of the myo-2 promoter (green). These animals also express TdTomato::H2B which labels the nucleus (magenta). B: LIN-18ICD and TdTomato::H2B expressing animals subjected to RNAi against par-5. The LIN-18ICD is expressed under the control of the myo-2 promoter. C: GFP-tagged LIN-18 fragments expressed under the control of the lin-18 promoter.

Download figure to PowerPoint

Table 2. Effect of Feeding RNAi on the Nuclear Level of LIN-18 Fragments in pm7 Cellsa
LIN-18 fragmentGene targeted by RNAiProtein% Animals with high-level nuclear GFPnP-Value*
  1. a

    Feeding RNAi was used to disrupt various genes in strains carrying qwEx8[Plin-18::lin-18ICD::gfp], qwEx25[Pmyo-2::lin-18ICD::GFP], qwEx12[Plin-18::lin-18KD::GFP] and syEx421[Plin-18::GFP]. The level of GFP in the pm7 nucleus was assayed qualitatively in each individual animal, and the percentage of animals with high level of GFP was calculated. *Compared to the vector only control. Fisher's exact test was used.

LIN-18ICD (expressed from lin-18 promoter)
 Vector 77205 
 GFP 47107<.0001
 cam-1ROR661050.0417
 mom-2Wnt53320.0082
 egl-20Wnt54500.0023
 cwn-1Wnt76500.8534
 cwn-2Wnt64550.0556
 lin-44Wnt72500.4627
 apr-1APC3754<.0001
 pry-1Axin66530.1114
 dsh-2Dishevelled47109<.0001
 mig-5Dishevelled49104<.0001
 dsh-1Dishevelled59560.0102
 cdc-37CDC374967<.0001
 par-514-3-33234<.0001
 ftt-214-3-378501
 sta-1STAT77561
 sma-6TGFBR81520.7090
 kin-32PTK284500.3410
 pik-1Pelle/IRAK73510.5817
 ddr-2DDR1/DDR290510.0501
LIN-18ICD (expressed from myo-2 promoter)
 Vector 9899 
 GFP 61100<.0001
 cam-1ROR98501
 cdc-37CDC3784950.0007
 par-514-3-381470.0007
 ftt-214-3-3100341
GFP (expressed from lin-18 promoter)
 Vector 93107 
 GFP 60108<.0001
 cam-1ROR96550.4968
 mig-5Dishevelled91540.7622
 dsh-2Dishevelled91540.7622
 egl-20WNT93551
 mom-2WNT92531
 cdc-37CDC3795400.7287
 par-514-3-386740.2114
LIN-18KD (expressed from lin-18 promoter)
 Vector 8451 
 GFP 54810.0004
 par-514-3-355750.0005
Table 3. Nuclear Level of LIN-18ICD::GFP in Different Mutant Backgroundsa
Genotype% animals with high level of LIN-18ICD::GFP in the pm7 nucleusnP-Value*
  1. a

    The qwEx8[Plin-18::lin-18ICD::gfp] transgene was crossed into different mutant backgrounds. The presence of LIN-18ICD::GFP in the pm7 nucleus was examined in L4 stage animals as in Table 2. For par-5 mutants, homozygous progeny of heterozygous parents were assayed. *Compared to qwEx8 in the wild-type background. Fisher's exact test was used.

qwEx8[Plin-18::lin-18ICD::gfp]7972 
cam-1(gm122); qwEx843128<.0001
egl-20(n585); qwEx850113<.0001
lin-44(n1792); qwEx881530.8249
lin-18(e620); qwEx881530.8249
lin-17(n671); qwEx878511.0000
par-5(it55) unc-22(e66); qwEx83432<.0001
vab-1(dx31); qwEx868820.1464
image

Figure 4. Quantitative measurements of nuclear localization. Photos of the pm7 cell were taken and the ratio of average pixel intensity in the nucleus and the cytoplasm [N:C] was calculated. A: Effect of RNAi on LIN-18 fragments tagged with GFP. Two different transgenic strains expressing LIN-18ICD under the control of the lin-18 promoter were tested. Enrichment in the nucleus is less obvious with qwEx8, probably due to the lower level of LIN-18ICD expression. In addition, the effect of RNAi was tested on GFP, LIN-18ICD expressed under the control of the myo-2 promoter, and LIN-18KD. B: Subcellular localization of LIN-18 fragments in the wild-type background. LIN-18ICD and LIN-18KD were significantly enriched in the nucleus, compared with GFP and LIN-18JM. The promoter used to express LIN-18 fragments (Plin-18 or Pmyo-2) had no obvious effect on subcellular localization. Transgenes assayed are qwEx115, qwEx110, qwEx12, qwEx100, qwEx27, qwEx25, qwEx26, and qwEx36. C: Effect of cam-1, egl-20, and par-5 mutations on LIN-18ICD localization. Student's t-test was used. *P < 0.05. **P < 0.0001.

Download figure to PowerPoint

Table 4. Nuclear/Cytoplasmic Distribution of GFP Tagged LIN-18 Fragments in pm7 Cells
GenotypeFragmentRatio of fluorescence levels in the nucleus and the cytoplasm [N:C] Average ± SDnP-Value*
  1. GFP levels in pm7 nucleus and cytoplasm were measured and the ratio [N:C] was calculated for each animal. The microscope setting and the exposure time were kept constant within each set of data. *p-values were calculated using the students T test. Some of the data are also presented in Figure 4. This set of data is from adult animals assayed using a different exposure time from the previous set.

qwEx115[Plin-18::GFP]GFP1.12±0.0918 
qwEx110[Plin-18::lin-18ICD::GFP]LIN-18ICD1.41±0.1850<0.0001
qwEx12[Plin-18::lin-18KD::GFP]LIN-18KD1.41±0.2150<0.0001
qwEx100[Plin-18::lin-18JM::GFP]LIN-18JM1.16±0.10500.1221
qwEx27[Pmyo-2::GFP]GFP1.10±0.1232 
qwEx25[Pmyo-2::lin-18ICD::GFP]LIN-18ICD1.44±0.1950<0.0001
qwEx26[Pmyo-2::lin-18KD::GFP]LIN-18KD1.37±0.2050<0.0001
qwEx36[Pmyo-2::lin-18JM::GFP]LIN-18JM1.13±0.11500.2228
qwEx8[Plin-18::lin-18ICD::GFP]LIN-18ICD1.13±0.1162 
cam-1(gm122); qwEx8LIN-18ICD1.04±0.0655<0.0001
egl-20 (n585); qwEx8LIN-18ICD1.10±0.08490.1946
qwEx110[Plin-18::lin-18ICD::GFP]LIN-18ICD1.33±0.2049 
cam-1(gm122);qwEx110LIN-18ICD1.23±0.21530.0125
egl-20(n585);qwEx110LIN-18ICD1.31±0.21510.5011
par-5(it55);qwEx110LIN-18ICD1.17±0.1139<.0001
qwEx110LIN-18ICD1.24±0.1833 
par-5(it55);qwEx110LIN-18ICD1.07±0.19340.0004
Table 5. Effect of RNAi on Nuclear/Cytoplasmic Distribution of GFP Tagged LIN-18 Fragments in pm7 Cell
GenotypeRNAiFragmentRatio of fluorescence levels in the nucleus and the cytoplasm [N:C] Average ±SDnP-Value
  1. The [N:C] ratio was measured as in Table 4. Control animals for RNAi experiments were fed bacteria containing the L4440 vector. The difference between qwEx8 and qwEx110 is probably related to a difference in the level of protein expression.

qwEx8[Plin-18::lin-18ICD::GFP]LIN-18ICD1.12±0.1279 
qwEx8gfpLIN-18ICD1.06±0.11500.0078
qwEx8cdc-37LIN-18ICD1.07±0.11480.0266
qwEx8dsh-2LIN-18ICD1.06±0.09490.0039
qwEx8mom-2LIN-18ICD1.06±0.10560.0053
qwEx8mig-5LIN-18ICD1.03±0.0542<.0001
qwEx8par-5LIN-18ICD1.04±0.11250.0044
qwEx110[Plin-18::lin-18ICD::GFP]LIN-18ICD1.35±0.1439 
qwEx110gfpLIN-18ICD1.24±0.19430.0027
qwEx110cdc-37LIN-18ICD1.19±0.18280.0003
qwEx110dsh-2LIN-18ICD1.25±0.15340.0048
qwEx110mom-2LIN-18ICD1.19±0.15190.0005
qwEx110mig-5LIN-18ICD1.29±0.11310.0492
qwEx12[Plin-18::lin-18KD::GFP]LIN-18KD1.32±0.2350 
qwEx12gfpLIN-18KD1.16±0.23480.001
qwEx12par-5LIN-18KD1.08±0.1726<.0001
syEx421[Plin-18::GFP]GFP1.18±0.1730 
syEx421gfpGFP1.12±0.26300.2834
syEx421cdc-37GFP1.13±0.13320.2315
syEx421par-5GFP1.10±0.14180.0992
syEx421mom-2GFP1.22±0.12280.2741
syEx421egl-20GFP1.18±0.15270.9764
qwEx25[Pmyo-2::lin-18ICD::GFP]LIN-18ICD1.45±0.1944 
qwEx25gfpLIN-18ICD1.26±0.28400.0004
qwEx25cdc-37LIN-18ICD1.30±0.18430.0002
qwEx25par-5LIN-18ICD1.30±0.18330.0006
qwEx25cam-1LIN-18ICD1.26±0.1529<.0001
qwEx25egl-20LIN-18ICD1.34±0.15390.0040

In transgenic animals that express LIN-18FL and LIN-18RC, GFP fluorescence was found at the plasma membrane, while low level of fluorescence was observed in the cytoplasm and the nucleus. In contrast, in transgenic animals that express LIN-18ICD or LIN-18KD, there was an elevated level of GFP fluorescence in the nucleus relative to the cytoplasm. LIN-18JM::GFP was found in similar levels in the cytoplasm and the nucleus, in a distribution similar to that of the GFP protein by itself (Fis. 3A,C, 4B; Table 4). These results suggest that, like mammalian Ryk ICD, the intracellular domain of LIN-18 has the tendency to localize to the nucleus. Furthermore, this localization is dependent on the kinase domain, rather than the juxtamembrane region.

Genes that Regulate the Level of LIN-18ICD in the Nucleus

Given the lack of evidence for the presence of detached LIN-18 ICD fragment in C. elegans, the significance of the nuclear localization of GFP-tagged LIN-18ICD is unclear. However, it is likely that this localization is influenced by proteins that normally interact with the intracellular domain of full-length LIN-18. If so, disruption of these interacting proteins may alter the nuclear localization of the LIN-18ICD fragment.

PAR-5/14-3-3

The juxtamembrane (JM) region of LIN-18 and Ryk are serine-rich, and may serve a regulatory function, because serine-rich regions are often targets of phosphorylation. Using RNAi, we tested an arbitrary set of kinases and phosphopeptide-interacting proteins for a role in regulation of LIN-18ICD (Table 2).

14-3-3 proteins interact with phosphorylated proteins and mediate various protein/protein interactions. In C. elegans, par-5/14-3-3 mediates the nuclear export of phosphorylated TCF/LEF in the Wnt/MAPK signaling pathway during early embryogenesis (Lo et al., 2004). Of the two 14-3-3 genes in C. elegans (Wang and Shakes, 1997; Morton et al., 2002), we found that RNAi against par-5/14-3-3 but not ftt-2/14-3-3 reduced the LIN-18ICD level in the nucleus (Fig. 3B; Table 2). This reduction was observed for LIN-18ICD expressed under the control of the lin-18 promoter or the myo-2 promoter. The quantitative analysis of relative nuclear/cytoplasmic GFP levels confirmed the change in the distribution of LIN-18ICD under par-5 RNAi treatment and in par-5 mutants (Fig. 4A,C; Tables 4, 5). Also, a transcriptional GFP reporter under the control of the lin-18 promoter was not affected by par-5 RNAi, indicating that the effect of par-5 on LIN-18ICD is not due to reduced expression from the lin-18 promoter. Because 14-3-3 proteins bind to specific amino acid sequences containing phosphorylated serine and threonine residues, these results suggest that serine/threonine phosphorylation of LIN-18ICD may regulate protein stability or localization. However, LIN-18KD was also regulated by PAR-5/14-3-3, suggesting that this interaction is not mediated by the juxtamembrane region.

To test whether the interaction with PAR-5/14-3-3 is required for LIN-18 function in vulval cells, we examined the effect of a par-5 loss-of-function mutation on P7.p development (Table 6). We found no obvious effect of the par-5 mutation in wild-type, lin-17 or lin-18 mutant background, suggesting that this interaction is not important for vulval function of LIN-18.

Table 6. Effect of par-5 Mutation on the P-Rvl Phenotypea
Genotype%P-RvlnP-Valuea
  1. a

    For par-5 mutants, homozygous progeny of heterozygous parents were assayed. *Compared to respective single mutant or the wild type. Fisher's exact test was used.

Wild type0110 
unc-22(e66)059 
par-5(it55) unc-22(e66)0581.0000
lin-18(e620)44209 
par-5(it55) unc-22(e66); lin-18(e620)491330.3165
lin-17(n671)77202 
lin-17(n671); par-5(it55) unc-22(e66)841500.1376

Wnt Pathway Components

Because the nuclear localization of mammalian Ryk ICD is regulated by Wnt, we tested whether Wnt signaling affects the level of LIN-18ICD in the nucleus. RNAi against cam-1/Ror, mom-2/Wnt, egl-20/Wnt, apr-1/APC, dsh-2/dishevelled, and mig-5/dishevelled resulted in a decrease in the nuclear level of LIN-18ICD expressed under the control of the lin-18 promoter (Table 2). Quantitative measurements of the nuclear localization revealed that RNAi against cam-1, mom-2, dsh-2, and mig-5 significantly reduced the nuclear localization of LIN-18ICD (Fig. 4A; Table 4). We also found that the nuclear localization of LIN-18ICD was reduced in the cam-1 mutant background, confirming the effect of cam-1/Ror on LIN-18ICD localization (Table 5).

CDC37

CDC37 is required for Ryk ICD nuclear translocation in HEK293T cells (Lyu et al., 2008). RNAi against the C. elegans homolog, cdc-37, significantly reduced the nuclear level of LIN-18ICD expressed from both lin-18 and myo-2 promoters (Table 2), and reduced the concentration of LIN-18ICD in the nucleus (Fig. 4; Table 5). Thus, similar mechanisms likely regulate nuclear accumulation of Ryk ICD fragment in C. elegans and mammalian cells.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgments
  8. References

Function of LIN-18 ICD in C. elegans

We were unable to detect the presence of cleaved LIN-18ICD fragment in C. elegans, although the possibility that the ICD fragment is present at a low level or in a small number of cell types is not completely ruled out. Because the LIN-18 fragment lacking the intracellular domain (LIN-18ICD-TM) rescues the lin-18 P-Rvl phenotype, the intracellular domain of LIN-18 is not absolutely required for lin-18 function in the vulva, either as a part of the full-length LIN-18 protein or as a detached fragment (Fig. 5). Noncleavable LIN-18 (LIN-18RC) also rescued the mutant, which is in contrast to the neuronal differentiation of mouse neural progenitor cells where the membrane cleavage is required for the function of Ryk (Lyu et al., 2008).

image

Figure 5. Distinct functions of LIN-18 domains. Effect on vulval development was observed for the ECD-TM fragment which rescues the lin-18 mutant, and the JM fragment which enhances the lin-18 mutant. Nuclear localization of the ICD fragment was dependent on the kinase domain rather than the juxtamembrane region, and the kinase domain was found to be regulated by par-5/14-3-3.

Download figure to PowerPoint

ICD-Independent Function of LIN-18

If ICD release is not the mechanism of LIN-18 signaling in the vulva, how does LIN-18 convey the signal across the cell membrane? Our results are consistent with the hypothesis that the rescuing ability of LIN-18ECD-TM is lin-17 dependent. Whereas the rescue of lin-18(e620) is observed in the presence of endogenous lin-17, in the absence of lin-17 (lin-17 or lin-17; cam-1 mutant background), LIN-18ECD-TM has the opposite effect of promoting the P-Rvl phenotype. In contrast, LIN-18ECD-TM rescues the P-Rvl phenotype of the cam-1; lin-18 double mutant, therefore, the rescue of lin-18 by LIN-18ECD-TM is cam-1 independent.

Previous results indicated that lin-17 and lin-18 can function independently in vulval cells to promote the anterior orientation of P7.p (Inoue et al., 2004). If the assertion that LIN-18ECD-TM functions in a lin-17dependent manner is correct, this means that the full length LIN-18 can function independently of lin-17, but the LIN-18 protein lacking the ICD needs to interact with lin-17 to signal. In other words, LIN-18 may function through two redundant mechanisms. First, it may interact with LIN-17 and signal through downstream effectors of LIN-17/Frizzled. Second, LIN-18 may interact with downstream effectors through its ICD in a LIN-17-independent manner.

Regulators of LIN-18ICD

Although an artificial system, GFP-tagged LIN-18ICD displays nuclear localization regulated by Wnt signaling, suggesting that nuclear localization of LIN-18ICD may be used to identify components that interact with LIN-18ICD. We found that Wnt pathway components MOM-2/Wnt, CAM-1/Ror, DSH-2/Dishevelled, and MIG-5/Dishevelled affect the level of LIN-18ICD in the nucleus, suggesting that LIN-18 interacts with the Wnt/Ror/Dishevelled pathway. A cross-talk between Ryk and Ror pathways has not been well studied, but would not be surprising because P7.p polarity responds to both Ryk and Ror signaling.

We also found that par-5/14-3-3 regulates the level of LIN-18ICD in the nucleus. One possibility is that PAR-5 binds to the LIN-18 intracellular domain, perhaps through a serine or threonine phosphorylated motif in the kinase domain. However, as we found no obvious phenotypic consequence of mutating par-5 on vulval cell polarity, whether this interaction is relevant to the normal function of LIN-18 remains unclear.

Experimental Procedures

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgments
  8. References

Strain Construction

C. elegans strains were maintained on NGM plates seeded with the E. coli strain OP50 and kept at 20°C unless specified otherwise (Brenner, 1974). Mutations used in this study are listed in Table 7 (Brenner, 1974; Herman and Horvitz, 1994; Sawa et al., 1996; George et al., 1998; Forrester et al., 1999; Maloof et al., 1999; Morton et al., 2002; Inoue et al., 2004). lin-18(e620), lin-17(n671), and cam-1(gm122) are null alleles. Standard methods were used to generate new strains.

Table 7. Strains, Mutations, and Transgenes Used in This Studya
StrainGenotypeReferences
  1. a

    Other strains (e.g. transgenes in mutant backgrounds) were made by crossing these strains. All transgenes were made with unc-119(+) as the coinjection marker.

N2wild type(Brenner, 1974)
MT1306lin-17(n671)(Sawa et al., 1996)
MT5383lin-44(n1792)(Herman and Horvitz, 1994)
NG2615cam-1(gm122)(Forrester et al., 1999)
CZ337vab-1(dx31)(George et al., 1998)
MT1215egl-20(n585)(Maloof et al., 1999)
KK299par-5(it55) unc-22(e66)/nT1(Morton et al., 2002)
CB66unc-22(e66)(Brenner, 1974)
ZF1557lin-17(n671); par-5(it55) unc-22(e66)/nT1generated in this study
ZF1558par-5(it55) unc-22(e66)/nT1; lin-18(e620)generated in this study
PS4259lin-18(e620)(Inoue et al., 2004)
PS3725unc-119(ed4); syEx421[Plin-18::gfp](Inoue et al., 2004)
ZF1097unc-119(ed4); qwEx8[Plin-18::lin-18ICD::gfp]generated in this study
ZF1101unc-119(ed4); qwEx12[Plin-18::lin-18KD::gfp]generated in this study
ZF1176unc-119(ed4); qwEx25[Pmyo-2::lin-18ICD::gfp]generated in this study
ZF1281unc-119(ed4); qwEx51[Plin-18::lin-18FL::gfp]generated in this study
ZF1327unc-119(ed4); qwEx60[Plin-18::lin-18RC::gfp]generated in this study
ZF1394unc-119(ed4); qwEx100[Plin-18::lin-18JM::gfp]generated in this study
ZF1438unc-119(ed4); qwEx109[Plin-18::lin-18ECD-TM::gfp]generated in this study
ZF1437unc-119(ed4); qwEx110[Plin-18::lin-18ICD::gfp]generated in this study
ZF1439unc-119(ed4); qwEx111[Plin-18::lin-18FL::gfp]generated in this study
ZF1469unc-119(ed4); qwEx114[Plin-18::lin-18RC::gfp]generated in this study
ZF1559unc-119(ed4); qwEx115[Plin-18::gfp]generated in this study
EG7959unc-119(ed3); him-5(e1490) oxTi405[Peft-3::TdTomato::H2B](Frøkjær-Jensen et al., 2014)

Transgenic Animals

To express GFP-tagged LIN-18 fragments under the control of the lin-18 promoter, we first made a new promoter::gfp vector (pSYQ10.1) with a short multiple-cloning site (MCS) between the promoter and the gfp. Briefly, the most proximal section of the lin-18 promoter was PCR amplified using a primer containing restriction sites to be inserted (TI0013; Table 8), and using SalI and BamHI restriction sites, the fragment was re-inserted into a previously generated promoter::gfp plasmid pTI02.1 (Inoue et al., 2004). This places unique NheI, MluI, and BamHI sites between the 5kb promoter and the gfp coding region. PCR fragments corresponding to various sections of LIN-18 cDNA were generated by RT-PCR and inserted into pSYQ10.1 (Table 8). For expression of GFP-tagged LIN-18 which is resistant to cleavage, we substituted the section of the lin-18 cDNA coding for the transmembrane region (AFFVIICIAAAFLLIVAATLICYF) with 69 bp coding for the transmembrane region of the human EGFR (IATGMVGALLLLLVVALGIGLFM). To do this, we first amplified the cDNA fragment coding for LIN-18 ECD using primers TI0015 and TI0195. The C-terminal side of this cDNA fragment was extended by another round of PCR amplification using primers TI0015 and TI0196. The cDNA fragment coding for the ICD was amplified using primers TI0197 and TI0018. Finally, fragments coding for ECD and ICD were joined by fusion PCR. Primers TI0195, TI0196 and TI0197 together contain the sequence of the human EGFR transmembrane region. To express LIN-18 fragments under the control of Pmyo-2, a strong pharyngeal promoter, we substituted the lin-18 promoter with the myo-2 promoter from the L4640 (myo-2::cfp) plasmid (Addgene plasmid 1662; A. Fire et al., personal communication). Transgenic animals were generated by co-injecting the expression construct and the unc-119(+) plasmid into unc-119(ed4) worms (Maduro & Pilgrim, 1995). These transgenic arrays were crossed into lin-18, lin-17, and cam-1 mutant backgrounds. To visualize the nucleus, some of the lines were crossed to the EG7959 strain containing the Peft-3::TdTomato::H2B transgene which expresses a red fluorescent protein that localizes to the nucleus (Frøkjær-Jensen et al., 2014).

Table 8. Primers Used for PCR
FragmentDirectionPrimerSequence
PromoterforwardTI0014ccaatttgtttcatttgttatccaaaatg
 reverseTI0013aaggGGATCCACGCGTGCTAGCAAGCTTattcgctgcaaaaaatgaaacag
LIN-18FLforwardTI0015ttccgctagcatgattcttcgctacctgatttttttc
reverseTI0018ttccGGATCCGCgatgtattgactgagttgaatg
LIN-18ICDforwardTI0016ttccgctagcATGtgttatttcaagcgctctaaaaaag
reverseTI0018ttccGGATCCGCgatgtattgactgagttgaatg
LIN-18KDforwardTI0017ttccgctagcATGgcattgttacaactctatcaag
reverseTI0018ttccGGATCCGCgatgtattgactgagttgaatg
LIN-18ECD-TMforwardTI0015ttccgctagcatgattcttcgctacctgatttttttc
reverseTI0019ttccGGATCCGCgaaataacagatcaacgttgctg
LIN-18JMforwardTI0016ttccgctagcATGtgttatttcaagcgctctaaaaaag
reverseTI0114ttccCCCGGGCacgtctcacgtcaatgtttcttggc
LIN-18RC (ECD)forwardTI0015ttccgctagcatgattcttcgctacctgatttttttc
reverseTI0195gaggagggcccccaccatcccagtggcgatcttgtctattgagtcagtgt
LIN-18RC (ECD extension)forwardTI0015ttccgctagcatgattcttcgctacctgatttttttc
reverseTI0196gatccctagggccaccaccagcagcaagaggagggcccccaccatccc
LIN-18RC (ICD)forwardTI0197gtggtggccctagggatcggcctcttcatgaagcgctctaaaaaagaaga
reverseTI0018ttccGGATCCGCgatgtattgactgagttgaatg
LIN-18RC (Fusion PCR)forwardTI0015ttccgctagcatgattcttcgctacctgatttttttc
reverseTI0018ttccGGATCCGCgatgtattgactgagttgaatg

Phenotypes and RNAi Experiments

The P-Rvl (posterior reversed vulval lineage) phenotype was scored in the mid-L4 stage using Nomarski microscopy as described in Inoue et al. (2004). RNAi experiments were performed as described (Kamath et al., 2001) at 25°C.

The level of LIN-18ICD, LIN-18KD, or GFP in the pm7 cell nucleus was determined in L4 stage worms by fluorescence microscopy. Initially, we qualitatively assessed whether GFP was present in the nucleus of each animal and calculated the percentage of animals which had a high level of GFP in the nucleus (Tables 2, 3). For quantitative measurements, each individual animal was photographed and the level of fluorescence in the nucleus and the cytoplasm was measured as average pixel intensity using the ImageJ software (Fig. 4; Tables 4, 5). The ratio of fluorescence intensity in the nucleus and cytoplasm [N:C] for each animal was calculated. Averages and standard deviations were calculated from [N:C] ratios.

Western Blot Experiments

The rabbit serum containing anti-LIN-18 antibody was a gift from P. W. Sternberg. We collected mixed stage wild-type and lin-18(e620) mutant worms and lysed them by boiling them at 100°C in a 1% SDS solution. In some Western blot experiments, this serum detected a band consistent with the full-length LIN-18. However, because of the low quality of the antibody, we were unable to conclusively determine the presence or absence of a truncated lin-18 product. To detect GFP fusion proteins, we used an anti-GFP antibody (Santa Cruz sc-9996). Total protein from mixed stage population of worms expressing GFP tagged LIN-18FL, LIN-18ICD, LIN-18KD and LIN-18RC were analyzed.

Acknowledgments

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgments
  8. References

We thank Paul W. Sternberg for the anti-LIN-18 antibody. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Experimental Procedures
  7. Acknowledgments
  8. References
  • Andre P, Wang Q, Wang N, Gao B, Schilit A, Halford MM, Stacker SA, Zhang X, Yang Y. 2012. The Wnt coreceptor Ryk regulates Wnt/planar cell polarity by modulating the degradation of the core planar cell polarity component Vangl2. J Biol Chem 287:4451844525.
  • Berndt JD, Aoyagi A, Yang P, Anastas JN, Tang L, Moon RT. 2011. Mindbomb 1, an E3 ubiquitin ligase, forms a complex with RYK to activate Wnt/beta-catenin signaling. J Cell Biol 194:737750.
  • Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77:7194.
  • Forrester WC, Dell M, Perens E, Garriga G. 1999. A C. elegans Ror receptor tyrosine kinase regulates cell motility and asymmetric cell division. Nature 400:881885.
  • Fradkin LG, Dura JM, Noordermeer JN. 2009. Ryks: new partners for Wnts in the developing and regenerating nervous system. Trends Neurosci 33:8492.
  • Frøkjær-Jensen C, Davis M, Sarov M, Taylor J, Flibotte S, LaBella M, Pozniakovsky A, Moerman D, Jorgensen E. 2014. Random and targeted transgene insertion in Caenorhabditis elegans using a modified Mos1 transposon. Nat Methods 11:529534.
  • George SE, Simokat K, Hardin J, Chisholm AD. 1998. The VAB-1 Eph receptor tyrosine kinase functions in neural and epithelial morphogenesis in C. elegans. Cell 92:633643.
  • Gleason JE, Szyleyko EA, Eisenmann DM. 2006. Multiple redundant Wnt signaling components function in two processes during C. elegans vulval development. Dev Biol 298:442457.
  • Gordon MD, Nusse R. 2006. Wnt signaling: multiple pathways, multiple receptors, and multiple transcription factors. J Biol Chem 281:2242922433.
  • Green JL, Inoue T, Sternberg PW. 2007. The C. elegans ROR receptor tyrosine kinase, CAM-1, non-autonomously inhibits the Wnt pathway. Development 134:40534062.
  • Green JL, Inoue T, Sternberg PW. 2008a. Opposing Wnt pathways orient cell polarity during organogenesis. Cell 134:646656.
  • Green JL, Kuntz SG, Sternberg PW. 2008b. Ror receptor tyrosine kinases: orphans no more. Trends Cell Biol 18:536544.
  • Halford MM, Armes J, Buchert M, Meskenaite V, Grail D, Hibbs ML, Wilks AF, Farlie PG, Newgreen DF, Hovens CM, Stacker SA. 2000. Ryk-deficient mice exhibit craniofacial defects associated with perturbed Eph receptor crosstalk. Nat Genet 25:414418.
  • Herman MA, Horvitz HR. 1994. The Caenorhabditis elegans gene lin-44 controls the polarity of asymmetric cell divisions. Development 120:10351047.
  • Hovens CM, Stacker SA, Andres AC, Harpur AG, Ziemiecki A, Wilks AF. 1992. RYK, a receptor tyrosine kinase-related molecule with unusual kinase domain motifs. Proc Natl Acad Sci U S A 89:1181811822.
  • Inoue T, Oz HS, Wiland D, Gharib S, Deshpande R, Hill RJ, Katz WS, Sternberg PW. 2004. C. elegans LIN-18 is a Ryk ortholog and functions in parallel to LIN-17/Frizzled in Wnt signaling. Cell 118:795806.
  • Kamath RS, Martinez-Campos M, Zipperlen P, Fraser AG, Ahringer J. 2001. Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biol 2:RESEARCH0002.
  • Katso RM, Russell RB, Ganesan TS. 1999. Functional analysis of H-Ryk, an atypical member of the receptor tyrosine kinase family. Mol Cell Biol 19:64276440.
  • Lo MC, Gay F, Odom R, Shi Y, Lin R. 2004. Phosphorylation by the beta-catenin/MAPK complex promotes 14-3-3-mediated nuclear export of TCF/POP-1 in signal-responsive cells in C. elegans. Cell 117:95106.
  • Logan CY, Nusse R. 2004. The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol 20:781810.
  • Lu W, Yamamoto V, Ortega B, Baltimore D. 2004. Mammalian Ryk is a Wnt coreceptor required for stimulation of neurite outgrowth. Cell 119:97108.
  • Lyu J, Yamamoto V, Lu W. 2008. Cleavage of the Wnt receptor Ryk regulates neuronal differentiation during cortical neurogenesis. Dev Cell 15:773780.
  • Macheda ML, Sun WW, Kugathasan K, Hogan BM, Bower NI, Halford MM, Zhang YF, Jacques BE, Lieschke GJ, Dabdoub A, Stacker SA. 2012. The Wnt receptor Ryk plays a role in mammalian planar cell polarity signaling. J Biol Chem 287:2931229323.
  • Maduro M, Pilgrim D. 1995. Identification and cloning of unc-119, a gene expressed in the Caenorhabditis elegans nervous system. Genetics 141:977988.
  • Maloof JN, Whangbo J, Harris JM, Jongeward GD, Kenyon C. 1999. A Wnt signaling pathway controls hox gene expression and neuroblast migration in C. elegans. Development 126:3749.
  • Morton DG, Shakes DC, Nugent S, Dichoso D, Wang W, Golden A, Kemphues KJ. 2002. The Caenorhabditis elegans par-5 gene encodes a 14-3-3 protein required for cellular asymmetry in the early embryo. Dev Biol 241:4758.
  • Niehrs C. 2012. The complex world of WNT receptor signalling. Nat Rev Mol Cell Biol 13:767779.
  • Pinkas-Kramarski R, Soussan L, Waterman H, Levkowitz G, Alroy I, Klapper L, Lavi S, Seger R, Ratzkin BJ, Sela M, Yarden Y. 1996. Diversification of Neu differentiation factor and epidermal growth factor signaling by combinatorial receptor interactions. EMBO J 15:24522467.
  • Sawa H, Lobel L, Horvitz HR. 1996. The Caenorhabditis elegans gene lin-17, which is required for certain asymmetric cell divisions, encodes a putative seven-transmembrane protein similar to the Drosophila frizzled protein. Genes Dev 10:21892197.
  • Sternberg PW, Horvitz HR. 1988. lin-17 mutations of Caenorhabditis elegans disrupt certain asymmetric cell divisions. Dev Biol 130:6773.
  • Wang W, Shakes DC. 1997. Expression patterns and transcript processing of ftt-1 and ftt-2, two C. elegans 14-3-3 homologues. J Mol Biol 268:619630.
  • Wouda RR, Bansraj MR, de Jong AW, Noordermeer JN, Fradkin LG. 2008. Src family kinases are required for WNT5 signaling through the Derailed/RYK receptor in the Drosophila embryonic central nervous system. Development 135:22772287.