SEARCH

SEARCH BY CITATION

Keywords:

  • Allergy;
  • Cytokine receptors;
  • Cytokines;
  • Eosinophils

Abstract

  1. Top of page
  2. Abstract
  3. 1 Introduction
  4. 2 Results
  5. 3 Discussion
  6. 4 Materials and methods
  7. Acknowledgements

The pathogenesis of human asthma and the development of key features of pulmonary allergy in mouse models has been critically linked to IL-13. Analyses of the receptor components employed by IL-13 have shown that delivery of this cytokine to the airways of naive IL-4Rα gene targeted (IL-4Rα–/–) mice fails to induce disease, suggesting that this membrane protein is critical for transducing IL-13-mediated responses. The current study demonstrates that, in contrast to naive mice, T helper 2 bias, airways hyperreactivity (AHR) and tissue eosinophilia develop in Ovalbumin-sensitized IL-4Rα–/– mice and that these responses can be inhibited by the IL-13 antagonist sIL-13Rα2Fc. Therefore, antigen stimulation induces an IL-13-regulated response that is independent of IL-4Rα. To determine the role of IL-5 and eosinophils in the development of disease in antigen-exposed IL-4Rα–/– mice, pulmonary allergy was examined in mice deficient in both factors. IL-4Rα/IL-5–/– mice were significantly defective in their ability to produce IL-13 and failed to develop AHR, suggesting that IL-5 indirectly regulates AHR in allergic IL-4Rα–/– mice by an IL-13-dependent mechanism. Collectively, these results demonstrate that IL-13-dependent processes regulating the development of AHR and T helper bias persist in the inthe lungs of allergic IL-4Rα–/– mice.

Abbreviations:
AHR:

Airways hyperreactivity

WT:

Wild type

Sal:

Saline (-sensitized)

MLC:

Mixedlymphocyte culture

PBLN:

Peribronchial lymph nodes

1 Introduction

  1. Top of page
  2. Abstract
  3. 1 Introduction
  4. 2 Results
  5. 3 Discussion
  6. 4 Materials and methods
  7. Acknowledgements

Inflammation of the airways is intimately linked to the development and exacerbation of asthma. The numbers of activated CD4+ T lymphocytes and the expression of Th2 cytokines, including interleukin (IL)-4, IL-5 and IL-13, in the airways of asthmatics correlate with disease severity 14 and regulate a complex immune response that underpins obstruction, hyperreactivity to spasmogenic stimuli and tissue remodeling. While the roles of IL-4 and IL-5 have been well characterized as contributing factors in the propagation of Th2 responses and eosinophilia, respectively, growing evidence suggests that IL-13 significantly regulates asthma pathology. Expression of IL-13 is elevated in the bronchial mucosa of atopic asthmatics compared to normal patients 4 and is further up-regulated in response to allergen provocation 5. In mouse models, blockade of IL-13 ablates allergen-induced airways hyperreactivity (AHR) and the hypersecretion of mucus 6, 7. In contrast, overexpression of IL-13 in transgenic mice induces many pathological features of asthma, including subepithelial fibrosis 8, 9.

The receptor complex employed by IL-13 is thought to comprise a heterodimer of IL-4Rα and IL-13Rα1. Because of its more extensive cytoplasmic domain containing binding sites for several transcription factors, IL-4Rα appears to be the primary signaling component, while IL-13Rα1 provides the IL-13 docking site to initiate formation of the ligand-receptor complex. The weak interaction of IL-13 with cells transfected with IL-13Rα1 is greatly enhanced by co-transfection with IL-4Rα, suggesting these subunits form a high-affinity complex capable of transmitting IL-13-induced proliferative responses 1013. Notably, the individual expression of IL-4Rα or IL-13Rα1 fails to activate Th2-dependent transcription factors 13. In contrast, IL-13Rα2 is unable to form a mitogenic-inducing complex with IL-4Rα, which may be attributable to its minimal cytoplasmic domain 14. The observation that IL-13Rα2 binds IL-13 with high affinity and blocks its interaction with the IL-13Rα1/IL-4Rα complex without activating signaling pathways suggests that IL-13Rα2 functions as a decoy receptor to inhibit IL-13-induced responses 1416. In fact, mice deficient in IL-13Rα2 display a phenotype consistent with enhanced IL-13 responses in vivo17. Consequently, a number of studies have effectively employed a soluble recombinant form of IL-13Rα2 to block the function of IL-13 both in vitro and in vivo6, 7, 16, 18.

IL-4Rα, which can also heterodimerize with the gamma common chain to form a complex responsive to IL-4 19, is thought to be an important regulator of the proliferation and polarization of Th2 lymphocytes 20. The availability of IL-4Rα–/– mice has facilitated investigations into the role of this receptor component in Th2 immunity in vivo. Interestingly, parasite models employing IL-4Rα–/– mice suggest that Th2 responses can develop in the absence of IL-4Rα 2123. We have previously employed two distinct models to investigate the development of allergic responses in IL-4Rα–/– mice. Delivery of IL-13 to the airways of naive wild-type (WT) mice induces eosinophilia, AHR and goblet cell hyperplasia. However, these processes are not manifested in similarly treated IL-4Rα–/– mice, demonstrating that in the absence of antigen, IL-4Rα is a critical conduit of IL-13-induced pathology 6, 24. In contrast, we demonstrated that AHR can be induced by adoptive transfer of antigen-specific Th2-biased WT CD4+ cells to IL-4Rα–/– mice, but not by antigen-specific CD4+ T cells from IL-13–/– mice, suggesting that IL-13 from the adoptively transferred cells can induce AHR in the recipient mouse in the absence of endogenous IL-4Rα 25. Importantly, this study implied that antigen-driven interactions can override the absolute requirement for IL-4Rα to regulate IL-13 responses in naive mice. However, it was uncertain whether the transferred IL-13–/– CD4+ cells trafficked to the lung with the same kinetics as similarly transferred WT cells, and secondly, as IL-4Rα plays a role in the generation of Th2 cytokines, whether sufficient endogenous IL-13 can be generated in the absence of IL-4Rα to induce downstream IL-13-dependent, but IL-4Rα-independent effector function.

In this study we aimed to eliminate these variables by employing an antigen-driven model to examine the development of allergy and expression of endogenous IL-13 in IL-4Rα–/–mice. Furthermore, we used the sIL-13Rα2Fc antagonist 6, 7, 16, 18 to specifically demonstrate that endogenous IL-13 can regulate AHR and T helper responses independently of IL-4Rα. By employing IL-4Rα/IL-5–/– mice, we extended these investigations to determine the role of IL-5 and eosinophils in pathogenic events that operate independently of IL-4Rα.

2 Results

  1. Top of page
  2. Abstract
  3. 1 Introduction
  4. 2 Results
  5. 3 Discussion
  6. 4 Materials and methods
  7. Acknowledgements

2.1 AHR, but not the hypersecretion of mucus, persists in Ova-sensitized IL-4Rα–/– mice

Ova-sensitized IL-4Rα–/– mice developed significant AHR compared to saline (Sal)-sensitized IL-4Rα–/– mice and to a level that was comparable to Ova-sensitized WT mice (Fig. 1A). In contrast to the hypersecretion of mucus seen in Ova-sensitized WT mice, no antigen-induced increase in the secretion of mucus was detected in Ova-sensitized IL-4Rα–/– mice (Fig. 1B). As IL-13 has been implicated in directly regulating AHR, we determined whether Ova sensitization stimulated the production of IL-13 in IL-4Rα–/– mice. Although decreased compared to that produced by Ova-sensitized WT mice, IL-13 was detected in the supernatants of antigen-stimulated peribronchial lymph node (PBLN) cultures from Ova-sensitized IL-4Rα–/– mice (Fig. 1C). These observations suggest that while IL-4Rα is critical for the development of antigen-induced hypersecretion of mucus, it is not essential for the development of AHR or for stimulating the production of IL-13.

thumbnail image

Figure 1. AHR, mucus secretion and IL-13 production in Ova-sensitized WT and IL-4Rα–/– mice. (A) AHR is represented as the percent increase over a baseline of 100% in response to water. AHR in Ova-sensitized WT mice was significantly elevated (p<0.05) compared to Sal-sensitized WT mice at all concentrations of methacholine (mean of 6–8 mice per group ± SEM). AHR in Ova-sensitized IL-4Rα–/– mice was significantly elevated (p<0.05) at concentrations higher than 6.25 mg/ml methacholine in this experiment, although in some experiments significant differences in AHR between Ova- and Sal-sensitized IL-4Rα–/– mice extended to concentrations ranging from 3.13 mg/ml (see Fig. 2). (B) The number of mucin-positive cells per high power microscopic field (×1000) was counted in comparable sections of lung epithelium. (C) IL-13 produced by PBLN cultured ex vivo was measured by ELISA (p<0.05 in both Ova-sensitized IL-4Rα–/– and WT mice compared to their Sal-sensitized counterparts; *;not detected). Independent assays were conducted at least twice in duplicate, and comparative assays were conducted simultaneously.

Download figure to PowerPoint

2.2 IL-13 regulates AHR in Ova-sensitized IL-4Rα–/– mice

To determine the role of IL-13 in regulating AHR in Ova-sensitized IL-4Rα–/– mice, this cytokine was blocked by the systemic delivery of a soluble recombinant IL-13Rα2Fc fusion protein, which specifically binds to and neutralizes IL-13 7, 16. Neutralization of IL-13 in Ova-sensitized IL-4Rα–/– mice reduced AHR to responses near those seen in Sal-sensitized IL-4Rα–/– mice (Fig. 2A). Moreover, to determine if delivery of exogenous IL-13 could further enhance antigen-induced AHR, IL-13 was delivered to the lungs of Ova-sensitized IL-4Rα–/– and WT mice (Fig. 2B). While exogenous IL-13 induced a trend towards an increase in AHR compared to that induced by endogenous antigen-driven responses in WT and IL-4Rα–/– mice, this was not significant in either strain. Collectively, these observations demonstrate that the AHR observed in Ova-sensitized IL-4Rα–/– mice is regulated by IL-13 and while exogenous IL-13 potentiates AHR in Ova-sensitized IL-4Rα–/– and WT mice, the AHR that develops in response to endogenous inflammation is near maximal in both strains.

thumbnail image

Figure 2. AHR in IL-4Rα–/– mice treated with sIL-13Rα2Fc or with exogenous IL-13. Ova-sensitized IL-4Rα–/– mice were treated with sIL-13Rα2-human Fc fusion protein or human Ig control. (A) AHR in Ova-sensitized IL-4Rα–/– mice treated with sIL-13Rα2Fc was reduced compared to treatment with control Ig at concentrations of methacholine above 3.13 mg/ ml (p< 0.05). Ova- and Sal-sensitized WT mice are included for comparison. (B) AHR was also measured in Ova-sensitized IL-4Rα–/– mice treated intratracheally with IL-13 in normal saline (NS), or saline only. Data are presented for 25 mg/ml methacholine, which is the maximal response and representative of the full methacholine dose response.

Download figure to PowerPoint

2.3 T helper responses are modulated by IL-13 in Ova-sensitized IL-4Rα–/– mice

As IL-13 can induce AHR in Ova-sensitized IL-4Rα–/– mice, we investigated the development of T helper bias in these mice and whether it was influenced by the levels of functional IL-13. Ova-sensitized IL-4Rα–/– mice exhibited significantly elevated levels of both IL-4 and IFN-γ compared to Sal-sensitized IL-4Rα–/– mice (Fig. 3A–D). In addition, blockade of IL-13 in Ova-sensitized IL-4Rα–/– mice with the sIL-13Rα2Fc antagonist significantly increased IFN-γ (Fig. 3B), but not IL-4 (Fig. 3A). Conversely, exogenous IL-13 delivered to Ova-sensitized IL-4Rα–/– mice significantly enhanced IL-4 (Fig. 3C), but not IFN-γ (Fig. 3D). Therefore, Ova-sensitized IL-4Rα–/– mice exhibited a mixed Th1/Th2 response, and IL-13 either inhibited Th1 or enhanced Th2 responses depending on the manner by which IL-13 levels were modulated. To determine if IL-13 could directly influence cytokine production in vitro, exogenous IL-13 (50 ng/ml) was added to cultures of PBLN cells derived from Ova-sensitized WT and IL-4Rα–/– mice. Whereas no change in IL-4 production was observed (Fig. 3E), exogenous IL-13 significantly inhibited production of IFN-γ by both WT and IL-4Rα–/– cultures (Fig. 3F). Importantly, IL-13 affected these responses in the absence of IL-4Rα.

thumbnail image

Figure 3. The role of IL-13 in modulating cytokine production in IL-4Rα–/– mice. Cell suspensions of PBLN from Ova-sensitized IL-4Rα–/– mice in which IL-13 was either blocked with sIL-13Rα2Fc (upper panel) or supplemented with exogenous IL-13 (middle panel) were restimulated in vitro with Ova. PBLN from Ova-sensitized WT and IL-4Rα–/– mice were also treated with IL-13 in vitro (lower panel). IL-4 (A, C and E) and IFN-γ (B, D and F) were measured by ELISA. Negligible levels of these cytokines were detected in cultures without Ova (not shown). Comparative assays were conducted as described in the legend to Fig. 1.

Download figure to PowerPoint

2.4 IL-13Rα1 and IL-13Rα2 are expressed in Ova-sensitized IL-4Rα–/– mice

As IL-13 has been shown to bind to IL-13Rα1 and IL-13Rα2, we examined whether these receptor subunits are expressed in mice deficient in IL-4Rα. Expression of the gene encoding IL-13Rα1 was detected in Sal-sensitized WT mice but was barely detectable in Sal-sensitized IL-4Rα–/– mice (Fig. 4). Inflammation enhanced the expression of IL-13Rα1 in both strains. Although expression of the gene encoding IL-13Rα2 was not detected in Sal-sensitized mice, it was highly up-regulated in both Ova-sensitized WT and IL-4Rα–/– mice. However, overall, lower expression of both IL-13Rα1 and IL-13Rα2 was observed in IL-4Rα–/– mice compared to WT mice. These data suggest that IL-13Rα1 and IL-13Rα2 are available to modulate IL-13 responsiveness in Ova-sensitized IL-4Rα–/– mice.

thumbnail image

Figure 4. The expression of genes encoding IL-13Rα1 and IL-13Rα2 in WT and IL-4Rα–/– mice. RT-PCR products were Southern blotted and hybridized with oligonucleotide probes, which were detected by enhanced chemiluminescence. Lane 1, RT-control; lane 2, PCR control; lane 3, Sal-sensitized IL-4Rα–/– mice; lane 4, Ova-sensitized IL-4Rα–/– mice; lane 5, Sal-sensitized WT mice; and lane 6, Ova-sensitized WT mice. The housekeeping gene HPRT was used to control for sample variation. Data are representative of four mice per group

Download figure to PowerPoint

2.5 Eosinophilia in Ova-sensitized IL-4Rα–/– mice

Eosinophils were recruited to the peribronchial region in Ova-sensitized IL-4Rα–/– mice (Fig. 5A) but were unable to permeate into the airway lumen (Fig. 5B). Treatment of Ova-sensitized IL-4Rα–/– mice with sIL-13Rα2Fc attenuated, but did not significantly reduce tissue eosinophilia. Expression of the eosinophil-associated chemokine eotaxin was not enhanced during inflammation in these mice (Fig. 5C). In contrast, elevated levels of antigen-induced IL-5, a molecule that also regulates eosinophil function, were observed (Fig. 5D).

thumbnail image

Figure 5. Eosinophil recruitment in Ova-sensitized IL-4Rα–/– mice. Peribronchial eosinophils (A) and total eosinophils in the bronchoalveolar lavage fluid (B) were determined in Ova-sensitized and Sal-sensitized IL-4Rα–/– mice treated with control Ig and in Ova-sensitized IL-4Rα–/– mice in which IL-13 function was blocked with sIL-13Rα2Fc (mean ± SEM 6–8 per group). Eotaxin in the lung (C) and IL-5 production by Ova-stimulated ex vivo PBLN cultures (D) were measured by ELISA. The eosinophilia, eotaxin and IL-5 production from a representative experiment using Ova-sensitized WT mice is presented for comparison. ELISA assays were conducted as described in the legend to Fig. 1.

Download figure to PowerPoint

2.6 AHR and IL-13 responses in Ova-sensitized IL-4Rα/IL-5–/– mice

To determine the roles of IL-5 and eosinophils in the development of AHR in IL-4Rα–/– mice, we examined responses in IL-4Rα–/– mice that were also deficient in IL-5. Ova-sensitized IL-4Rα/IL-5–/– mice failed to develop peribronchial eosinophilia (Fig. 6A) and exhibited airways responsiveness that was not statistically different from that in Sal-sensitized IL-4Rα/IL-5–/– mice (Fig. 6B). The deficiency in IL-5 also reduced the levels of IL-13 produced by PBLN of Ova-sensitized IL-4Rα–/– mice (Fig. 6C) and IL-4 and IL-13 produced by Th2-biased IL-4Rα/IL-5–/– CD4+ cells compared to IL-4Rα–/– CD4+ cells (Fig. 6D, E). This suggests that IL-5 modulates the production of IL-13 in Ova-sensitized IL-4Rα–/– mice and that this deficiency in IL-13 may in turn inhibit the development of AHR.

thumbnail image

Figure 6. Eosinophilia, AHR and cytokine production in IL-4Rα/IL-5–/– mice. (A) Eosinophils were counted in similar peribronchial high power fields. (B) AHR was assessed by Buxco plethysmography (mean ± SEM for 6–8 mice per group, @p< 0.05 for Ova-sensitized IL-4Rα–/– mice compared to Ova-sensitized IL-4Rα/IL-5–/– mice. (C) Levels of IL-13 produced by Ova-stimulated PBLN cultures were measured by ELISA. Representative assays from IL-4Rα–/– mice are included for comparison. Culture supernatants from WT, IL-4Rα–/– and IL-4Rα/IL-5–/– CD4+ cells purified from Th2-biased splenocytes were assayed for IL-4 (D) and IL-13 (E) as described above. For IL-4Rα–/– samples compared to similarly treated IL-4Rα/IL-5–/– samples (A, C–D), #p< 0.05, *;not detected.

Download figure to PowerPoint

3 Discussion

  1. Top of page
  2. Abstract
  3. 1 Introduction
  4. 2 Results
  5. 3 Discussion
  6. 4 Materials and methods
  7. Acknowledgements

In this investigation we show that IL-13 can induce defined pathophysiological features of allergic airways disease in the absence of IL-4Rα. In mouse models of asthma, IL-13 induces features of allergy that include AHR, mucus hypersecretion, eosinophilia and subepithelial fibrosis 49, 24. The observation that these pathogenic processes fail to develop in naive IL-4Rα–/– mice treated with exogenous IL-13 delivered to the respiratory tract has led to the conclusion that IL-4Rα is a critical receptor component for IL-13-induced responsiveness in the lung 6, 7, 24. However, we have previously shown that AHR develops after adoptive transfer of antigen-specific IL-13-producing T cells (but not T cells deficient in this factor) in conjunction with antigen inhalation in naive IL-4Rα–/– mice 25. While these data suggested that IL-13 could regulate AHR independently of IL-4Rα in antigen-driven responses, it was not clear whether the deficiency in IL-13 influenced the kinetics with which the adoptively transferred IL-13–/– T cells trafficked to the lung or whether it was possible to stimulate sufficient endogenous IL-13 in Ova-sensitized IL-4Rα–/– mice to induce disease. In the present study, treatment with sIL-13Rα2Fc significantly inhibited antigen-induced AHR in IL-4Rα–/– mice. Furthermore, contrasting observations in naive and Ova-sensitized IL-4Rα–/– mice indicate that priming the immune system with antigen may modify the manner by which IL-13 functions in these mice.

As IL-4Rα–/– mice exhibit some deficiencies in aspects of allergic responses, they provided the opportunity to analyze pathophysiological processes that predispose the development of AHR. Notably, AHR persisted in the absence of the hypersecretion of mucus, enhanced eotaxin expression and the migration of eosinophils into the airway lumen, showing that although signaling through IL-4Rα is crucial for antigen-induced mucus and spatial aspects of eosinophil trafficking, AHR develops independently of these processes. Modulation of IL-13 levels in Ova-sensitized IL-4Rα–/– mice also influenced the T helper bias. Ova-sensitized IL-4Rα–/– mice exhibited a mixed Th1/Th2 cytokine profile, and blockade of IL-13 during the challenge period enhanced IFN-γ production, while supplementation with exogenous IL-13 enhanced IL-4 production by PBLN cultures. Although the timing of IL-13 delivery (6 h before the last aerosol challenge) or the neutralization of IL-13 with sIL-13Rα2 (2 h before every aerosol challenge) was distinct, overall, IL-13 inhibited Th1 and promoted Th2 responses in Ova-sensitized IL-4Rα–/– mice. As no membrane expression of IL-13Rα1 has been detected on T cells 26, it seems unlikely that IL-13 directly modulates the T helper cell bias. However, IL-13 can inhibit IL-12 and IFN-γ production by LPS-activated macrophages 27 suggesting that IL-13 modulates T cell responses in Ova-sensitized IL-4Rα–/– mice by influencing macrophage function. We extended this observation to demonstrate that the addition of IL-13 to cultures of PBLN from both Ova-sensitized WT and IL-4Rα–/– mice inhibited IFN-γ production. Importantly, these data show that IL-13 can function to regulate immune responses as well as AHR in IL-4Rα–/– mice.

Although we have not determined how IL-13 can function in allergic IL-4Rα–/– mice, the receptor employed may include the IL-13Rα1and/or α2 subunits, which were both expressed in the lungs of allergic IL-4Rα–/– mice. Other studies have suggested that a soluble form of IL-13Rα1 can bind a membrane-associated complex of IL-13Rα1 and IL-13 to displace the interaction of this heterodimer with IL-4Rα 28. This configuration is thought to be sufficient to transduce IL-13 signaling. Perhaps in the absence of IL-4Rα, a complex of IL-13 with IL-13Rα1 is similarly sufficient to signal in the allergic lung.

While eosinophils were abundant in the blood (data not shown) and tissues of Ova-sensitized IL-4Rα–/– mice, these cells failed to permeate into the airway lumen. To investigate the mechanism underlying the development of tissue eosinophilia and the potential role of this cell in modulating AHR in Ova-sensitized IL-4Rα–/– mice, we examined expression of the eosinophil chemokine eotaxin and the eosinophil-modulating cytokine IL-5. No enhanced expression of eotaxin was detected in Ova-sensitized IL-4Rα–/– mice, suggesting that eotaxin is not obligatory for the transendothelial migration of eosinophils into the lung tissue but may play a role in transepithelial permeation into the airway lumen. In contrast, IL-5 was expressed by PBLN from Ova-sensitized IL-4Rα–/– mice. Therefore, tissue eosinophilia is likely to be a combination of the IL-5-mediated availability of a peripheral pool of eosinophils and the expression of other chemotactic signals generated in the lungs of Ova-sensitized IL-4Rα–/– mice.

To determine the roles of IL-5 and eosinophils in Ova-sensitized IL-4Rα–/– mice, we generated a mouse genetically deficient in both IL-4Rα and IL-5. Negligible peribronchial eosinophils were seen in these mice, and they failed to mount airways responsiveness that was significantly elevated compared to Sal-sensitized IL-4Rα/IL-5–/– mice. In comparison, we observed significant eosinophilia in Ova-sensitized IL-4Rα–/– mice despite blockade of IL-13 that inhibited AHR. A recent study by Walter et al. also showed that AHR failed to develop in Ova sensitized IL-13–/– mice despite the presence of an abundant pulmonary eosinophilia 29. Several explanations could be offered for linking the seemingly distinct observations that neutralization of IL-13 eliminates AHR despite the presence of eosinophils, yet deficiency in IL-5 and eosinophils ablates AHR in Ova-sensitized IL-4Rα–/– mice. While it is possible that IL-13 is required to activate tissue eosinophils to release factors that induce AHR, an alternative scenario is suggested by our previous observation that IL-13 is reduced in Ova-sensitized IL-5–/– mice to around 30% of that seen in Ova-sensitized WT mice 30. Notably, Ova-sensitized IL-5–/– BALB/c mice develop AHR similar to Ova-sensitized WT mice 30, 31. In the present study we show that IL-13 production by purified in vitro Th2-biased IL-4Rα–/– CD4+ cells is reduced to 27% of that produced by WT cells. However, IL-13 is further reduced to 6% of WT when the additional defect in IL-5 is introduced. A similar profile of IL-13 production is observed when PBLN cells from these mice are cultured ex vivo. Thus the degree of AHR directly correlates with the levels of IL-13 produced. IL-5 is not thought to directly influence T helper lymphocyte function 32, although we have previously shown that eosinophils play a role in antigen presentation and express co-stimulatory surface molecules 33. The important and novel aspect of the current study is that IL-5 can influence T helper function by a mechanism that bypasses the requirement for IL-4Rα. A schematic overview of the proposed relationship between IL-5, IL-13 and the development of AHR in IL-4Rα–/– mice is presented in Fig. 7.

thumbnail image

Figure 7. Schematic overview of the proposed interaction of IL-5 and IL-13 in the development of AHR in allergic IL-4Rα–/– mice. (1.) IL-5 and/or eosinophils regulate the production of IL-13 by Th2 lymphocytes. (2.) IL-13 indirectly regulates Th2 responses by modulating antigen presenting cell function and induces processes that underlie the development of AHR. We propose that processes 1 and 2 can be regulated by an IL-13-responsive receptor in IL-4Rα–/– mice.

Download figure to PowerPoint

In conclusion, we have shown that IL-4Rα is fundamental for some, but not all features of allergic disease. Sufficient endogenous IL-13 is produced in Ova-sensitized IL-4Rα–/–mice to induce AHR and to regulate the T helper bias. However, IL-4Rα is critical for mucus hypersecretion, eotaxin production and spatial aspects of eosinophil trafficking in the allergic lung. The dichotomy in processes that are dependent on IL-4Rα is probably reflective of the diversity of cells that are responsive to IL-13 and their potential to do so in allergic IL-4Rα–/– mice. While the role of IL-5 in regulating expression of IL-13 is intriguing, the molecular mechanism remains elusive. Collectively, this investigation provides new insights into the molecularregulation of the cytokine network underlying allergic disease.

4 Materials and methods

  1. Top of page
  2. Abstract
  3. 1 Introduction
  4. 2 Results
  5. 3 Discussion
  6. 4 Materials and methods
  7. Acknowledgements

4.1 Induction of allergic airways inflammation

IL-4Rα–/– mice were generated from BALB/c embryonic stem cells as previously described 34. IL-4Rα/IL-5–/– mice were generated by crossing IL-5–/– N10 BALB/c mice 31, 32 with IL-4Rα–/– BALB/c mice. Equal numbers of male and female mice were sensitized at 6–8 weeks of age by intraperitoneal (i.p.) injection with 50 μg Ovalbumin (Ova: Sigma Grade V) mixed with 1 mg Alhydrogel (CSL Ltd., Parkville, Australia) in 0.9% sterile saline. Nonsensitized mice received 1 mg Alhydrogel in 0.9% saline. On days 12, 14, 16 and 18, all mice were challenged with aerosolized 10 mg/ml Ova in 0.9% saline three times for 30 min, with 30 min breaks between treatments as previously described 31, 35, 36. In some experiments Ova-sensitized IL-4Rα–/– mice were treated with 400 μg soluble IL-13Rα2Fc fusion protein or purified control human Ig 7, 16 injected i.p. 2 h before every aeroallergen challenge or with 10 μg purified recombinant IL-13 delivered intratracheally 6 h before thelast challenge (both reagents generously supplied by Wyeth Research, Cambridge, MA). AHR was measured 24 h after the last challenge. Mice were killed by cervical dislocation and the inflammation and morphological changes to the airways characterized. Mice were treated according to Australian National University Animal Welfare guidelines (Protocol number DMB 59/01) and were housed in a specific pathogen-free facility.

4.2 Characterization of lung morphology and eosinophils in blood, tissue and bronchoalveolar lavage fluid

Lungs were fixed in 10% phosphate-buffered formalin, sectioned and stained with Carbol's Chromotrope-Hematoxylin for the identification of eosinophils or with Alcian blue-periodic-acid Schiff for the enumeration of mucin-secreting cells. Leukocytes in the blood, bronchoalveolar lavage fluid and peribronchial region were identified by morphological criteria and quantitated as previously described 31, 35. Mucin-secreting cells were quantitated by counting the number of mucin-positive cells in the bronchi-bronchiole epithelial regions in 40 high power fields (×1000).

4.3 Measurement of AHR

Responsiveness to β-methacholine was assessed in conscious, unrestrained mice by barometric plethysmography, using the apparatus and software supplied by Buxco (Troy, NY). Measurement was performed essentially as previously described 36, 37. Briefly, mice were placed in the plethysmograph chamber and exposed to an aerosol of water (baseline readings) and then cumulative concentrations of β-methacholine ranging from 3.125 to 25 mg/ml. The aerosol was generated with an ultrasonic nebulizer and drawn through the chamber for 2 min. The inlet was then closed, and Penh readings taken for 3 min were averaged. Values were reported as the mean percentage increase over baseline ± SEM (n=6–8 mice per group).

4.4 Measurement of antigen-specific cytokine production by PBLN cells

Cells from the PBLN were isolated, washed and stimulated with 1 mg/ml Ova in mixed lymphocyte culture (MLC) medium for 72 h at 37°C and 5% CO2 in 96-well plates with 1×106 cells per well as described previously 38. The concentrations of IL-4, IL-5, IL-13 and IFN-γ in the cell-free supernatants were measured by ELISA in two to three independent assays as described elsewhere 36. The sensitivity of detection was 12 pg/ml for IL-4, 24 pg/ml for IL-5 and IL-13 and 50 pg/ml for IFN-γ. The paired capture and detection IL-4, IL-5 and IFN-γ antibodies were obtained from PharMingen (San Diego, CA), and the IL-13 antibodies were purchased from R & D Systems (Minneapolis, MN).

4.5 In vitro polarization of T cells

Equal numbers of male and female mice were sensitized at 6–8 weeks of age by i.p. injection with 50 μg Ova mixed with 1 mg Alhydrogel in 0.9% sterile saline. Splenocytes were recovered after 7 days, erythrocytes were lysed and the washed splenocytes were stimulated with 200 μg/ml Ova and polarized toward a Th2 phenotype in vitro with 40 ng/ml mIL-4 (kind gift from S. Ford and I. G. Young, JCSMR) and anti-IFN-γ antibody (R46A2, 70 μg/ml) in MLC medium. After incubation for 7 days at 37°C and 5% CO2, CD4+ cells were purified using the Minimacs magnetic bead system following the manufacturer's recommendations (Miltenyi Biotec, Germany). Th2-biased CD4+ cells (5×106/ml) were restimulated with 1×106/ml mitomycin C-treated naive splenocytes (40 μg/ml for 60 min at 37°C, followed by extensive washing in PBS) and 200 μg/ml Ova in MLC medium at 37°C and 5% CO2 for 3 days. Cell-free culture supernatants were removed and assayed for cytokine production as described above.

4.6 Measurement of eotaxin in the lung

To measure eotaxin, the large pulmonary lobe was finely minced in 1 ml MLC medium and then incubated at 37°C for 30 min. Eotaxin in the cell-free supernatant was measured by ELISA using pairedcapture and detection antibodies and an eotaxin standard following the manufacturer's recommendations (R&D Systems, Minneapolis, MN). The limit of detection for eotaxin was 100 pg/ml.

4.7 Reverse transcriptase-PCR (RT-PCR) analysis for IL-13Rα1 and IL-13Rα2

Total RNA was isolated from lungs by a standard method with RNAzol B (Biotech Laboratories). RT-PCR was performed as previously described 39. The primers and probes for all genes were purchased from GIBCO BRL. Sense and antisense primer sequences for IL-13R α1, IL-13Rα2 and HPRT have been described previously 16, 39, 40. Probe sequences for IL-13Rα1, IL-13Rα2 and HPRT were: IL-13Rα1, GGTGATCCTGAGTCCGCTGTG; IL-13Rα2, GGATGGGTTTGATCTTAATAAAGG; and HPRT, GTTGTTGGATATGCCCTTGAC. The number ofcycles used for amplification of each gene product were: IL-13Rα1 and IL-13Rα2, 35 cycles and HPRT, 25 cycles. After the appropriate number of PCR cycles, the amplified DNA was analyzed by gel electrophoresis, Southern blotting and detection using the enhanced chemiluminescence detection system as recommended by the manufacturer (Amersham Corporation, Arlington Heights, IL). PCR amplification with the HPRT reference gene was performed to assess variations in cDNA or total RNA loading between samples.

4.8 Statistical analysis

The significance of differences between experimental groups was analyzed using Student's unpaired t-test. Values were reported as the mean ± standard error of the mean (SEM). Differences in means were considered significant if p<0.05.

Acknowledgements

  1. Top of page
  2. Abstract
  3. 1 Introduction
  4. 2 Results
  5. 3 Discussion
  6. 4 Materials and methods
  7. Acknowledgements

We thank Aulikki Koskinen for skilled technical assistance and Vane Damcevski for breeding the IL-4Rα/IL-5–/– mice. This research was supportedby a Human Frontiers Grant awarded to PSF and a National Health and Medical Research Council (NHMRC) Program Grant (No. 224207) to P.S.F. and K.I.M. D.W is supported by a NHMRC Peter Doherty Training Fellowship (No. 179841) and by a contribution from the New South Wales Asthma Foundation, Australia.

  • 1

    WILEY-VCH

  • 2

    WILEY-VCH

  • 3

    WILEY-VCH

  • 4

    WILEY-VCH

  • 5

    WILEY-VCH

  • 6

    WILEY-VCH

  • 7

    WILEY-VCH

  • 1
    Walker, C., Kaegi, M. K., Braun, P. and Blaser, K., Activated T cells and eosinophilia in bronchoalveolar lavages from subjects with asthma correlated with disease severity. J. Allergy Clin. Immunol. 1991. 88: 935942.
  • 2
    Robinson, D. S., Hamid, Q., Ying, S., Tsicopoulos, A., Barkans, J., Bentley, A. M., Corrigan, C., Durham, S. R. and Kay, A. B., Predominant TH2-like bronchoalveolar lavage T-lymphocyte population in atopic asthma. N. Engl. J. Med. 1992. 326: 298304.
  • 3
    Corrigan, C. J. and Kay, A. B., T cells and eosinophils in the pathogenesis of asthma. Immunol. Today 1992. 13: 501507.
  • 4
    Kotsimbos, T. C., Ernst, P. and Hamid, Q. A., Interleukin-13 and interleukin-4 are coexpressed in atopic asthma. Proc. Assoc. Am. Phys. 1996. 108: 368373.
  • 5
    Huang, S.-K., Xiao, H.-Q., Kleine-Tebbe, J., Paciotti, G., Marsh, D. G., Lichtenstein, L. M. and Liu, M. C., IL-13 expression at the sites of allergen challenge in patients with asthma. J. Immunol. 1995. 155: 26882694.
  • 6
    Grünig, G., Warnock, M., Wakil, A. E., Venkayya, R., Brombacher, F., Rennick, D. M., Sheppard, D., Mohrs, M., Donaldson, D. D., Locklsley, R. M. and Corry, D. B., Requirement for IL-13 independently of IL-4 in experimental asthma. Science 1998. 282: 22612263.
  • 7
    Wills-Karp, M., Luyimbazi, J., Xu, X., Schofield, B., Neben, T. Y., Karp, C. L. and Donaldson, D. D., Interleukin-13: central mediator of allergic asthma. Science 1998. 282: 22582261.
  • 8
    Zhu, Z., Homer, R. J., Wang, Z., Chen, Q., Geba, G. P., Wang, J., Zhang, Y. and Elias, J. A., Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production. J. Clin. Invest. 1999. 103: 779788.
  • 9
    Lee, C. G., Homer, R. J., Zhu, Z., Lanone, S., Wang, X., Koteliansky, V., Shipley, J. M., Gotwals, P., Noble, P., Chen,Q., Senior, R. M. and Elias, J. A., Interleukin-13 induces tissue fibrosis by selectively stimulating and activating transforming growth factor β1. J. Exp. Med. 2001. 194: 809821.
  • 10
    Hilton, D. J., Zhang, J.-G., Metcalf, D., Alexander, W. S., Nicola, N. A. and Willson, T. A., Cloning and characterization of a binding subunit of the interleukin 13 receptor that is also a component of the interleukin-4 receptor. Proc. Natl. Acad. Sci. USA 1996. 93: 497501.
  • 11
    Aman, M. J., Tayebi, N., O'biri, N. I., Puri, R. K., Modi, W. S. and Leonard, W. J., cDNA cloning and characterization of the human interleukin 13 receptor α chain. J. Biol. Chem. 1996. 271: 2926529270.
  • 12
    Gauchat, J.-F., Schlagenhauf, E., Feng, N.-P., Moser, R., Yamage, M., Jeannin, P., Alouani, S., Elson, G., Notarangelo, L. D., Wells, T., Eugster, H.-P. and Bonnefoy, J.-Y., A novel 4-kb interleukin-13 receptor α mRNA expressed in human B, T, and endothelial cells encoding an alternate type-II interleukin-4/interleukin-13 receptor. Eur. J. Immunol. 1997. 27: 971978.
  • 13
    Miloux, B., Laurent, P., Bonnin, O., Lupker, J., Caput, D., Vita, N. and Ferrara, P., Cloning of the human IL-13Rα1 chain and reconstitution with the IL-4Rα ofa functional IL-4/IL-13 receptor complex. FEBS Lett. 1997. 401: 163166.
  • 14
    Kawakami, K., Taguchi, J., Murata, T. and Puri, R. K., The interleukin-13 receptor α2 chain: an essential component for binding and internalization but not for interleukin-13-induced signal transduction through the STAT6 pathway. Blood 2001. 97: 26732679.
  • 15
    Zhang, J.-G., Hilton, D. J., Willson, T. A., McFarlane, C., Roberts, B. A., Moritz, R. L., Simpson, R. J., Alexander, W. S., Metcalf, D. and Nicola, N. A., Identification, purification and characterization of a soluble interleukin (IL)-13-binding protein. J. Biol. Chem. 1997. 272: 94749480.
  • 16
    Donaldson, D. D., Whitters, M. J., Fitz, L. J., Neben, T. Y., Finnerty, H., Henderson, S. L., O'Hara, R. M. J., Beier, D. R., Turner, K. J., Wood, C. R. and Collins, M., The murine IL-13 receptor α2: molecular cloning, characterization, and comparison with the murine IL-13 receptor α1. J. Immunol. 1998. 161: 23172324.
  • 17
    Wood, N., Whitters, M. J., Jacobsen, B. A., Witek, J., Syoek, J. P., Kasain, M., Epihimer, M. J., Unger, M., Tanaka, T., Goldman, S. J., Collins, M., Donaldson, D. D. and Grusby, M. J., Enhanced Interleukin(IL)-13 responses in mice lacking IL-13 receptor α2. J. Exp. Med. 2003. 6: 703709.
  • 18
    Ford, J. G., Rennick, D., Donaldson, D. D., Venkayya, R., McArthur, C., Hansell, E., Kurup, V. P., Warnock, M. and Grünig, G., IL-13 and IFNγ: Interactions in lung inflammation. J. Immunol. 2001. 167: 17691777.
  • 19
    Nelms, K., Keegan, A. D., Zamorano, J., Ryan, J. J. and Paul, W. E., The IL-4 receptor: Signaling mechanisms and biologic functions. Annu. Rev. Immunol. 1999. 17: 701738.
  • 20
    Mohrs, M., Lacy, D. A. and Locksley, R. M., Stat signals release activated naive Th cells from an anergic checkpoint. J. Immunol. 2003. 170: 18701876.
  • 21
    Jankovic, D., Kullberg, M., Noben-Trauth, N., Caspar, P., Ward, J. M., Cheever, A. W., Paul, W. E. and Sher, A., Schistosome-infected IL-4 receptor knockout (KO) mice, in contrast to IL-4 KO mice, fail to develop granulomatous pathology while maintaining the same lymphokine expression profile. J. Immunol. 1999. 163: 337342.
  • 22
    Mohrs, M., Holscher, C. and Brombacher, F., Interleukin-4 receptor alpha-deficient BALB/c mice show an unimpaired T helper 2 polarization in response to Leishmania major infection. Infect. Immun. 2000. 68: 17731780.
  • 23
    Noben-Trauth, N., Paul, W. E. and Sacks, D. L., IL-4- and IL-4 receptor-deficient BALB/c mice reveal differences in susceptibility to Leishmaina major parasite substrains. J. Immunol. 1999. 162: 61326140.
  • 24
    Yang, M., Hogan, S. P., Henry, P. J., Matthaei, K. I., McKenzie, A. N. J., Young, I. G., Rothenberg, M. E. and Foster, P. S., Interleukin-13 mediates airways hyperreactivity through the IL-4 receptor-alpha chain and STAT-6 independently of IL-5 and eotaxin. Am. J. Respir. Cell Mol. Biol. 2001. 25: 522530.
  • 25
    Mattes, J., Yang, M., Siqueira, A., Clark, K., MacKenzie, J., McKenzie, A. N., Webb, D. C., Matthaei, K. I. and Foster, P. S., IL-13 induces airways hyperreactivity independently of the IL-4Rα chain in the allergic lung. J. Immunol. 2001. 167: 16831692.
  • 26
    Graber, P., Gretener, D., Herren, S., Aubry, J.-P., Elson, G., Poudrier, J., Lecoanet-Henchoz, S., Alouani, S., Losberger, C., Bonnefoy, J.-Y., Kosco-Vilbois, M. H. and Gauchat, J.-F., The distribution of IL-13 receptor α1 expression on B cells, T cells and monocytes and its regulation by IL-13 and IL-4. Eur. J. Immunol. 1998. 28: 42864298.
  • 27
    Muchamel, T., Menon, S., Pisacane, P., Howard, M. C. and Cockayne, D. A., IL-13 protects mice from lipopolysaccharide-induced lethal endotoxemia. J. Immunol. 1997. 158: 28982903.
  • 28
    Poudrier, J., Graber, P., Herren, S., Gretener, D., Elson, G., Berney, C., Gauchat, J.-F. and Kosco-Vilbois, M. H., A soluble form of IL-13 receptor α1 promotes IgG2a and IgG2b production by murine germinal center B cells. J. Immunol. 1999. 163: 11531161.
  • 29
    Walter, D. M., McIntire, J. J., Berry, G., McKenzie, A. N., Donaldson, D. D., DeKruyff, R. H. and Umetsu, D. T., Critical role for IL-13 in the development of allergen-induced airway hyperreactivity. J. Immunol. 2001. 167: 46684675.
  • 30
    Mattes, J., Yang, M., Mahalingam, S., Kuehr, J., Webb, D. C., Simson, L., Hogan, S. P., Koskinen, A., Dent, L., Rothenberg, M. E., Matthaei, K. I., Young, I. G. and Foster, P. S., Intrinsic defect in T cell production of interleukin (IL)-13 in the absence of both IL-5 and eotaxin precludes the development of eosinophilia and airways hypereactivity in experimental asthma. J. Exp. Med. 2002. 195: 14331444
  • 31
    Hogan, S. P., Matthaei, K. I., Young, J. M., Koskinen, A., Young, I. G. and Foster, P. S., A novel T cell-regulated mechanism modulating allergen-induced airways hyperreactivity in BALB/c mice independently ofIL-4 and IL-5. J. Immunol. 1998. 161: 15011509.
  • 32
    Kopf, M., Brombacher, F., Hodgkin, P. D., Ramsay, A. J., Milbourne, E. A., Dai, W. J., Ovington, K. S., Behm, C. A., Köhler, G., Young, I. G. and Matthaei, K. I., IL-5-deficient mice have a developmental defect in CD5+ B-1 cells and lack eosinophilia but have normal antibody and cytotoxic T cell responses. Immunity 1996. 4: 1524.
  • 33
    MacKenzie, J. R., Mattes, J., Dent, L. A. and Foster, P. S., Eosinophils promote allergic disease of the lung by regulating CD4+ Th2 lymphocyte function. J. Immunol. 2001. 167: 31463155.
  • 34
    Noben-Trauth, N., Shultz, L. D., Brombacher, F., Urban, J. F. Jr, Gu, H. and Paul, W. E., An interleukin 4 (IL-4)-independent pathway for CD4+ T cell IL-4 production is revealed in IL-4 receptor-deficient mice. Proc. Natl. Acad. Sci. USA 1997. 94: 1083810843.
  • 35
    Foster, P. S., Hogan, S. P., Ramsay, A. J., Matthaei, K. I. and Young, I. G., Interleukin-5 deficiency abolishes eosinophilia, airways hyperreactivity, and lung damage in a mouse asthma model. J. Exp. Med. 1996. 183: 195201.
  • 36
    Webb, D. C., McKenzie, A. N. J., Koskinen, A. M. L., Yang, M., Mattes, J. and Foster, P. S., Integrated signals between IL-13, IL-4, and IL-5 regulate airways hyperreactivity. J. Immunol. 2000. 165: 108113.
  • 37
    Hamelmann, E., Schwarze, J., Takeda, K., Oshiba, A., Larsen,G. L., Irvin, C. G. and Gelfand, E. W., Noninvasive measurement of airway responsiveness in allergic mice using barometric plethysmography. Am. J. Respir. Crit. Care Med. 1997. 156: 766775.
  • 38
    Hogan, S. P., Koskinen, A., Matthaei, K. I., Young, I. G. and Foster, P. S., Interleukin-5-producing CD4+ T cells play a pivotal role in aeroallergen-induced eosinophilia, bronchial hyperrreactivity, and lung damage in mice. Am. J. Respir. Care Med. 1998. 157: 210218.
  • 39
    Mahalingam, S., Farber, J. M. and Karupiah, G., The interferon-inducible chemokines MuMig and Crg-2 exhibit antiviral activity in vivo. J. Virol. 1999. 73: 14791491.
  • 40
    Schnare, M., Blum, H., Jüttner, S., Röllinghoff, M. and Gessner, A., Specific antagonism of type I IL-4 receptor with a mutated form of murine IL-4. J. Immunol. 1998. 161: 34843492.