Intrahepatic B cell clonal expansions and extrahepatic manifestations of chronic HCV infection

Authors

  • Domenico Sansonno,

    1. Department of Biomedical Sciences and Human Oncology, Section of Internal Medicine and Clinical Oncology, University of Bari Medical School, Bari, Italy
    Search for more papers by this author
  • Gianfranco Lauletta,

    1. Department of Biomedical Sciences and Human Oncology, Section of Internal Medicine and Clinical Oncology, University of Bari Medical School, Bari, Italy
    Search for more papers by this author
  • Valli De Re,

    1. Division of Experimental Oncology I, Centro di Riferimento Oncologico, Aviano, Italy
    Search for more papers by this author
  • Felicia Anna Tucci,

    1. Department of Biomedical Sciences and Human Oncology, Section of Internal Medicine and Clinical Oncology, University of Bari Medical School, Bari, Italy
    Search for more papers by this author
  • Pietro Gatti,

    1. Department of Biomedical Sciences and Human Oncology, Section of Internal Medicine and Clinical Oncology, University of Bari Medical School, Bari, Italy
    Search for more papers by this author
  • Vito Racanelli,

    1. Department of Biomedical Sciences and Human Oncology, Section of Internal Medicine and Clinical Oncology, University of Bari Medical School, Bari, Italy
    Search for more papers by this author
  • Mauro Boiocchi,

    1. Division of Experimental Oncology I, Centro di Riferimento Oncologico, Aviano, Italy
    Search for more papers by this author
  • Franco Dammacco

    Corresponding author
    1. Department of Biomedical Sciences and Human Oncology, Section of Internal Medicine and Clinical Oncology, University of Bari Medical School, Bari, Italy
    • Department of Biomedical Sciences and Human Oncology, Section of Internal Medicine and Clinical Oncology, University of Bari Medical School, Policlinico, Piazza Giulio Cesare 11, I-70124 Bari, Italy Fax: +39-080-547-8820
    Search for more papers by this author

Abstract

B cell repertoire in three biological compartments (liver, bone marrow and peripheral blood) of 30 unselected patients chronically infected with HCV has been characterized. Restriction of humoral immune response defined by enrichment of B cell clonal expansions occurred in the liver of 15 patients (50%), in the bone marrow and peripheral blood of 2 (6.7%) and 8 (26.7%) patients, respectively. An in situ hybridization technique was developed for the detection of dominant B cell clones in patients with monoclonal expansions. It was shown that morphologically distinct B cell expansion contributes to the formation of intraportal follicle-like structures. Sequence analyses of CDRH3 gene segments revealed a wide range of variations. Clones derived from the same founder were demonstrated simultaneously in the three compartments explored. The occurrence of B cell clonal expansions profoundly influenced the clinical expression of HCV infection, since it was associated with extrahepatic manifestations. In sharp contrast, no extrahepatic signs or disease occurred in patients without evidence of intrahepatic B cell clonalities. These findings emphasize the profound B cell function derangement in at least half of HCV-infected patients. Thus, the restriction of V gene usage has a direct impact on the clinical spectrum of HCV infection.

Abbreviations:
HCV:

Hepatitis C virus

MC:

Mixed cryoglobulinemia

IgH:

Immunoglobulin heavy chain

RF:

Rheumatoid factor

MGUS:

Monoclonal gammopathy of undetermined significance

1 Introduction

Hepatitis C virus (HCV) is characterized by a high tendency to become persistent and leads to chronic liver disease 1. Experimental infection of chimpanzees and analyses in polytransfused patients have demonstrated that HCV infection occurs even after development of what can be considered a protective immune response 2, 3. It is not clear, why this response fails to resolve the infection. Failure to generate an effective neutralizing response and the persistent production of non-neutralizing antibodies result in both lack of control of the virus spread and formation of the circulating immune complexes involved in many immunopathological aspects of this infection 4.

More than one-third of HCV-infected patients have circulating immune complexes with cryoprecipitating properties, and this characterizes the mixed cryoglobulinemia (MC) syndrome 5. MC is considered to be an immunoproliferative disorder with bone marrow multifocal lymphoid infiltrates of expanded B cell clonotypes 6. Bone marrow-derived B cells investigated at the DNA level proved to be oligoclonal despite the occurrence of a serum monoclonal component (usually IgMk) 7. On the other hand, the striking association between HCV infection and MC has suggested that the virus plays a primary pathogenetic role in the B cell clonal expansion 8. Molecular analyses of the immunoglobulin heavy chain (IgH) indicate that B cell clones show a significant sequence similarity with IgH sequences encoding for rheumatoid factors (RF). This supports the view that they produce autoantibodies which may be a significant factor in viral persistence 9.

Morphological pictures similar to those found in the bone marrow of patients with MC develop in the liver of chronic HCV carriers. Inflammatory lymphoid infiltrates mainly recruited at the portal areas frequently occur as round aggregates of small lymphoid cells 10. These follicle-like structures often appear as a well-formed germinal center, suggesting they are true functional follicular structures 11. Some studies have shown that they mainly consist of B cells, surrounded by a T cell zone 12.

Activation, differentiation and proliferation of B cells occur in the lymphoid follicles of secondary lymphoid organs such as regional lymph nodes, tonsils, spleen, and mucosal-associated lymphoid tissues 13, or in the so-called "ectopic" germinal centers found in non-lymphoid organs 14, 15. This is consistent with previous observations in the liver of patients with and without MC, whose portal tracts were isolated by microdissection. Results showed that IgH D genes were frequently mutated, as indicated by their degree of difference from the known germ-line segments 16.

In some patients, despite the use of different D and J segments, the resulting amino acid sequences matched, suggesting the presence in the liver of common selected antigen translation of CDRH3 sequences of lymphocyte clusters 16. Rearrangement usually occurred in the appropriate reading frame for the production of potentially functional proteins 17.

These data indicate that an in situ immune response is not polyclonal and is preferentially mounted against selected antigens. This may represent a key feature in the host-pathogen interaction, in that increased ability to bind selected antigens gives the B cell clone a growth advantage over those that cannot respond or respond less efficiently 18, with obvious pathobiological and clinical implications. Expanded clones may be the result of an irrelevant not-protective immune response which possibly interferes with neutralizing antibodies. In this view, persistence of HCV may occur by virtue of an immune interference strategy, as employed by other viruses that establish persistent infection 19.

To approach this issue, we employed the polymerase chain reaction (PCR) method for the rapid detection of IgH gene rearrangements in the liver-, bone marrow- and circulation-derived B cells of unselected chronic HCV carriers. Nucleotide sequencing of individual B cell clones was performed to define their potential significance in the explored biologic compartments and their impact on clinical features.

2 Results

2.1 B cell repertoire in different compartments

FRIII and JH oligonucleotides span the CDRH3 region of the IgH that is generated by the combinatorial assortment of many VDJ regions. The resulting CDRH3 segment, therefore, exhibits a unique sequence in each B cell clone. Single and distinct IgH PCR fragments will be generated only when monoclonal B cell clones represent a discrete subpopulation in any given sample.

As assessed by previous experiments, the detection limit of a discrete band ranges from 0.05% to 0.01% for dilutions containing DNA from nonlymphoid tissues. That limit decreased to 0.5–1% in dilutions containing DNA from lymphoid tissues. Thus, the efficiency of the PCR protocol appears to be lower when working with lymphoid organs. Multiple PCR fragments, each with unique and different length, can be obtained when multiple B cell populations coexist. A smear with no distinct dominant band is defined polyclonal, in that no VDJ gene restriction occurred (Fig. 1).

Results of IgH PCR fragments obtained from liver, bone marrow and peripheral blood of 30 unselected patients chronically infected with HCV are summarized in Table 1. Molecular analyses of expanding B cells were always performed before starting specific therapies.

Samples from 15 patients (50%) yielded smears with no distinct bands in the liver, bone marrow or peripheral blood, indicating that there were no clonally rearranged immunoglobulin genes in these compartments.

A number of accumulating B cell clonotypes derived from these compartments were defined in the other 15 patients (50%). In all of them B cell clonal expansions were demonstrated in the liver. Multiple distinct bands defining an oligoclonal picture were found in 11 patients (73%), whereas a single dominant band corresponding to a monoclonal B cell clonotype was noted in the other four (27%). In sharp contrast, features of B cell clonal expansions in bone marrow aspirates were demonstrated in only two patients, whereas in 13 a smear-like pattern reflecting a polyclonal feature was found. As compared with intrahepatic patterns, one patient showed a coincident monoclonal feature and identical electrophoretic mobility of the rearranged band, whereas a biclonal feature was found in the other.

With respect to circulating blood cells, distinct B cell clonal expansions were noted in eight patients. An oligoclonal feature was detected in two, and a single circulating clonotype in the other six patients. Since identical electrophoretic mobility was noted in the corresponding liver and/or bone marrow, it was postulated that they exhibited the same nucleotide sequence. We confirmed this by nucleotide sequences of the dominant bands. The deduced amino acid sequences of CDRH3 region in the three compartments for each patient are reported in Table 2.

The overall pattern indicates that the profiles of B cell repertoire of hepatic and extrahepatic sites were quite distinct, reflecting their unique composition. Some B cell subpopulations, however, were distributed between the liver, the bone marrow and the peripheral blood. Identical B cell clones were simultaneously found in the considered biological compartments in 8 (53.3%) of 15 patients with evidence of intrahepatic IgH VDJ gene rearrangements.

Comparison of the CDRH3 profiles between the liver, the bone marrow and the peripheral blood showed that in the majority of HCV chronic carriers the intrahepatic B cell repertoire was more restricted. Thus, the lymphocytes found in HCV-infected liver are a more homogeneous cell population with a narrowly focused repertoire, possibly reflecting the degree of clonal expansions occurred in response to an antigenic challenge. Nevertheless, in one patient (Table 2; patient 1) the number of oligoclonal expansions in the blood was greater than that in the liver. Whether these expansions are related to HCV or to other antigenic stimuli is still unclear.

Since the occurrence of identical B cell clones in different biological compartments might have resulted from contamination during DNA processing, samples were processed in duplicate and the utmost care was taken to prevent PCR contamination. A control with no added template was used to check for contamination. To overcome the risk of DNA carryover, samples referred to specimens of different compartments were evaluated by independent PCR reactions on different days. Each specimen was divided in two separate samples in the early stage of processing as an added precaution to provide back-up material, and each clone sequencing process was repeated and confirmed.

Subpopulations in the hepatic microenvironment might also reflect the presence of residual blood cells, which remain in the liver during biopsy or are tightly bound to the hepatic sinusoids because of the increased expression of adhesion molecules. This, however, seems unlikely since in no instance did sequencing data demonstrate hepatic oligoclonal peaks homologous to peripheral polyclonal background (Table 2; patients 3–5). Ten or more randomly selected clones derived from polyclonal DNA of peripheral blood were sequenced, and no CDRH3 sequences homologous to expanded B cell clones were detected in the corresponding liver. Thus, despite the lower number of lymphocytes present in the liver, it can be held that both pattern of B cells and CDRH3 profiling are a true reflection of B cell distribution in the organ, rather than the selective amplification by PCR of a distinct species of B cell receptor.

The use of VH family-specific primers for the VH genes in the FRI segment allowed to detect a prevalent family in the B cell populations in those patients with monoclonal/biclonal features of B cell expansion. Sequence data showed that the assigned germ-line counterpart was closely related to VH 1–69, VH 3–7, VH 3–21 and VH 6–1 family members (Table 2; patients 1, 6–11).

Concerning the gene segment usage, it was associated with 20 different DH segments in six families in the liver, with 12 DH segments in five families in peripheral blood and with three DH segments in three families in bone marrow. The most frequent DH family in the mutated clones was DH3 either in the liver (27.9%) or the peripheral blood (35.3%), whereas no distinct prevalence was observed in the bone marrow. D3–3*;01, D2–2*;01, D3–10*;01 and D3–22*;01 were the most frequently used D segments. A restricted use of JH segments was also noted, JH4 being the most represented either in the liver or in the peripheral blood (53.3% and 47%, respectively).

Figure 1.

Agarose gel electrophoresis of semi-nested PCR amplification products of IgH VDJ gene by Fr3 protocol. (A) Lane numbers 1 and 2 refer to DNA of negative controls obtained from a colon carcinoma cell line. Lanes 3-6 refer to DNA of peripheral B cells; Lanes 3 and 4 illustrate a polyclonal picture and 5 and 6 an oligoclonal rearrangement. (B) Intrahepatic B cell expansions. Lanes 1 and 2 refer to oligoclonal features, and lane 3 to a monoclonal pattern. Predicted size ranges of amplified fragments (bars) are indicated in base pairs. Higher molecular weight bands represent nonspecific amplification products. M: molecular marker (HaeIII-digested DNA of ϕX174).

Table 1. Agarose gel electrophoretic features of IgH VDJ PCR products in the liver, bone marrow and peripheral blood of 30 patients with chronic HCV infection
Sites of B cell derivationIgH VDJ gene rearrangements (%)
 PolyclonalOligoclonalMonoclonal
Liver (n=30)15 (50)11 (37)4 (13)
Bone marrow (n=30)28 (93.3)1 (3.3)1 (3.3)
Peripheral blood (n=30)22 (73.3)2 (6.6)6 (20)
Table 2. IgH VDJ gene segments and amino acid sequences of CDRH3 region in liver, bone marrow and peripheral blood-derived B cells from 15 patients with B cell clonal expansions
original image

2.2 In situ detection of B cell clonalities

The presence of a unique nucleotide sequence of CDRH3 in patients who developed intrahepatic monoclonal B cell expansion enabled us to construct appropriate oligonucleotide probes in order to characterize the morphological counterpart of B cell expansion in the liver tissue by in situ hybridization (ISH). This method differentiates individual VH genes and provides evidence of sites and connections with intrahepatic structures of B cell clonotype expansions. Positive results were obtained when clonospecific oligoprobes hybridized with the corresponding liver tissue containing unique mutations and identical CDRH3 rearrangements. Negative results were always found with unrelated probes.

These observations were critical for the specificity of the reactions, in that experimental parameters were empirically determined for each clonospecific probe by repeated ISH. Negative controls containing sense sequence of the probes and oligonucleotide complementary to 5′–UTR of rat β-actin were also included. Hybridization and post-hybridization stringencies were maximized, in that hybrids of probes and corresponding targets were very stable.

Though positive B cells occurred as individual elements within hepatic sinusoids, randomly distributed in the lobules, most lymphocytes clustered in dense aggregates in the portal tracts and in the originating fibrous septa, as depicted in Fig. 2.

Figure 2.

Identification of a distinct B cell clone in the liver biopsy by in situ hybridization using an oligonucleotide probe derived from IgH(N1)D(N2) gene segment sequence [5′-GAATATGGGACA(N1)GATACTAGTGGTTATTACTAC(D)GCC(N2)-3′] of patient 6. Two main pictures of hybridization signal were found in the corresponding liver biopsy tissue: (A) single round, small cells randomly scattered within intralobular sinusoids and (B) aggregates of lymphoid cells within expanded portal traits. (C) Higher magnification shows the distribution of clonal expanding B cells within a follicle-like structure in a portal tract. Specificity of the hybridization signal is demonstrated in (D): a negative reaction was achieved when digoxigenin-labeled probe was incubated with a 1,000-fold excess of unlabeled oligonucleotide.

2.3 Relationship between clinical features and restriction of B cell response

In this context, the main laboratory and clinical features of the chronic HCV carriers were related to the presence (group 1) or absence (group 2) of intrahepatic IgH VDJ gene rearrangements, as summarized in Table 3. Mean age, presumptive length of liver disease, mean serum transaminase activities and occurrence of histological evidence of liver cirrhosis were similar in both groups. In contrast, a virus-related parameter and sex prevalence were differently distributed. A higher occurrence of genotype 2 was noted in group 1. In addition, females prevailed in group 1, whereas males were more frequent in group 2.

A substantial feature of the presence of intrahepatic B cell clonal expansions was their impact on the clinical picture and their strict correlation with signs of immunoproliferative disorders, including cryoglobulinemia and monoclonal gammopathy of undetermined significance (MGUS). Cryoglobulins were found in 11 patients (73.3%) of group 1 and in none of group 2 (p<0.005).Types II and III mixed cryoglobulins were documented in six (54%) and three (27%) patients, respectively. Type I (IgGk) cryoglobulins were noted in the remaining two patients with MGUS (18%).

The analyses of RF serum levels and C4 fraction of complement indicated that mixed cryoglobulins were associated with higher titers of RF and low levels of C4, whereas neither elevation of RF nor decrement of C4 were demonstrated in type I cryoglobulins. This strongly suggests that different pathogenetic mechanisms are involved in the cold-precipitation of these types of cryoglobulins in HCV-infected patients. It is noteworthy that MC patients displayed concomitant active cutaneous vasculitis, peripheral neuritis and arthralgias.

Except for higher serum levels of RF, the remaining patients of group 1 did not differ from those of group 2 in terms of either laboratory parameters or clinical features.

Table 3. Clinical, virological and immunological parameters in patients with and without intrahepatic B cell clonal expansions
ParameterIntrahepatic IgH gene rearrangements
 With (n=15)Without (n=15)Statistics (p)
Age (years)56.9 ± 13.554 ± 11.1 
Sex (M/F ratio)0.71.50.05
HCV genotypes (%)
 16 (40)9 (60) 
 28 (53)6 (40) 
 31 (7)0 
Alt (IU/ml; ≤30)83.7 ± 60.389.2 ± 44.1 
Cirrhosis (%)2 (13)3 (20) 
Cyroglobulins (%)11 (73.3)00.0005
 I2 (18)  
 II6 (54)  
 III3 (28)  
MGUS IgGk (%)2 (18)(0) 
Rheumatoid factor acitvity (10 IU/ml)
 > 20 (%)13 (86.6)00.0005
 mean ± SD220.8 ± 252.16.3 ± 2.40.002
Complement fration 4 (mg/100ml)
 < 10 (%)9 (60)00.0002
 mean ± SD10.5 ± 7.620.3 ± 6.30.005
Cutaneous vasculitis (%)9 (60)00.0005
Peripheral neuritis (%)6 (40)00.002
Arthralgias (%)7 (47)1 (6.6)0.01

3 Discussion

A key consideration in this report is that antigen-activated B cells were shown to undergo massive clonal expansions in the liver of 50% of an unselected series of chronically HCV-infected patients. B lymphocytes derived from clonal expansion of the same founder were identified in the circulation and bone marrow of more than 50% and 10%, respectively.

Blood is considered as a homogeneous, mixed fluid with respect to an existing model of lymphocyte circulation 20, which can predict the proportion of lymphocytes in the different compartments. However, the disproportionate distribution of expanded B cell clones we found within the explored biologic compartments suggests that IgH VDJ mutational activity is differentially up-regulated.

The liver is obviously the main target of HCV infection and the site of inflammatory events, including inflammatory cell recruitment. Distribution of B cells and their productive Ig gene rearrangements can be influenced by a variety of selective events during development and antigenic stimulation. The over-representation of B cell clonal expansions in the liver strongly emphasizes that putative microenvironment factors play a major role for their emergence and persistence. Underlying mechanisms involved in somatic hypermutations and secondary rearrangements contribute to the generation of a highly diversified array of IgV gene products 21.

The basic processes of IgV gene recombination were mostly thought to take place in the bone marrow 22. However, more recent studies provide evidence that immature B cells outside the bone marrow retain recombination gene activating activity leading to replacement of their receptor 23. This process usually occurs in the secondary lymphoid organs 24.

Here, we have reported the successful detection of specific B cell clonotypes in liver biopsies by ISH. Hybridization signals morphologically depicted distinct clusters of lymphoid infiltrates, mainly located in the portal tracts and in the expanding fibrous bridgings. Follicle-like structures, often with germinal centers, are characteristic of HCV infection. It appears that they are functional "ectopic" lymphoid follicles 12. Although the exact phenotype of these cells has not been defined, we have demonstrated that intrahepatic expanded B cell clonotypes contribute to the formation of intraportal lymphoid nodules.

The highly diverse CDRH3 sequences of B cell clonalities suggest they are the result of an antigen-driven response. Thus, though antigen selection events occur in the liver, identity of the antigen is unknown. It can be speculated that both selection and expansion of intrahepatic B cells are the result of an increased affinity process following VDJ rearrangements with functionalsubstitutions in the CDRH3 region 25.

More than 80% of patients who developed intrahepatic B cell clonotype expansions had higher serum levels of RF and almost 70% displayed MC. It was concluded that RF-B cells are largely involved in this lymphoproliferative process.

Though we have no direct evidence for an antigen-binding effect, recent data indicate that potentially pathogenetic autoantibodies may arise via somatic hypermutation during immune response toforeign antigens from antibodies that have no reactivity to such antigens in their germ-line configuration 26. This notion provides a potential explanation for our findings, in that peptide mass fingerprinting characterization of the variable combinatory region of cryoprecipitable IgM RF molecules from patients with type II MC demonstrated an amino acid sequence identical to the corresponding region of the Ig receptor of the underlying B cell clonal expansion. The same cryoprecipitating IgM molecule showed anti-NS3-encoded protein reactivity, suggesting a direct causal involvement of HCV in sustaining lymphoproliferation (manuscript in preparation).

A more complex role is suspected for NS3-encoded protein in the pathogenesis of HCV-induced damage since immunoinhibitory effects via interleukin-10 induction have also been suggested 27.

The mechanism of B cell stimulation is not known, but it could involve cellular activation through T cell help with provision of a Th2 cytokine pattern. It is notable that, except for sex distribution, no significant differences of major clinical parameters were found between patients with polyclonal features and those with oligo/monoclonal B cell expansions. We found prevalence of malesin the former and females in the latter, suggesting that the hormone pattern may modify characteristics of B cell immune response. The high prevalence of females in MC is a long-lasting observation28. It has been known that estradiol contributes to a T cell cytokine bias 29, whereas testosterone administration converts a Th2 to a Th1 response 30. It has also been shown that Th2 cytokines provide effective help for B cell activation and Ig synthesis, and may also favor cryoglobulin production 31.

In conclusion, data presented here as well as our previous work 16, 32 demonstrate a remarkable restriction of CDRH3 diversity in the liver of a large proportion of HCV-infected patients. Since CDRH3 plays a dominant role in antigen binding, its restriction would normally be interpreted as antigen-driven clonal expansion. By focusing on the relationships between liver, peripheral blood and bone marrow, our results strongly suggest that B cell clones start expanding presumably in the liver and then can circulate and reach other compartments.

It is not clear, at present, whether B cell expansion of a particular specificity occurs as a result of preferred V(D)J rearrangement or is the result of selection. It has been demonstrated that clonal selection exerts a continuous influence on B cells even before they acquire the capacity of somatic hypermutation until reaching terminal differentiation as plasma cells 33. Our observation that mutated clones contribute to define intrahepatic portal lymphoid nodules suggests that B cell maturation from a relatively early stage occurs in the liver of HCV-infected patients. This raises the possibility that B cells proliferate and undergo active somatic hypermutation outside the germinal centers. A similar mechanism seems to be operative in mice, in which red pulp T cells in the spleen represent an important site for active hypermutation, loss of B cell tolerance and autoantibody production 25.

Although the occurrence of intrahepatic B cell expansions has been reported to be independent of the presence of B cell-producing cryoglobulins 34, here, we demonstrate thatrestriction of intrahepatic B cell repertoire has a direct influence on the clinical features. It associates with higher serum levels of RF activity, occurrence of cryoglobulins and presence of MGUS, namely the most frequent extrahepatic manifestations of chronic HCV infection which would possibly require additional therapeutic approaches. Use of rituximab, for example, an anti-CD20 monoclonal antibody, has recently proved effective in modifying the dynamics of B cells, in that it can delete expanded B cell clones in MC 35, thus, providing protection against factors potentially involved in the pathogenesis of B cell malignant transformation 36.

4 Materials and methods

4.1 Patients

Thirty consecutive patients (male: 13; female: 17), aged 38–75 years (mean 56.5) attending the "Liver Diseases Unit of the Department of Internal Medicine and Clinical Oncology of the University of Bari" were considered. All had clinical and serological evidence of chronic liver disease. Sera obtained at diagnosis were all positive for anti-HCV antibodies by ELISA (HCV 3.0, Ortho Clinical Systems, Raritan, NJ, USA) and by recombinant-based immunoblot assay (RIBA, Ortho Clinical Systems), as well as for HCV RNA (Amplicor HCV, Roche Diagnostic Systems, Branchburg, NY, USA). All patients were HIV seronegative. One had a history of i.v. drug abuse. Six had been transfused 14–20 years before enrollment, whereas the source of HCV infection was unknown in the other 23. All were negative for HBsAg and for antinuclear and anti-smooth muscle auto-antibodies. None had received corticosteroid, immunosuppressive or interferon therapy. The study was approved by the "Institutional Ethical Committee", and written informed consent was obtained from all patients.

Baseline evaluation included disease history, current signs and symptoms and previous medications. Physical examination and laboratory values were recorded. Liver biopsy was performed. Serum cryoglobulins were determined as described elsewhere 37, and the monoclonal component in the serum or in the cryoprecipitate was characterized by immunofixation (Paragon, Beckman, Fullerton, CA, USA).

4.2 IgH VDJ gene amplification

Genomic DNA was purified from frozen liver tissue, bone marrow and circulating lymphocytes by phenol-chloroform extraction. Samples from heparinized blood and bone marrow aspirates were immediately used for mononuclear cell isolation by gradient centrifugation. Recovered mononuclear cells (2×106 cells) and liver tissue samples (∼3 mg) were processed for DNA preparation, as previously described 32. Samples were digested overnight in a lysis buffer containing 50 μg/ml proteinase K, 1% SDS, 20 mM Tris-HCl (pH 8.0) and 5 mM EDTA (pH 8.0). DNA was extracted with phenol/chloroform in the presence of 300 mM sodium acetate (pH 5.2), followed by precipitation with isopropanol and yeast tRNA (10 mg/ml).

B cells, a reactive lymph node and a colon carcinoma were investigated. Amplification of the IgH gene was carried out in duplicate with the Fr3 protocol 38. Briefly, 1 μg DNA of each sample was processed in the PCR analysis. Consensus primers for V and J regions included: (a) an upstream primer complementary to the third framework V region: 5′-ACACGGC[C/T][G/C]TGTATTACTGT-3′; (b) a downstream primer directed to a conserved sequence of the J region: 5′-TGAGGAGACGGTGACC-3′, and in the second round amplification to an inner conserved sequence of the same J region: 5′-GTGACCAGGGTNCCTTGGCCCCAG-3′. The reaction mixture (50 μl final volume) contained 200 μM each dNTP, 50 pmol primers, 1.5 mM MgCl2, 1× Taq buffer (Promega, Madison, WI, USA) and 2.5 units Taq polymerase (Promega). DNA was amplified for 30 cycles in the first round and 20 cycles in the second. Each cycle consisted of 94°C for 45 s, 50°C for 45 s, and 72°C for 30 s, followed by an additional extension interval at 5 min at 72°C.

Twenty microliter of reaction mixture were analyzed by electrophoresis in 5% agarose gel in TBE buffer, stained with ethidium bromide and optically evaluated by UV transillumination. Control mixtures in the reaction were without DNA or included DNA from clonal cell line. A monoclonal B cell expansion was defined as one or two (if both alleles were rearranged) discrete narrow band(s) within the predicted size. Distinction of biclonal monoallelic rearrangements from monoclonal biallelic rearrangements was based on the results of the sequence analyses, in that a non-functional rearrangement of one of two alleles was detected in the case of monoclonal disorders, whereas both dominant bands were representative of a functional IgH rearrangement in biclonal disorders.

Amplification of IgH V gene segments was carried out in duplicate with the Fr1 protocol, as described elsewhere 17. Single bands derived from CDRH3 amplification ofDNA were excised and sequenced. A clonospecific antisense oligoprimer was then synthesized, based on the CDRH3 DNA sequence and used as downstream primer paired with each VH family-specific framework 1 primer, as previously reported 39:

5′-CCTCAGTGAAGT[C/T]TCCTGCAAGGC-3′ (VH1); 5′-GTCCTGCGCTGGTGAAA[G/C]CCACACA-3′ (VH2); 5′-GGGGTCCCTGAGACTCTCCTGTGCAG-3′ (VH3); 5′-GACCCTGTCCCTCACCTGC[A/G]CTGTC-3′ (VH4); 5′-AAAAAGCCCGGGGAGTCTCTGA[A/G]GA-3′ (VH5); 5′-ACCTGTGCCATCTCCGGGGACAGTG-3′ (VH6).

Fidelity of the system was checked by reamplification, recloning and sequencing of independent subclones in both directions. Identification of VH germ-line sequences was performed bysequence comparison with the ‘International Immunogenetics Database program’ (http//imgt.cnusc.fr:8104/dnaplot/).

4.3 Sequence analyses

Individual bands on the entire smear within the PCR range were cut from the agarose gel, cloned and sequenced. Purified DNA was ligated into a pGem-T cloning vector (Promega), and transfected into E. coli DH5α-competent cells. Transfected cells were plated onto LB-ampicillin agar plates containing 5-bromo-4-chloro-3-indolyl-β-D-galactoside and isopropyl-thiogalactose. Uncolored colonies were selected at random and cultured. Plasmid DNA was purified with the ‘Wizard Plus Minipreps DNA purification system’ (Promega).

Sequence reactions were carried out on an ABI Prism 310 Genetic Analyzer (Perkin-Elmer, Faster City, CA, USA). All sequences were confirmed in both directions with primers T7 and SP6. At least10 different clones were sequenced for each dominant band.

4.4 In situ hybridization

Clonospecific oligoprobes based on CDRH3 DNA sequences from patients with intrahepatic monoclonal B cell expansion (Table 2; Patients 6, 10, 11, 14) were used todetect predominant B cell clones in liver tissue by in situ hybridization (ISH), as described elsewhere 40. Briefly, after extensive washings in cold phosphate-buffered saline (PBS) containing 0.02% diethylpyrocarbonate (DEPC, Sigma Chemical Company, St. Louis, MO, USA), cryostat liver sections were fixed in 4% paraformaldehyde (PFA) in PBS for 10 min. They were then rinsed in PBS for 5 min and digested with 12.5 μg/ml proteinase K (Roche) for 5 min. The slides were rinsed again in PBS and refixed in 4% PFA for 10 min, dipped in DEPC-treated water, and acetylated in 0.01% acetylanhydride in 0.1 M triethanolamine for 10 min. After washings in PBS and 0.85% saline for 5 min each and holding at 95°C for 15 min to denature nucleic acids and abolish endogenous alkaline phosphatase activity, the sections were refixed in 4% PFA, rinsed in PBS, dehydrated through a series of ethanol baths (40–100%) and finally allowed to dry for at least 1 h.

Dehydrated sections were prehybridized for 1 h with a mixture containing 50% deionized formamide, 1× Denhardt's solution, 1 mM ethylenediamine tetracetic acid, 100 μg/ml denatured salmon sperm DNA, 100 μg/ml yeast RNA, 250 μg polyadenylic acid, and 4× standard saline citrate (SSC). Hybridization was carried out for 24 h at 40°C in the same mixture containing digoxigenin-labeled probe at a final concentration of 100 ng/ml, which was boiled for 5 min and quenched on ice. Freshly prepared dithiothreitol was added to a final concentration of 10 mM. Sections were overlaid with 20 μl hybridization mixture and placed in a moist chamber. After incubation, the slides were washed for 1 h in 2×SSC, then for 1 h in 1×SSC, 10 min at a melting temperature of 5°C in 0.5×SSC and finally 1 h in 0.1×SSC.

After a brief wash in PBS, sections were incubated with the Fab fragments of sheep anti-digoxigenin antibody conjugated with calf intestinal alkaline phosphatase (Roche) for 4 h. Unbound antibody was washed off by immersing the slides in 0.1 M Tris-HCl buffer (pH 7.4) containing 0.15 M NaCl, followed by 0.1 M Tris-HCl pH 9.5 containing 0.1 M NaCl and 0.05 M MgCl2. To develop thecolor reaction, 4-chloro-2-methylbenzenediazonium/3-hydroxy-2-naphthoic-acid-2,4-dimethyl-anilide phosphate substrate was added.

In the control experiments, before hybridization, sections were treated with deoxyribonuclease (10 mg/ml). In competition experiments, unlabeled probes in 500–1,000-fold excess were added to the hybridization mixture. Sense oligonucleotide DNA and an oligonucleotide complementary to 5′-UTR of rat β-actin (5′-TTGCTCCAACCAACTGCGGTCGCCTTCACCGTTCCAGTTTTTAAATCCTTGA-3′) were used as irrelevant probes in specificity experiments.

4.5 Probe preparation

Synthetic oligonucleotides complementary to CDRH3 region of patients 6, 10, 11, and 14 (Table 2) were purified by high-performance liquid chromatography, checkedby polyacrylamide gel electrophoresis and labeled at the 3′-end with digoxigenin-11-deoxyuridine triphosphate (dUTP) (Roche).

Acknowledgements

This study was supported in part by "Associazione Italiana per la Ricerca sul Cancro" (AIRC, Milan, Italy) and by a grant from the Italian Ministry of University and Scientific and Technological Research, National Project "Chronic liver damage induced by hepatitis C virus". F.A.T. is recipient of a fellowship granted by "Fondazione Italiana per la Ricerca sul Cancro" (FIRC).

Footnotes

  1. 1

    WILEY-VCH

  2. 2

    WILEY-VCH

Ancillary