Commensal Gram-negative bacteria prime human dendritic cells for enhanced IL-23 and IL-27 expression and enhanced Th1 development

Authors

  • Hermelijn H. Smits,

    1. Academic Medical Center, Department of Cell Biology and Histology, University of Amsterdam, Amsterdam, The Netherlands
    Search for more papers by this author
  • Astrid J. van Beelen,

    1. Academic Medical Center, Department of Cell Biology and Histology, University of Amsterdam, Amsterdam, The Netherlands
    Search for more papers by this author
  • Christina Hessle,

    1. University of Göteborg, Department of Clinical Bacteriology, Göteborg, Sweden
    Search for more papers by this author
  • Robert Westland,

    1. Academic Medical Center, Department of Cell Biology and Histology, University of Amsterdam, Amsterdam, The Netherlands
    Search for more papers by this author
  • Esther de Jong,

    1. Academic Medical Center, Department of Cell Biology and Histology, University of Amsterdam, Amsterdam, The Netherlands
    Search for more papers by this author
  • Eelco Soeteman,

    1. Academic Medical Center, Department of Cell Biology and Histology, University of Amsterdam, Amsterdam, The Netherlands
    Search for more papers by this author
  • Agnes Wold,

    1. University of Göteborg, Department of Clinical Bacteriology, Göteborg, Sweden
    Search for more papers by this author
  • Eddy A. Wierenga,

    1. Academic Medical Center, Department of Cell Biology and Histology, University of Amsterdam, Amsterdam, The Netherlands
    Search for more papers by this author
  • Martien L. Kapsenberg

    Corresponding author
    1. Academic Medical Center, Department of Cell Biology and Histology, University of Amsterdam, Amsterdam, The Netherlands
    2. Academic Medical Center, Department of Dermatology, University of Amsterdam, Amsterdam, The Netherlands
    • Academic Medical Center, Department of Cell Biology and Histology, University of Amsterdam, P.O. Box 22700, 1100 DE Amsterdam, The Netherlands Fax: +31-20-6974156
    Search for more papers by this author

Abstract

Dendritic cells (DC) are the main orchestrators of specific immune responses. Depending on microbial information they encounter in peripheral tissues, they promote the development of Th1, Th2 or unpolarized Th cell responses. In this study we have investigated the immunomodulatory effect of non-pathogenic intestinal Gram-negative (Escherichia coli, Bacteroides vulgatus,Veillonella parvula, Pseudomonas aeruginosa) and Gram-positive (Bifidobacterium adolescentis, Enteroccocus faecalis, Lactobacillus plantarum and Staphylococcus aureus) bacteria on human monocyte-derived DC (moDC). None of the Gram-positive bacteria (GpB) primed for Th1 or Th2 development. In contrast, despite the low levels of IL-12 they induce, all Gram-negative bacteria (GnB) primed moDC for enhanced Th1 cell development, which was dependent on IL-12 and an additional unidentified cofactor. Strikingly, GnB-matured moDC expressed elevated levels of p19 and p28 mRNA, the critical subunits of IL-23 and IL-27, respectively, suggesting that the IL-12 family members may jointly be responsible for their Th1-driving capacity. Purified majorcell wall components of either GnB or GpB did not yield Th cell profiles identical to those obtained with whole bacteria, and could not explain the induction of the IL-12 family members nor Th1 priming by GnB. Importantly, this study gives indications that the expression of the different IL-12 family members is dictated by different priming conditions of immature DC.

Abbreviations:
moDC:

Monocyte-derived dendritic cells

iDC:

Immature DC

mDC:

Mature DC

PGN:

peptidoglycan

LTA:

Lipoteichoic acid

GnB:

Gram-negative bacteria

GpB:

Gram-positive bacteria

MF:

Maturation factors

1 Introduction

The gastrointestinal tract is colonized by a large variety of different commensal bacteria. The intestinal microflora is the chief stimulus for the mucosal and systemic immune system 13, that is under homeostatic conditions in symbiosis with the host and supplies a role in host nutrition, intestinal permeability and protection against invasive and resident pathogens 4, 5.

Specific immune responses at mucosal sites are initiated by resident immature myeloid DC, that are specialized in antigen capture and processing. Upon exposure to microbial and/or inflammatoryproducts, DC increase their expression of MHC-II and costimulatory molecules and migrate to the draining lymph nodes where they start adaptive immune responses by presenting processed antigen to naive Th cells 6. In addition, mature DC also determine the class of immune response by instructing naive Th cells to develop into either effector Th1 -, Th2 cells or a mixed phenotype by the selective expression of polarizing molecules 7. DC-derived molecules that drive the development of Th1 cells include IL-12, IL-18, IFN-α and ICAM-1 6, 7. Furthermore, the novel IL-12 family members IL-23, a heterodimer consisting of the p19 and p40 subunit, or IL-27, composed of the subunits p28 and EBI3, can be important players in this respect as well 8. IL-23 functions primarily on effector T cells, prolonging and sustaining their IFN-γ production, whereas IL-27 has a profound effect on especially naive Th cells and is of crucial importance for the initial and early IFN-γ  production, either alone or in synergy with IL-12 9, 10.

The Th cell polarizing capacity of mature DC is strongly dictated by the type of pathogen or reactivity product in infected tissues, that prime DC at their immature sentinel stage. Ideally, DC with the ability to promote Th1 responses will develop after exposure of immature DC to (compounds of) intracellular pathogens, like mycobacteria or viruses (reviewed in 11, 12). Likewise, tissue factors 13, innocuous fed antigens 14, enteric pathogens 1517 or non-pathogenic microflora bacteria may influence the Th cell polarizing capacity of gut-resident DC and thereby contribute to the class of gut-associated and systemic effector Th cell responses. Previous studies investigating the immunomodulatory capacities of intestinal microflora bacteria in human PBMC 18, human monocytes 19, mouse bone marrow-derived DC 20 or in vivo mouse models 21, 22 have demonstrated differences in either APC or T cell cytokine secretion patterns, supporting the concept that microflora bacteria can affect DC by influencing their expression levels of Th cell polarizing signals. Therefore, the aim of the present study was to investigate the modulation of Th cell instructive signals of human DC by randomly selected commensal GnB and GpB.

The results of the present study suggest that non-pathogenic intestinal GnB induce the expression of Th1-polarizing signals in human moDC. In contrast, GpB did prime for neither Th1 nor Th2 development. Th1 development induced by GnB-primed moDC is likely to be mediated by the joint action of different IL-12 family members.

2 Results

2.1 Intestinal GnB but not GpB prime moDC for a high Th1 polarizing capacity

To investigate whether intestinal commensal bacteria can modulate the Th cell polarizing capacity of human DC, immature moDC were cultured with a panel of intestinal GnB (E. coli, B. vulgatus, V. parvula and P. aeruginosa) or GpB (B. adolescentis, E. faecalis, L. plantarum and S. aureus) in the presence of the maturation factors (MF) IL-1β and TNF-α to induce equal maturation in both groups, as GpB did not induce full maturation independently, in contrast to GnB (data not shown). The primed mature DC were used to stimulate naive Th cells with SEB (100 pg/ml), which were restimulated after 10 days to evaluate their acquired cytokine profile. Fig. 1A demonstrates that all GnB primed moDC for an enhanced Th1 cell development, although not as strongly as priming with high level rIFN-γ. In contrast, GpB did not prime for an enhanced Th1 – or Th2 cell polarizing capacity in moDC. Fig. 1B indicates that the dosage of 107 GnB (approximately 1:100 ratio) was optimal to prime for a strong Th1 polarizing capacity in moDC, whereas 106 bacteria (ratio 1:10) gave a partial effect and 105 bacteria (ratio 1:1) was clearly insufficient. With respect to optimal cytokine induction a similar dose-dependent effect was found for both GnB and GpB in a previous study with peripheral monocytes 19.

Figure 1.

 Intestinal GnB but not GpB prime moDC for a high Th1 polarizing capacity. Immature DC were generated as described elsewhere 24. (A) Maturation was induced by addition of MF (rIL-1β (25 ng/ml) and rTNF-α (50 ng/ml)), MF plus rIFN-γ (1000 U/ml) or MF plus 1×107 UV-killed bacteria. After 48 h, mature moDC were harvested, washed and cocultured (5×103 cells/well) with naive Th cells (2×104 cells/well) and superantigen SEB (100 pg/ml). After 12 days, IFN-γ and IL-4 productions per cell were analyzed by intracellular FACS-staining following a 6 h PMA/ionomycin stimulation, the last 5 h in the presence of Brefeldin A. (B) Maturation was induced by an increasing dose of GnB (105–106–107, which equals a ratio of 1:1, 1:10 and 1:100). After 48 h, the mature moDC were treated as described in legend (A).

2.2 Th1 polarization by GnB-primed moDC is blocked by neutralizing anti-IL-12, although IL-12p70 production is not increased

To explore the role of IL-12 in the Th1-driving effect of GnB-primed moDC, blocking Ab to IL-12 were added to the coculture of naive Th cells and mature moDC. The Th1 polarization driven by GnB-primed moDC was completely blocked by neutralizing anti-IL-12, whereas the Th cell cytokine profile obtained with moDC matured in the presence of GpB was hardly affected (Fig. 2A). However, IL-12p70 production was not increased, in GnB-nor in GpB-matured moDC, in comparison to the control maturation condition with MF only (Fig. 2B). Surprisingly, GnB-matured moDC expressed elevated levels of IL-10 (Fig. 2C) instead. IL-10 neutralization experiments, however, showed that this IL-10 production did not affect their Th cell polarizing potential (Fig. 2D).

Figure 2.

Th1 polarization by GnB-primed moDC is blocked by neutralizing anti-IL-12, although IL-12p70 production is not increased. Generation of immature moDC and maturation conditions are described in the legend to Fig. 1. (A) and (D) Naive Th cells (2×104 cells/well) were stimulated with differentially matured DC (5×105 cells/well) and superantigen SEB (100 pg/ml) in the absence or presence of neutralizing anti-IL-12 (10 μg/ml; A) or neutralizing anti-IL-10 (1 μg/ml; D). After 12 days, IFN-γ and IL-4 production per cell were determined by intracellular FACS analysis as described in the legend to Fig. 1. (B) and (C) Mature DC (2×104 cells/well) were stimulated with mouse CD40L-expressing mouse plasmacytoid cells (J558 cells, 2×104 cells/well) to induce the production of IL-12 and IL-10. After 24 h, supernatants were collected and IL-12p70 (B) and IL-10 (C) production was measured by ELISA.

2.3 Th1 polarization by GnB-primed moDC is driven by IL-12 in synergy with an additional cofactor, which is not IL-18, type I IFN or ICAM-1

Since Th1 polarization by GnB-primed moDC was completely neutralized by polyclonal antibodies to IL-12 despite the fact that these cells produced only limited amounts of IL-12p70, it was hypothesized that apart from IL-12, an additional cofactor should play a key role in driving Th1 polarization. Likely candidates in this respect are the cytokines IL-18, IFN-α, IL-23, IL-27 or the membrane-bound molecule ICAM-1. To test this, blocking studies were performed by adding IL-18BP or anti-type I IFN Ab, with or without anti-IL-12 Ab, during the coculture of bacteria-primed moDC and naive Th cells. In all conditions only neutralizing polyclonal IL-12 Ab were successful in blocking Th1 cell development, suggesting that the cytokines IL-18 (Fig. 3A) or type I IFN (Fig. 3B) were not acting as Th1-driving cofactors with IL-12 under these conditions. This conclusion is further supported by the finding that neither IL-18 nor IFN-α was produced by bacteria-primed DC, as they could not be detected by ELISA (data not shown). A role for ICAM-1 or other costimulatory molecules, like CD80 or CD86, as cofactors for IL-12-induced Th1 polarization appeared not to be very likely, as no differences in their expression patterns were found on GnB-or GpB-primed moDC (Fig. 3C). Also CD83 expression was equal in all conditions, giving no indications for differences in Th cell response outcome (Fig. 3C).

Figure 3.

Th1 polarization by GnB-primed moDC is driven by IL-12 in synergy with an unidentified cofactor, which is not IL-18, type I IFN or ICAM-1. Generation of immature moDC and maturation conditions are described in the legend to Fig. 1. (A) and (B) Naive Th cells (2×104 cells/well) were stimulated with differentially matured DC (5×105 cells/well) and superantigen SEB (100 pg/ml) in the absence or presence of IL-18BP (A) or anti-type I IFN Ab (B), with or without anti-IL-12 Ab. After 12 days, IFN-γ and IL-4 productions per cell were determined by intracellular FACS analysis as described in the legend to Fig. 1. (C) CD14, CD80, CD83, CD86 and ICAM-1 (CD54) expression on mature bacteria-treated DC was analyzed by flow cytometry.

2.4 GnB-primed moDC express elevated levels of IL-23 and IL-27 mRNA

The novel IL-12 family member IL-23, composed of p19 and p40 subunits, can elevate IFN-γ in Th cells and is also blocked by polyclonal antibodies to IL-12 (because of sharing the p40 subunit with IL-12). The Th1 polarizing capacity of GnB-primed moDC, therefore, may be explained by the additional production of IL-23 as well. In addition, the other novel IL-12 family member IL-27, composed of p28 and EBI3 subunits, may synergize with IL-12 in this Th1 bias. The p19 and p28 subunits are the limiting factors in the p19-p40 heterodimer of IL-23 and the p28-EBI3 heterodimer of IL-27, respectively, like for the p35 subunit in the IL-12 molecule. The expression of p19, p28, p40 and EBI3 subunits was analyzed by real-time reverse transcription (RT)-PCR in either CD40L-stimulated moDC (p28 and EBI3) or in CD40L plus IFN-γ-stimulated moDC (p19 and p40), since p19 mRNA expression was only marginal in CD40L-stimulated moDC. Strikingly, p19 and, in particular, p28 were significantly elevated in GnB-treated moDC (Fig. 4A). Furthermore, in contrast to p28 mRNA, which was expressed at levels similar to the levels of control MF-treated moDC, the levels p19 mRNA were slightly elevated in the GpB-primed moDC. The levels of p19 and p28 in the GnB-primed moDC were as high as in IFN-γ-primed moDC. EBI3 and p40 expression were the same in all conditions (Fig. 4B). The elevated expression levels of IL-23 and IL-27 may suggest that these cytokines may act as a cofactor, together with IL-12, in the induction of Th1 responses by GnB-primed moDC.

Figure 4.

 GnB-primed DC express elevated levels of p19 and p28, the limiting subunits of IL-23 and IL-27, respectively. Generation of immature moDC and maturation conditions are described in the legend to Fig. 1. Mature DC (5×104 cells/well) were stimulated with mouse CD40L-expressing mouse plasmacytoid cells (J558 cells, 5×104 cells/well) in the absence (p28 and EBI3 analyses) or presence of rIFN-γ (1000 U/ml; p19 and p40 analyses). After 6 h, the cells were lysed, and cDNA was synthesized. The relative number of p19, p28 (A), p40 or EBI3 (B) transcripts was determined by real-time quantitative RT-PCR, using a bulk cDNA of CD40L-stimulated moDC as a standard and normalization to β2 m was performed for each sample. The data presented here are the mean ± SEM of four independent experiments. Statistical analysis was performed by a Student's t-test. * p<0.05.

2.5 Modulation of human DC function by purified cell wall components of GnB or GpB

In an attempt to identify the bacterial components that prime moDC for the Th1 polarizing capacity, the role of some obvious candidate compounds was tested by adding them to cultures of maturing moDC, and evaluating the impact on DC cytokine production and Th cell polarization. These include lipopolysaccharide (LPS), a component of the outer cell wall of GnB, peptidoglycan (PGN), a component of the cell wall of all bacteria, but in particular of GpB, and lipoteichoic acid (LTA), present only in GpB. Fig. 5A demonstrates that neither LPS nor LTA influenced the Th cell polarizing capacity of moDC when present during maturation, while PGN primed for Th1 cell development. This Th1-driving effect was IL-12 dependent, as shown by the parallel IL-12-blocking studies. However, PGN did not prime for high IL-12 production in mature moDC (Fig. 5B), but instead, primed for high IL-10 production, in a similar fashion as priming with whole GnB (Fig. 5C). Interestingly, p19 mRNA, but not p28 mRNA, was strongly elevated in PGN-primed DC, which is in line with previous reports 23 (Fig. 5D). Again, EBI3 and p40 mRNA was expressed to a similar extent in all groups (Fig. 5E). Furthermore, when moDC were matured in the presence of PGN plus LTA, like in whole GpB, the Th1-polarizing effect of PGN was dominant (Fig. 5A). Together, these data show that the priming action of whole bacteria cannot easily be attributed to a single cell wall component since the effect of the purified compounds tested here was not in line with the priming effects of whole bacteria and cannot explain either the induction of IL-27 nor the priming for Th1 development.

Figure 5.

Modulation of human DC function by purified cell wall components of GnB or GpB. Immature DC were generated as described elsewhere 24. Maturation was induced by addition of LPS (10 μg/ml), PGN (10 μg/ml), LTA (10 μg/ml) or PGN plus LTA. (A) After 48 h mature moDC were harvested, washed and cocultured (5×103 cells/well) with naive Th cells (2×104 cells/well) and superantigen SEB (100 ng/ml) in the absence or presence of neutralizing anti-IL-12. After 12 days, IFN-γ and IL-4 production per cell were determined by intracellular FACS analysis as described in the legend to Fig. 1. Mature DC (2×104 cells/well) were stimulated with mouse CD40L-expressing mouse plasmacytoid cells (J558 cells, 2×104 cells/well) in the presence or absence of rIFN-γ (1000 U/ml) to induce the production of IL-12p70 (B) and IL-10 (C). After 24 h, supernatants were collected and IL-12p70 and IL-10 production were measured by ELISA. (D) Mature DC were stimulated as described in the legend to Fig. 4. After 6 h, the cells were lysed, and cDNA was synthesized. The relative number of p19, p28 (A), p40 or EBI3 (B) transcripts was determined by real-time quantitative RT-PCR as described in the legend to Fig. 4. The data presented here are the mean ± SEM of four independent experiments. Statistical analysis was performed by a Student's t-test. *p<0.05 and **p<0.01.

3 Discussion

In the present study we demonstrate that GnB, but not GpB, prime human moDC for enhanced capacity to drive Th1 responses, which is in part dependent on IL-12, but also involves an additional cofactor for which IL-27 and/ or IL-23 are likely candidates as mRNA of the p19 subunit of IL-23 and the p28 subunit of IL-27 is enhanced in GnB-primed moDC. The type 1 priming capacity of GnB is not easily attributed to a single component of their cell wall, as purified major cell wall compounds of either GnB or GpB did not yield Th cell profiles identical to those obtained with whole bacteria. These data suggest that commensal Gram-negative microflora bacteria can have immunomodulatory functions, in which the novel IL-12 family members IL-23 and/or IL-27 may play a crucial role.

The induction of IFN-γ in response to GnB 24 has recently also been described for murine splenocyte cultures and bone marrow-derived DC (BM-DC). However, with respect to the GnB, this was accomplished via an IL-12-independent pathway and mainly via the cytokines IL-18 and type I IFN, whereas it remained unclear which cell types did produce these factors. This finding is in contrast with the results from the present study with human cells, showing that the induction of IFN-γ was dependent on IL-12 and another factor, probably IL-27 and/or IL-23, but clearly not IFN-α or IL-18. However, we cannot exclude the possibility that these cytokines, perhaps produced by other cell types, may contribute to elevate IFN-γ production by Th cells during inflammatory responses evoked by GnB in vivo.

Our data demonstrate that the up-regulation of p19 and p28 mRNA expression in the GnB-primed DC was comparable to those in IFN-γ-primed moDC. This is in line with previous reports demonstrating that IFN-γ is a major enhancing signal of all IL-12 family members, which includes IL-12 25, IL-23 9, 26 and IL-27 10. The role of IL-12 in the protection against intracellular protozoan, fungal, bacterial and viral infections may not be as crucial as originally thought. Interestingly, patients with mutations in the IL-12p40 or the IL-12Rβ1 gene have a relatively mild phenotype and only some may develop chronic courses of salmonellosis or mycobacteriosis, suggesting that other Th1-polarizing cytokines are effective as well in clearing of infections, in particular other than salmonellosis and mycobacteriosis 27, 28. Indeed, mice lacking IL-12 still develop polarized Th1 responses to some viral or mycobacterial infections 29, 30, provided p40 subunits are present 31, 32, which thus suggests a role for other p40-related and p40-dependent proteins, such as IL-23. An additional role for IL-27 in mycobacteriosis follows from experiments with mice deficient in WSX-1, one of the receptor chains of IL-27R. These mice show impaired early IFN-γ production and poorly differentiated granulomas when treated with BCG 33. These studies all suggest that the separate IL-12 family members have overlapping in the clearing of particular infections, albeit IL-12 and IL-27 act at early and IL-23 may act at later stages of T cell differentiation. However,it cannot be ruled out that they have unique functions as well, in particular in innate immunity.

Our data do not favor a critical role for LPS, the major cell wall component of GnB, in the DC-mediated Th1 development primed by these bacteria. In the tested conditions, only very high levels of LPS (up to 100 μg/ml; data not shown) could prime DC for a slight up-regulation in the percentage of IFN-γ-producing Th cells, however, this was far below the extent observed when usingwhole GnB. In vivo-secreted LPS can induce IFN-γ production in pathological conditions, but it remains to be established whether LPS can induce Th1 cell development (via modulation of DC) under physiological conditions of GnB infection. Although LPS is a component of major biologic importance for GnB, various other molecular components of GnB may activate and polarize the moDC, including PGN (also part of the cell wall of GnB), porins, lipoproteins and outer membrane proteins 34. A role for an alternative component is highly likely according to a recent study by Resigno et al. 35 with Toll–like receptor (TLR)-deficient mice strain showing that GnB induce DC maturation via activation of TLR2, and not via TLR4, the major binding site of LPS. Similarly, our preliminary experiments (Smits, H. H. and van der Kleij, D.) using Toll-like receptor (TLR)-transfected cell lines indicated that GnB, such as E. coli, activate both TLR2 and TLR4 with high affinity and TLR1, 6, and 9 to a lesser extent, whereas purified LPS activates only TLR4. However, as TLR2-neutralization experiments did not block Th1 polarization induced by GnB-primed DC (data not shown), this suggest that the TLR2-ligating component in GnB is not likely to be responsible for Th1 priming. Nevertheless, a differential functional role of TLR2, TLR4, other TLR or other pattern recognition receptors in this respect, is highlighted by recent studies demonstrating that whole GnB induce other and more expanded gene programs in human DC than do individual cell wall compounds, like LPS 36.

In this study moDC were used as a model for resident immature DC present in peripheral tissues, such as the mucosal lining of the intestine. This model has the limitation that we cannot mimic the influence of local micro-environmental tissue factors on the ultimate Th cell polarizing capacity of tissue-specific DC. For example, TGF-β is abundantly present in the intestine and has been demonstrated to down-regulate IL-12p70 production by DC 37, 38. Indeed, DC isolated from gut-associated lymphoid tissue have been shown to be IL-12-deficient 13, in contrast to, e.g. DC isolated from the spleen. Therefore the question remains whether the results of this study can easily be extrapolated to acquired antimicrobial immune responses mounted in the intestine in vivo. Nevertheless, several studies have demonstrated that human intraepithelial (IEL) and lamina propria (LML) lymphocytes isolated from intestinal biopsies in non-pathological conditions can produce high levels of IFN-γ 3941 in addition to high levels of IL-10 42. (reviewed in 43). Remarkably, this is also the phenotype of the effector Th cells obtained with GnB-primed moDC in the present study. Blocking studies with anti-IL-10 indicated that the high IL-10 production in the Th cells was strongly dependent on IL-10 secreted by GnB-primed moDC (Fig. 2C and data not shown). This IL-10 production may also account for the generation of IgA antibodies in vivo, instrumental in (oral) tolerance induction and frequently found in the intestines against harmless food proteins or commensal bacteria 44.

This study demonstrates that GnB have a clear immunomodulatory effect on DC by the imprinting of a strong Th1 polarizing capacity. This capacity is only partly dependent on the activity of theclassical Th1 polarizing cytokine IL-12, and it is suggested that this Th1 polarization may as well be driven by the action of the novel IL-12 family members IL-27 and/or IL-23.

4 Materials and methods

4.1 Antibodies, cytokines and reagents

Human rIL-4 (sp. act. 1×108 U/mg) was obtained from PBH (Hanover, Germany). Human rGM-CSF (sp. act. 1.11×107 U/mg) was a gift of Schering-Plough (Uden, The Netherlands). Human rIFN-γ (sp. act. 8×107 U/mg) and a neutralizing rabbit IgG to human IL-12 were gifts from Dr. P. H. van der Meide (U-cytech, Utrecht, The Netherlands). Human IL-18-binding protein (BP) was a gift from Amgem (Thousand Oaks, CA). Neutralizing Ab to human IL-10 were obtained from BD PharMingen (San Diego, CA). Neutralizing sheep antisera to human type I IFN (Iivari: 450,000 neutralizing U/ml anti-IFN-α plus 3,000 U/ml anti-IFN-β and Kaalepi: 30,000 U/ml anti-IFN-α plus 30,000 U/ml anti-IFN-β) were a gifts from Dr. I. Julkunen (National Public Health Institute, Helsinki, Finland) 45. LPS (E. coli), peptidoglycan (PGN) and lipoteichoic acid (LTA; both from S. aureus) were purchased from Sigma-Aldrich (St.Louis, MO).

4.2 Intestinal bacteria

The following bacteria were obtained from the Culture Collection of the University of Göteborg (Göteborg, Sweden) and cultured as described before 19: Escherichia coli (strain 24), Bacteroides vulgatus (strain 4940), Veillonella parvula (strain 5123), Pseudomonas aeruginosa (strain 5123) (all Gram-negative) and Bifidobacterium adolescentis (strain 18363), Enteroccocus faecalis (strain 19916), Lactobacillus plantarum (isolated from healthy human gastro-intestinal mucosa; 19), Staphylococcus aureus (strain 1800) (all Gram-positive). The bacteria were washed in PBS and killed by a 15-min exposure to UV-light and stored at –80♀C. Killing of the bacteria was confirmedby replating of the UV-exposed bacteria.

4.3 In vitro generation and maturation of DC from monocytes

Immature DC were generated by culture of peripheral blood monocytes (0.5×106 cells/well) in 24-well culture plates (Costar, Cambridge, MA) in Iscove's modified Dulbecco's medium (IMDM; Life Technologies Ltd., Paisley, GB) containing gentamycin (86 μg/ml; Duchefa, Haarlem, The Netherlands) and 10% FCS (Hyclone, Logan, UT), supplemented with rGM-CSF (500 U/ml) and rIL-4 (250 U/ml), as previously described 46. On day 6, maturation of iDC was induced by the maturation factors (MF) IL-1β (25 ng/ml) and TNF-α (50 ng/ml) (both purchased from Peprotech, Rocky Hill, NJ) in presence or absence of 1×107 UV-killed bacteria/ml. After 48 h, full maturation into CD83+ mature effector DC (mDC) was confirmed by flowcytometric analysis.

4.4 Analysis of cell surface molecule expression by flow cytometry

Mouse anti-human mAb against the following molecules were used: CD80, CD86, CD14 (all purchased by BD PharMingen), CD54 (CLB), CD1b (Diaclone Research, Besançon, France), CD83 (Immunotech, Marseilles, France). Bound mAb were detected by FITC-conjugated goat F(ab′)2 anti-mouse IgG and IgM (Jackson ImmunoResearch Laboratories Inc., West Grove, PA).

4.5 Cytokine production by DC

Mature DC (2×104 cells) were stimulated with mouse CD40L-expressing mouse plasmacytoma cells (J558 cells, 2×104 cells; a gift from Dr. P. Lane, University of Birmingham, Birmingham, GB) in 96-well flat-bottom culture plates (Costar) in IMDM containing 10% FCS, in a final volume of 200 μl. Supernatants were harvested after 24 h and stored at –20♀C until the levels of IL-12 and IL-10 secretion were measured by ELISA, as described elsewhere 46.

4.6 Real-time quantitative RT-PCR analyses of p19, p28, p40 and EBI3 mRNA

Quantitative analysis of p19, p28, p40 and EBI3 mRNA expression was performed in mature DC (5×104 cells) stimulated with J558 cells (5×104 cells) in the presence orabsence of IFN-γ (1000 U/ml; to analyze mRNA expression of p19 and p40), in 96-well flat-bottom culture plates (Costar), in IMDM plus 10% FCS, for 6 h and lysed for total RNA extraction, using a NucleoSpin RNA Isolation Kit (Macherey-Nagel, Duren, Germany). First strand cDNA was synthesized, using a cDNA-synthesis kit (MBI Fermentas, St Leon-Rot, Germany). Quantification of p19, p28, p40,EBI3 and, as a control, β2-microglobulin (β2 m) transcripts was performed by real-time quantitative PCR, using a Bio-Rad iCycler (iCycler iQ Multi-Color Real Time PCR Detection System; Bio-Rad, Hercules, CA) based on specific primers and general SYBR green (iQ SYBR Green supermix, 2×, Bio-Rad) fluorescence detection. The primer sequences were the following: 5′ p19 primer, TCGGCACGAGAACAACTGAG; 3′ p19 primer, TGGGGAACATCATTTGTAGTCT; 5′ p28 primer, GCGGAATCTCACCTGCCAG; 3′ p28 primer, CGGGAGGTTGAATCCTGCA; 5′ p40 primer, ATTGAGGTCATGGTGGATGC; 3′ p40 primer, AATGCTGGCATTTTTGCGGC; 5′ EBI3 primer, CGTGCCTTTCATAACAGAGCA; 3′ EBI3 primer, GACGTAGTACCTGGCTCGG; 5′ β2 m primer, AAGATTCAGGTTTACTCACGTC; 3′β2 m primer, TGATGCTGCTTACATGTCTCG; resulting in the amplification of PCR-products of 353 bp (p19), 285 bp (p28), 297 bp (p40) or 294 bp (β2 m). The reaction protocol was identical for all PCR-products: first a 3-min incubation at 94°C, followed by 45 cycles of sequential incubations at 94°C (30 s), 60°C (30 s), and finally 72°C (1 min) for data collection. A bulk cDNA sample of CD40L-stimulated human moDC was used as a standard and normalization to β2 m was performed for each sample.

4.7 Isolation of naive Th cells

PBL were isolated by density gradient centrifugation on Percoll (Pharmacia), and thereafter CD45RA+ CD45RO CD4+ Th cells were isolated to high purity (>98% as assessed by flow cytometry) through one-step high-affinity negative selection columns (R&D Systems), according to the manufacturer's instructions.

4.8 Stimulation and culture of naive Th cells

Purified naive Th cells (2×104 cells) were cocultured with mature DC (5×103 cells) in 200 μl culture medium in the presence of superantigen Staphylococcus aureus enterotoxin B (SEB) (100 pg/ml; Sigma), in 96-well flat-bottom culture plates (Costar). At day 5, rIL-2 (10 U/ml, Cetus Corp.) was added and the cultures were expanded for the next 7 days.

4.9 Cytokine production by Th cells

On day 14, the quiescent Th cells were restimulated with PMA (10 ng/ml) and ionomycin (1 μg/ml; Sigma) for 6 h, the last 5 h in the presence of Brefeldin A (10 μg/ml; Sigma), to determine single-cell IL-4 and IFN-γ production by intracellular flow cytometric analysis. Cells were fixed in 2% paraformaldehyde (PFA; Merck, Darmstadt, Germany), permeabilized with 0.5% saponin (ICN Biochemicals; Cleveland, OH) and stained with anti-human IFN-γ-FITC and anti-human IL-4-PE (both from BD PharMingen).

Acknowledgements

HHS was financially supported by a grant from the ‘Stichting Astma Bestrijding’.

Footnotes

  1. 1

    WILEY-VCH

  2. 2

    WILEY-VCH

  3. 3

    WILEY-VCH

  4. 4

    WILEY-VCH

  5. 5

    WILEY-VCH

Ancillary