Small interference RNA modulation of IL-10 in human monocyte-derived dendritic cells enhances the Th1 response

Authors


Abstract

RNA interference technology has been used to modulate dendritic cell (DC) function by targeting the expression of genes such as IL-12 and NF-kB. In this paper, we demonstrate that transfectionof DC with IL-10-specific double strands of small interference RNA (siRNA) resulted in potent suppression of IL-10 gene expression without inducing DC apoptosis or blocking DC maturation. Inhibition of IL-10 by siRNA was accompanied by increased CD40 expression and IL-12 production after maturation, which endowed DC with the ability to significantly enhance allogeneic T cell proliferation. IL-10 siRNA transfection did not affect MHC class II, CD86, CD83, or CD54 expression in mature DC. To further test the ability of IL-10 siRNA-treated DC to induce a T cell response, naive CD4 T cells were stimulated by autologous DC pulsed with KLH. The results indicated that IL-10 siRNA-transfected DC enhanced Th1 responses by increasing IFN-γ and decreasing IL-4 production. These findings suggest the potential for a novel immunotherapeutic strategy of using IL-10 siRNA-transfected antigen-presenting cells as vaccine delivery agents to boost the Th1 response against pathogens and tumors that are controlled by Th1 immunity.

Abbreviations:
siRNA:

Small interference RNA

RNAi:

RNA interference

1 Introduction

Dendritic cells (DC), which can activate naïve T cells, are thought to be the most potent of all antigen-presenting cells (APC) 1, 2. However, several variables including cytokine and costimulatory molecule levels, the origin of the DC, and the antigen dose strongly affect the initiation and intensity of the immune response 36.

IL-10 was initially identified as a critical cytokine that suppresses multiple immune response activities including the synthesis of Th1-derived cytokines. Further studies demonstrated that the immunosuppressive properties of IL-10 are mediated by its suppressive effects on the maturation of DC 7. Among these suppressive effects are the inhibition of MHC class II, CD86, and CD54 expression and suppression of IL-1 and TNF-α transcription 8, 9. In DC generated from peripheral blood monocytes by using GM-CSF and IL-4, IL-10 inhibits IL-12 production and induces a state of antigen-specific anergy in T cells. This anergy is characterized by inhibited T cell proliferation and reduced IFN-γ production 8. Therefore, suppressing endogenous IL-10 expression at the level of APC may be a promising strategy to enhance Th1 immune responses in DC-based cancer immunotherapy.

RNA interference (RNAi) is the process whereby dsRNA rapidly destroys mRNA that contains a sequence identical to the dsRNA. Initially described in plants, worms, Drosophila, and parasites, RNAi has recently been applied to mammalian cells by using small interfering RNA (siRNA) 1012. The mediators of RNAi are 21–23-nt siRNA generated by RNase III cleavage from longer dsRNA 1315. Transfection of 21-nt chemically synthesized siRNA has been shown to knock down the expression of the translated protein in cultured mammalian cells 10, 11, 16. siRNA technology has been used as a powerful tool to modulate the immune response in DC 17, 18. In this study, we assessed the induction of RNAi using siRNA specific for IL-10 in human monocyte-derived DC. We sought to investigate the potential application of a cellular vaccine system based on the suppression of endogenously expressed IL-10 to facilitate specific Th1 induction. We found that IL-10 in monocyte-derived DC is inhibited after stimulation with LPS + TNF-α and this is accompanied by an increase in IL-12 production and CD40 expression. Moreover, IL10 siRNA-treated DC significantly increased T cell proliferation when DC were cultured with allogeneic T cells. Th1 polarization was enhanced when naïve CD4 T cells were stimulated by IL-10 siRNA-treated DC. This study demonstrates that knocking down endogenous IL-10 expression at the level of DC by use of siRNA is a practical strategy for enhancing the specific Th1 response against pathogens.

2 Results

2.1 DC are efficiently transfected with siRNA

To establish a protocol for IL-10 RNAi in human monocyte-derived DC using GeneSilencer siRNA transfection reagent (Gene Therapy Systems, San Diego, CA), we evaluated the efficacy of siRNA transfection using FITC-labeled IL-10 siRNA. The transfection efficiency was quantified by flow cytometry. As seen in Fig. 1, FITC-labeled siRNA was successfully transfected into 91.1% of the cells after 48 h whereas only 5% of the DC incorporated siRNA in the absence of the transfection agent.

Figure 1.

 Efficacy of siRNA transfection in DC. On day 6 of culture with GM-CSF and IL-4, monocyte-derived DC (1×106) were transfected with GeneSilencer reagent only (A); FITC-labeled IL-10 siRNA (200 nM) was added to DC without transfection reagents (B); GeneSilencer reagent and FITC-labeled IL-10 siRNA at 200 nM (C). DC were activated with 100 ng/ml LPS and 10 ng/ml TNF-α on day 7, and the transfection efficacy was assessed by flow cytometry on day 8. Data are representative of three independent experiments.

2.2 siRNA transfection does not reduce DC viability or induce IFN expression

We sought to evaluate the toxicity of siRNA and the transfection reagent by measuring the viability of DC and their ability to induce type 1 IFN expression. On day 6 of culture in GM-CSF and IL-4, DC were treated with transfection reagent alone, transfected with non-silencing siRNA or with IL-10 siRNA. After 24 h of transfection, apoptosis and necrosis were assessed using annexin V and propidium iodine staining, respectively. As shown in Fig. 2, compared with untreated DC, neither the transfection reagent alone nor the transfection reagent in combination with siRNA affected cell viability. Furthermore, there was no IFN-α detectable by ELISA assay in the culture medium of transfected DC (data not shown).

Figure 2.

 DC viability is not affected by siRNA transfection. On day 6 of culture with GM-CSF and IL-4, monocyte-derived DC (1×106) were left unmanipulated (no treatment), transfected with GeneSilencer alone (mock); transfected with 200 nM non-silencing siRNA or with 200 nM IL-10 siRNA for 24 h. Then, the transfected DC were activated with 100 ng/ml LPS and 10 ng/ml TNF-α for 24 h. Cell apoptosis and necrosis were assessed by flow cytometry using annexin V and propidium iodine staining, respectively. Data are representative of three independent experiments.

2.3 IL-10 and IL-12 production in mature DC after siRNA transfection

The specificity of siRNA gene inhibition in DC after transfection with IL-10 siRNA was investigated. Immature human DC were prepared by culture of adherent mobilized peripheral blood monocytes with GM-CSF and IL-4 and transfected with 10, 50, 100, and 200 nM anti-IL-10 or 200 nM control siRNA. DC were matured by 100 ng/ml LPS and 10 ng/ml TNF-α after siRNA transfection for 24 h (see Sect. 4). After maturation (24 h), DC were collected to analyze IL-10 mRNA expression by RT-PCR, and IL-10 and IL-12 production in the culture medium were measured by ELISA. As shown in Fig. 3A and B, IL-10 siRNA transfection decreased IL-10 mRNA expression and IL-10 protein production. We observed the decrease of IL-10 protein in the medium even with only 10 nM siRNA, while IL-10 siRNA at 200 nM decreased IL-10 protein production by more than 95%. IL-12 production, however, was increased when IL-10 was decreased (Fig. 3C), demonstrating that endogenous IL-10 inhibits IL-12 expression.

Figure 3.

 IL-10 siRNA transfection of DC specifically blocks IL-10 expression and increases IL-12 production. On day 6 of culture with GM-CSF and IL-4, monocyte-derived DC (1×106) were left unmanipulated (no treatment), transfected with GeneSilencer alone (mock); transfected with 200 nM non-silencing siRNA or with 10, 50, 100 and 200 nM IL-10 siRNA for 24 h. Then, the transfected DC were activated with 100 ng/ml LPS and 10 ng/ml TNF-α for 24 h. (A) RNA from transfected DC was extracted using the RNeasy kit. RT-PCR was performed to assess IL-10 and β-actin expression, using primers described in Sect. 4. (B) Supernatants were harvested from culture medium and analyzed by ELISA for IL-10 production. (C) Supernatants were harvested from culture medium and analyzed by ELISA for IL-12 p70 production. (B, C) "a" indicates p<0.01 compared with no treatment, non-silencing siRNA, and mock groups; "b" indicates p<0.01 compared with 10 nM IL-10 siRNA; "c" indicates p<0.01 compared with 50 nM IL-10 siRNA; "d" indicates p<0.01 compared with 100 nM IL-10 siRNA. Data are representative of three independent experiments.

2.4 Cell surface phenotype analysis after IL-10 siRNA transfection

To address the effects of IL-10 siRNA transfection on DC phenotype after maturation, we used a homogenous population of immature DC obtained after 6 days in culture with GM-CSF and IL-4. These DC expressed medium levels of MHC class II and CD86 and had barely detectable expression levels of CD83 on the surface. The vast majority of these cells (∼90%) did not display CD14 before maturation (data not shown). DC were matured with 100 ng/ml LPS and 10 ng/ml TNF-α after siRNA transfection for 24 h (see Sect. 4). After 24 h, DC were collected to analyze their phenotypes by flow cytometry. Maturation of DC induces dramatic phenotypic changes, which is shown by the up-regulation of MHC class II, CD86, CD40, CD83, and CD54 expression levels on the surface. siRNA transfection did not inhibit DC maturation. As shown in Fig. 4, there was no difference between the four groups with regard to MHC class II, CD86, CD83, or CD54 expression. We did find, however, that CD40 expression was increased in DC after IL-10 siRNA transfection.

Figure 4.

Effect of IL-10 siRNA transfection on DC phenotype after maturation. On day 6 of culture with GM-CSF and IL-4, monocyte-derived DC (1×106) were left unmanipulated (no treatment), transfected with GeneSilencer alone (mock); transfected with 200 nM non-silencing siRNA or with 200 nM IL-10 siRNA for 24 h. Then, the transfected DC were activated with 100 ng/ml LPS and 10 ng/ml TNF-α for 24 h. DC phenotype was assessed by expression analysis of CD83, HLA-DR, CD86, CD40, and CD54 by flow cytometry. Data are representative of three independently performed experiments.

2.5 T cell stimulatory ability of DC after IL-10 RNAi

The function of DC can be characterized in part by their ability to stimulate alloreactive T cells in the mixed lymphocyte reaction (MLR) 2. To determine whether IL-10 siRNA transfection affected the allostimulatory activity of DC, MLR was performed using DC transfected with IL-10 siRNA, DC transfected with non-silencing control siRNA, mock transfected DC or untreated control cells. Allogeneic T cells were cultured with siRNA-transfected DC for 6 days, at which point allostimulation was determined by proliferation. All three control groups showed similar allostimulatory activity. Interference with IL-10 siRNA significantly increased the induction of T cell proliferation, which was significant and consistent with the decrease of IL-10 production and increase of IL-12 production (Fig. 5). Because IL-10 siRNA treatment did not change MHC class II or costimulatory molecule (CD86) expression on DC, our results demonstrate that IL-10 and IL-12 levels directly influence allogeneic T cell proliferation.

Figure 5.

 IL-10 siRNA transfection increases DC-induced allogeneic T cell proliferation. DC were left untreated (no treatment), transfected with GeneSilencer alone (mock), transfected with 200 nM control siRNA (non-silencing siRNA) or with 200 nM IL-10 siRNA for 24 h. Allogeneic T cells (2×105/well) were incubated with siRNA-treated DC at the indicated ratio of DC : T for 6 days. Proliferation was determined using the WST-1 assay. Data are representative of three independent experiments.

2.6 IL-10 siRNA-treated DC polarize naïve CD4 cells toward a Th1 immune response

The process of phenotypic maturation and induction of IL-10 and IL-12 production by DC is thought to play an important role in the induction of an immune response 19. In this study, we observed that interference with IL-10 siRNA inhibited IL-10 secretion and, concurrently, increased IL-12 production and CD40 expression after maturation by LPS and TNF-α. When co-cultured with T cells, these DC appeared optimally suited to induce a Th1 immune response. To test the function of siRNA-treated DC, purified CD45RO CD4+ cells were stimulated by IL-10 siRNA-transfected DC pulsed with 50 μg/ml KLH. After 6 days of stimulation, in the presence of IL-10 siRNA-treated DC, the IFN-γ level in the culture medium was significantly increased. Furthermore, there was no detectable IL-4 in cultures with IL-10 siRNA-treated DC (Fig. 6). The results indicated that DC matured by LPS and TNF-α polarize CD4+ cells toward the Th1 immune response because IL-4 production was much lower than IFN-γ production by the T cells in every group. In particular, IL-10 siRNA-treated DC generated the most significant and strongest Th1 immune response as indicated by high IFN-γ production by CD4+ cells and the lack of any detectable IL-4 production.

Figure 6.

Effect of IL-10 siRNA transfection of DC on antigen presentation and specific Th1 response activation. On day 6 of culture with GM-CSF and IL-4, monocyte-derived DC (1×106) were left unmanipulated (no treatment); transfected with GeneSilencer alone (mock); with 200 nM non-silencing control siRNA or 200 nM IL-10 siRNA for 24 h. Transfected DC were incubated with KLH (50 μg/ml) for 3 h, then activated with 100 ng/ml LPS and 10 ng/ml TNF-α for 24 h. After washing, siRNA-treated DC (106) were seeded in cultures with autologous CD45RO CD4+ T cells (10×106) for 6 days. Supernatants were collected from the medium and IFN-γ (A) and IL-4 (B) production was assessed by ELISA (* indicates p<0.01, by one-way ANOVA compared with the other three groups). Data are representative of three independent experiments.

3 Discussion

IL-10 siRNA-treated DC could significantly decrease IL-10 expression at both the mRNA and protein levels. Most importantly, inhibition of endogenous IL-10 expression could significantly increase IL-12 expression after LPS + TNF-α maturation. Inhibition of IL-10 expression could increase CD40 expression, increasing the allogeneic T cell response and antigen presentation to induce a more potent Th1 immune response. Although many studies have shown a limited ability of DC to be transfected with DNA, Hill et al. showed that RNA transfection of bone marrow-derived murine DC by using GenePorter reagents (Gene Therapy Systems, San Diego, CA) was extremely efficient 17. siRNA has been successfully transfected into human monocyte-derived DC by electroporation 18. It is well known that immature DC are highly phagocytic and can internalize a variety of molecules including nucleic acids. However, we and others have found that immature DC are unable to internalize naked siRNA 17. Long double-stranded RNA (>38 bp) could induce a nonspecific type 1 IFN response in mammalian cells, leading to arrest in transcription and cell death. DC may be particularly sensitive to double-stranded RNA via the expression of Toll-like receptor 3 20, 21, although the small-size siRNA (<30 nt) reportedly fail to activate the IFN-induced protein kinase R 22 or to elicit a type 1 IFN response in mammalian cells 12. A lingering concern for siRNA transfection is that transfection reagents may alter DC viability and their induction of a type 1 IFN response. We and others also demonstrated that siRNA transfection did not affect cell viability or the ability of DC to induce a type 1 IFN response 17, 18. Furthermore, unlike antisense oligodeoxyribonucleotides (oligo-dNTP), siRNA appears to require doses 10- to 100-fold lower than such nucleotides to achieve a similar effect 18. Although antibody neutralization and IL-10 antisense oligo-dNTP transfection has been successfully used to block the bioactivity of IL-10 and inhibit IL-10 production, our results highlight how RNAi can be used to analyze specifically the role of single gene products in DC antigen presentation.

IL-10 prevents antigen-specific T cell proliferation indirectly by reducing the antigen-presenting capacity of DC. This effect is associated with the inhibition of MHC class II, CD86, and CD54 expression on these cells 8, 9. In our study, there was no effect on MHC class II, CD86, and CD54 expression when IL-10 was silenced by RNAi. We found that CD40 expression was significantly increased on the surface of DC after RNAi-inhibited IL-10 expression. A previous report indicated that allogeneic T helper and cytotoxic T cell responses were diminished in CD40 ligand (CD40L)-deficient mice despite the fact that injected DC expressed high levels of MHC class II, B7.1, and B7.2 23. CD40 and CD40L interactions play important roles in the priming, differentiation and effector function of helper and cytotoxic T cells 23. IL-12 is an inducible cytokine composed of 35- and 40-kDa subunits and is crucial to promoting the development of Th1 cells and cell-mediated immunity 2426. DC are major IL-12 producers 27, 28, and IL-12 production after cognate interaction with CD4+ T cells is largely dependent on CD40/CD40L interaction 29. It has been shown that triggering CD40 on DC leads to IL-12 production. The increase in CD40 expression and IL-12 production, and the enhanced Th1 induction by IL-10 siRNA-treated DC suggest that antigen presentation is an active process, not just a default outcome of low levels of IL-10 in the environment. This finding underscores the basis for the ineffectiveness of anti-IL-10 Ab to enhance Th1 induction via binding and neutralization of secreted IL-10. A recent study suggested the reverse relationship between the production of IL-10 and IL-12 in activated DC 30, a finding also observed in the current study. Neutralization of the secreted IL-10 by Ab and IL-10 antisense oligo-dNTP could enhance the production of IL-12 31. The Th1 immune response was significantly enhanced by DC in an IL-10 knockout mouse model 32, and previous studies demonstrated that endogenous IL-10 production is a crucial regulatory step in Th1 activation.

DC of cancer patients exhibit dysfunction as a result of tumor cells secreting immunosuppressive cytokines such as transforming growth factor β (TGF-β) 33, vascular endothelial growth factor (VEGF) 34, and IL-10 35. A promising means of eliciting tumor-specific antigen presentation to the immune system is to provide optimalDC to induce a Th1 response. It has been established that a Th1-like T cell response is desirable for optimal tumor rejection 36, 37. Transfection of DC with IL-10 siRNA is efficient and may offer the possibility of treating immune-based diseases in a specific and effective manner. The successful use of antigen-pulsed IL-10 siRNA-modified DC to enhance a Th1 immune response highlights the potential utility of this approach for DC-based cancer immunotherapy.

4 Materials and methods

4.1 Generation of monocyte-derived DC

Mononuclear cells were isolated using leukapheresis. A COBE Spectra Apheresis System was used to harvest the mononuclear cell layer. Leukapheresis yielded 1010 PBMC. These cells were allowed to become adherent for 2 h at 37°C in tissue culture flasks at a concentration of 5×106 cells/ml in RPMI 1640 (Invitrogen, Carlsbad, CA) with 10% autologous heat-inactivated serum. After 2 h at 37°C, nonadherent cells were removed by washing with warm complete medium. To generate autologous DC, adherent PBMC were cultured in complete medium for 6 days in the presence of human recombinant GM-CSF (800 U/ml; clinical grade; Berlex, Richmond, CA) and human recombinant IL-4 (500 U/ml; R&D Systems, Minneapolis, MN).

4.2 siRNA design, synthesis and transfection

The 21-nt interfering RNA duplexes with two 3′-end overhang dT nucleotides in the antisense strands of the siRNA have been reported 10, 11. The siRNA sequence used for targeted silencing of human IL-10 [Genebank access number: AY029171] was designed by Qiagen software, and siRNA sequences were selected according to the method of Elbashir et al. 10. An IL-10 siRNA targeting the specific sequence AATAAGCTCCAAGAGAAAGGC was selected for this study. The double-stranded RNA consisted of the sense strand 5′-UAAGCUCCAAGAGAAAGGCdTdT-3′ and the antisense strand 3′-dTdTAUUCGAGGUUCUCUUUCCG-5′. Searches of the human genome database (BLAST) were carried out to ensure that the sequence would not target other gene transcripts. siRNA were facilitated by GeneSilencer (Gene Therapy Systems, San Diego, CA), which was used according to the manufacturer's protocol. Non-silencing control siRNA is an irrelevant siRNA with random nucleotides and no known specificity. Sequences were synthesized and annealed by the manufacturer (Qiagen, Valencia, CA).

4.3 RT-PCR

Total RNA was extracted from 1×106 DC using an RNeasy kit (Qiagen) according to the manufacturer's instructions. cDNA was synthesized using an oligo(dT) primer, a dNTP mixture, RNase inhibitor, and Superscript II RNase H-Reverse Transcriptase (Invitrogen, Carlsbad, CA). PCR amplification was conducted in 50 μl containing 1–5 μl cDNA, 1.5 mM MgCl2, a dNTP mixture (0.2 mM of each dNTP), 0.5 μM of each oligonucleotide primer, and 2 U Taq DNA polymerase. Primers used in this study were: IL-10 forward, 5′-ATGCACAGCTCAGCACTGCTCT-3′, IL-10 reverse, 5′-CTTAAAGTCCTCCAGCAAGGAC-3′, product size 225 bp; and β-actin forward, 5′-AATCTGGCACCACACCTTCTAC-3′, β-actin reverse, 5′-CTTCTCCTTAATGTCACGCACG-3′, product size 394 bp. Amplification steps consisted of 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 1 min, using a DNA cycler (PerkinElmer, Wellesley, MA). The PCR reaction was analyzed on 1.5% agarose gels stained with ethidium bromide.

4.4 Flow cytometric analysis

Directly conjugated mouse mAb, including FITC-conjugated CD86 and CD40, PE-conjugated anti-HLA-DR and anti-CD83, and Biotin-conjugated anti-CD54 mAb were supplied by BD PharMingen (San Diego, CA). Cellular staining was measured on a FACSCalibur instrument (BD Biosciences, San Jose, CA), and data were analyzed using CellQuest software, with results expressed as percentage of cell stainingabove background staining obtained with isotype control mAb.

4.5Allogeneic T cell proliferation

MLR was set up by culturing PBMC [5×104 cells/0.3 ml of AIM-V serum-free medium (Invitrogen) per well in triplicate] with various concentrations of allogeneic transfected DC obtained ∼24 h after transfection with the various siRNA. The mitogenic activity of the growth factors was determined by a colorimetric assay based on formazan dye formation (WST-1, Roche, Indianapolis, IN), which directly correlates with the number of metabolically active cells in the culture. After incubation of cells for 6 days, 20 μl/well of the reagent WST-1 were added and incubated for 1.5 h at 37°C. An increase in the number of viable cells resulted in an increase in the overall activity of mitochondrial dehydrogenases in the sample with an ensuing increase in formazan dye formation. The formazan dye was quantified by measuring the optical density of the dye solution at 450 nm with a scanning multiwell spectrophotometer (Molecular Devices, Sunnyvale, CA) using 890 nm asthe internal reference 38. All results in the study were based on at least five parallel measurements each time and repeated in up to three independent experiments.

4.6 Purification of naïve CD4 T cells and stimulation by DC

Naïve CD4 T cells were purified by magnetic separation using anti-CD45RO (UCHLA1) (Miltenyi Biotech Inc., Auburn, CA) microbeads for negative selection, then anti-CD4 microbeads for positive selection. Matured, IL-10 siRNA-treated DC were loaded with 50 μg/ml KLH (subunits, Mr 350,000/400,000; Calbiochem-Novabiochem Corp., San Diego, CA), then cultured with autologous purified CD45RO CD4+ cells at 2×105 DC/ml and 2×106 T cells/ml in a final volume of 2 ml AIM-V medium for 6 days. IFN-γ and IL-4 in the medium were measured by ELISA.

4.7 ELISA assay

IL-12 p70, IL-10, IFN-α, IFN-γ, and IL-4 were measured in the culture medium using the OptEIA ELISA sets according to the manufacturer's instructions (BD PharMingen, San Diego, CA). The coefficient of variation (CV) of inter-assay and intra-assay for ELISA in our experiments was less than 10%.

4.8 Statistics

Data are presented as the mean of each triplicate assay. Statistical comparisons between groups were performed using a one-way ANOVA followed by a Dunnett's test, as appropriate. Differences among groups were considered significant when p<0.05.

Acknowledgements

The authors would like to thank Dr. Scot Macdonald for editorial assistance.

Footnotes

  1. 1

    WILEY-VCH

  2. 2

    WILEY-VCH

  3. 3

    WILEY-VCH

  4. 4

    WILEY-VCH

  5. 5

    WILEY-VCH

  6. 6

    WILEY-VCH

Ancillary