SEARCH

SEARCH BY CITATION

Keywords:

  • Immunosuppression;
  • Lymphocyte activation;
  • Stem cells

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods

Bone marrow mesenchymal progenitor cells (BMSC) are used for regenerating tissues of mesodermal origin, as well as tissues of different embryological derivation. Experimental evidence shows that BMSC are able to suppress the activation of the immune response by mechanisms that are still not completely understood. Thus far, in vitro studies carried using human or mouse cells indicate that autologous or allogeneic BMSC strongly suppress proliferation of T lymphocytes, triggered by cellular stimuli, nonspecific mitogenic stimuli, or antigenic peptides. Using cell proliferation and blocking assays, we demonstrated that BMSC inhibited the activation of murine splenocytes, T, and B lymphocytes. Direct contact of BMSC and target cells in a cognate fashion determined the inhibition of cell proliferation via engagement of the inhibitory molecule programmed death 1 (PD-1) to its ligands PD-L1 and PD-L2, leading the target cells to modulate the expression of different cytokine receptors and transduction molecules for cytokine signaling. Soluble factors present on supernatants of BMSC cultures were effective in suppressing proliferation of B cells to a mitogenic stimulus. Taken together, these results highlight the complexity of the role of BMSC in regulating the immune response, asserting the possibility of their therapeutic application in transplantation and autoimmune diseases.

Abbreviations:
BMSC:

Bone marrow stromal progenitor cells

PD-1:

Programmed death-1

PD-L1:

Programmed death-1-ligand 1

PD-L2:

Programmed death-1-ligand 2

SDF-1:

Stromal derived factor 1

TGFβ1:

Transforming growth factor β1

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods

Bone marrow mesenchymal progenitor cells (BMSC) are precursors of skeletal tissue components such as bone, cartilage, hematopoiesis-supporting stroma, and adipocytes. In addition, they may be experimentally induced to undergo unorthodox differentiation, such as neural and myogenic cells 13. Analysis of the clonal differentiation potential indicates that a single cell can give rise to different phenotypes, and that the original BMSC population is extremely heterogeneous. Given their high proliferation potential and their multipotential differentiation capability, BMSC have been proposed for regeneration and repair of both skeletal and nervous tissues. In particular, remarkable progresses have been made in the regeneration of long bone segments using autologous BMSC loaded in biomaterial scaffolds 4. Moreover, BMSC have been shown to be capable of regulating the immune response. In humans, allogeneic transplantation of mesenchymal precursors in patients affected by osteogenesis imperfecta resulted in engraftment of donor osteoblasts 5. BMSC may improve the outcome of allogeneic transplantation by promoting hematopoietic engraftment and limiting GVH disease 69. In vitro studies carried using human or mouse cells indicate that autologous or allogeneic BMSC strongly suppress T lymphocyte proliferation, triggered by cellular stimuli, nonspecific mitogenic stimuli, or antigenic peptides, in a dose-dependent fashion 8, 1012. Immunological restriction appears not to be involved, indicating that third-party non-histocompatible cells can be used to suppress the lymphocyte activation 1012. Differences have been described as far as mechanisms of BMSC-mediated immunomodulation are concerned, which can be explained by differences between murine and human BMSC or by the extreme heterogeneity of BMSC populations used for the studies. BMSC from different mouse strains have been shown to inhibit the proliferation of T lymphocytes by a cell-to-cell contact mechanism, even though the intervention of soluble factors cannot be ruled completely out 11, 12. However, other reports claim that human BMSC suppress T cell proliferation either by intervention of soluble factors 10 or by cell contact 8.

The immune response is subject to a variety of control mechanisms. These mechanisms restore the immune system to a resting state when responsiveness to a given antigen is no longer required. Cell-mediated immune responses are controlled by molecular interactions leading to inhibition of activation signals, CTLA-4 (CD152)/B7 (CD80) or B7–2 (CD86) and Fas (CD95)/FasL (CD178), among the others. The B7 homolog and costimulatory molecule programmed death-1 (PD-1) and its ligands, PD-L1 and PD-L2 constitute a recently discovered inhibitory regulatory pathway 1315. Activation of the PD-1 pathway leads to the inhibition of T cell receptor-mediated lymphocyte proliferation and cytokine secretion 16, 17. There are also different down-regulatory pathways involving cytokines and resulting in suppression of the immune response, transforming growth factor-β (TGFβ) and IL-10 among the others. TGFβ is a family of three closely related molecules that stimulate connective tissue growth and collagen formation, but also promotes several anti-inflammatory effects, including suppression of hematopoiesis, reduction in production of proinflammatory cytokines, and inhibition of leukocyte adhesion 18, 19. Similarly, IL-10 has been shown to inhibit the activation of specific macrophage subsets, including blocking of the production of proinflammatory cytokines and interference with the macrophage-mediated antigen presentation 20, 21.

In this study, we investigated the mechanisms involved in the BMSC-mediated immunomodulation. We found that BMSC selectively suppressed the proliferation of T and B lymphocytes. Cell-to-cell contact, via the PD-1 inhibitory molecule and its ligands PD-L1 and PD-L2, mediated the inhibition of spleen, T and B cell activation, while soluble factors were effective in suppressing the proliferation of B lymphocytes. Target cells were rendered unresponsive by modulation of the expression of different cytokine receptors, such as IL-12R, and signal transductors, STAT5a and STAT5b.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods

Immunophenotype of BMSC

BMSC is a very heterogenic population of cells, in which a single cell can give rise to clones with specific differentiation potential. Culture conditions might determine the expansion of particular clones with disparate functional and phenotypic characteristics, and as yet there are no specific molecular markers for detection of a pure population of BMSC 12, 2224. Thus, we specifically identified and selected BMSC populations through their ability to adhere to the plastic support and their capacity to differentiate into chondrocytes, osteoblasts, and adipocytes (Fig. 1A). BMSC selected by these criteria and harvested after the first passage of culture on F12 medium (naive BMSC), constitutively expressed molecules involved in activation of the immune reaction. More than 95% of BMSC expressed major histocompatibility complex class I molecules (Fig. 1B), but not MHC class II antigens (data not shown). Expression of molecules described as markers of different subpopulations of mesenchymal or hematopoietic progenitor cells 23, such as CD13 and CD34, was heterogeneous (Fig. 1B). Costimulatory and accessory molecules, i.e. CD28 and CD80, were variably expressed (Fig. 1B). BMSC constitutively produced detectable mRNA levels of cytokines, such as IL-1β, stromal derived factor 1 (SDF-1), osteopontin (OPN), and of growth factors, i.e. TGFβ1 (data not shown), molecules already well known for being secreted by BMSC under physiological conditions.

thumbnail image

Figure 1. (A) In vitro differentiation potential. Undifferentiated cells (negative control) are shown in the left panel, differentiated cells in the right panel. Chondrogenic differentiation was induced using ascorbic acid and TGFβ1, and stained with alcian blue. Positive cells appear light blue. Osteogenic differentiation was induced by adding ascorbic acid, sodium β-glycerophosphate, and dexamethasone, and stained with alizarin red. Positive cells are red. Adipogenic differentiation was induced by the addition of dexamethasone and insulin, and stained with Sudan black. Differentiated cells appear black. (B) Immunophenotype of naive BMSC. Flow cytometric analysis of naive BMSC shows that BMSC constitute a heterogeneous population characterized by the expression of MHC class I antigens in more than 95% of cells. BMSC express low levels of CD28 costimulatory molecule, and CD80 with a bimodal appearance. About 50% of BMSC show expression of CD13, and less than 10% are CD34+. Areas under the gray line represent molecule expression on tested cells, and areas under the red line represent the blank (unstained cells).

Download figure to PowerPoint

Expression profiles of PD-1, PD-L1 and PD-L2

Expression of the inhibitory molecule PD-1 or its ligands PD-L1 and PD-L2 was not detected by FACS analysis on naive BMSC, although mRNA for these products was assessable by RT-PCR (Fig. 2A), indicating that the expression of these molecules at a protein level would be inducible using appropriate stimuli. In fact, BMSC cultivated for 96 h in RPMI medium (unstimulated BMSC), expressed PD-1 (average 32%), PD-L1 (5%), and PD-L2 (9%) (Fig. 2B). Adding PHA to these cultures produced a slight increase of the expression of PD-1 (40%) by BMSC, and a decreased expression of PD-L2 (2%), whereas the level of PD-L1 expression remained unchanged (5%) (Fig. 2B). Co-culturing BMSC and allogeneic splenocytes in presence of PHA induced a sharp decrease of PD-1 (8%) expressed by BMSC, a significant increment of PD-L1 (55%), and a milder increase of expression of PD-L2 (15%) (Fig. 2B).

thumbnail image

Figure 2. (A) Expression of PD-1, PD-L1, and PD-L2 by naive BMSC, tested by RT-PCR. Results of a representative experiment are shown. Splenocytes and cells from the quadriceps muscle of the leg are used as positive and negative controls, respectively. Expressions of PD-1, PD-L1, and PD-L2 are compared with that of the internal control GAPDH. (B) Pattern of expression of PD-1, PD-L1, and PD-L2 by BMSC under different culture conditions analyzed by FACS. Results show one representative experiment. FACS analysis confirms the absence of PD-1, PD-L1, and PD-L2 on naive cells. Unstimulated BMSC express PD-1 (average 32%), PD-L1 (5%), and PD-L2 (9%). PD-1 is present on 40% of BMSC cultured in presence of PHA, PD-L2 on 2% of BMSC cultured in presence of PHA, while the level of expression of PD-L1 remains at 5% under the same conditions. BMSC co-cultured with allogeneic splenocytes in presence of PHA decrease the expression of PD-1 (8%), and increase the level of PD-L1 (55%), and PD-L2 (15%). Areas under the dark gray line represent molecule expression on tested cells, and areas under the light gray line represent the blank (unstained cells).

Download figure to PowerPoint

Immunosuppression of cell proliferation by BMSC

As a first step in identifying the role of BMSC in the immune system, mesenchymal progenitor cells were found not to be professional APC since BMSC from C57BL/10 mice (H2b) did not trigger a significant proliferation of allogeneic splenocytes from BALB/c mice (H2d) (Fig. 3). Allogeneic BMSC were able to significantly inhibit proliferation of splenocytes challenged with a mitogenic agent, such as PHA, or with allogeneic APC (Fig. 4, 5A). BMSC action targeted both T and B lymphocytes, since proliferation to T- or B-specific mitogenic stimuli was significantly suppressed in presence of allogeneic BMSC (Fig. 5B, C). Proliferation of splenocytes and T cells was significantly inhibited in the presence of BMSC, but not when supernatant of BMSC cultures was added to wells containing PHA-activated splenocytes (Fig. 5A, B), whereas pokeweed mitogen (PWM)-dependent activation of B lymphocytes was blocked by BMSC contact and by cytokines present in supernatants of BMSC cultures. These data indicate that the cognate interaction between BMSC and target cells was required for blocking the proliferation of all type of cell studied, and that the action of soluble factors was selectively effective in suppressing B cell proliferation (Fig. 5C).

thumbnail image

Figure 3. BMSC are not professional APC. Murine spleen cells do not actively proliferate upon challenge with allogeneic BMSC. Compiled results of at least three independent experiments are shown. Data represent the average cpm. Error bars indicate SD values. *p<0.05, comparing proliferation rates of stimulated cells with proliferation rate of cells cultured in presence of medium only (considered as control baseline).

Download figure to PowerPoint

thumbnail image

Figure 4. BMSC abrogate proliferation of splenocytes to mitogenic or allogeneic stimuli. BMSC inhibit the proliferation of murine spleen cells stimulated with PHA or allogeneic APC. Compiled results of at least three independent experiments are shown. Data represent the average cpm. Error bars indicate SD. *p<0.05, comparing proliferation rates of stimulated cells, in presence or absence of BMSC, with proliferation rate of cells cultured in presence of medium only.

Download figure to PowerPoint

thumbnail image

Figure 5. BMSC-mediated immunosuppression involves cell-to-cell contact. (A) Proliferation of splenocytes to PHA is significantly blocked by contact with BMSC. (B) Similarly, PHA-mediated activation of T lymphocytes is only significantly blocked by the presence of BMSC. (C) Proliferation of B lymphocytes to a mitogenic stimulus (PWM) is completely suppressed by cognate contact with BMSC and partially (about 50%) by soluble factors present in the supernatant. Data are shown as average cpm. Error bars indicate SD. *p<0.05, for proliferation rates of stimulated cells, in presence or absence of BMSC or supernatant, compared with proliferation rate of cells cultured in presence of medium only. •p<0.05, for proliferation rates of stimulated cells in presence of supernatant compared with proliferation rate of cells cultured in presence of mitogen.

Download figure to PowerPoint

Involvement of the PD-1 pathway in BMSC-mediated immunosuppression

To study the role of the PD-1 inhibitory pathway in mediating suppression of cell proliferation by BMSC, we performed blocking experiments using monoclonal antibodies to PD-1, PD-L1, and PD-L2. The presence of 0.50 μg/well of anti-PD-1 antibody restored about 50% of T cell proliferation, and only about 30% of B lymphocyte proliferation (Fig. 6). Cell proliferation was rescued by anti-PD-1, anti-PD-L1, and anti-PD-L2 in a dose-dependent fashion, which was more evident when T lymphocytes were the responder cells (Fig. 6). The simultaneous blockade of PD-L1 and PD-L2 did not produce any significant effect on the BMSC-mediated inhibition of cell proliferation (Fig. 6). It is possible that the presence of both monoclonal antibodies could modify the appropriate biochemical interactions between PD-1 and its ligands. Alternatively, the blockade of both PD-L1 and PD-L2 may unmask and activate other factors involved in the inhibition of cell proliferation 25.

thumbnail image

Figure 6. Activation of the PD-1 pathway is required for blocking BMSC-mediated cell proliferation. Compiled results are shown of at least four independent blocking experiments using decreasing concentrations of monoclonal antibodies to PD-1, PD-L1 and PD-L2, and combined concentrations of anti-PD-L1 and anti-PD-L2 antibodies. Data represent the averaged cpm. Error bars indicate SD. *p<0.05, comparing proliferation rates of stimulated cells, in presence or absence of BMSC and/or blocking antibodies, with proliferation rate of cells cultured in presence of BMSC and antibody isotype control.

Download figure to PowerPoint

Taken together, these data suggest that the PD-1 pathway is effective in restoring BMSC-inhibited proliferation of T and B lymphocytes; engagement of PD-1 to its ligands PD-L1 and PD-L2 led to a partial restoration of cell proliferation, indicating that the mechanisms of BMSC action are redundant, involving different molecular pathways. The action of PD-L1 and PD-L2 was independent, and it appeared dominant over other inhibitory mechanisms.

Molecular mechanisms of BMSC-mediated immunosuppression

BMSC cultured on transwell membranes, which precluded the contact with the co-cultured PHA-stimulated allogeneic splenocytes, significantly increased the expression of messenger RNA for the inhibitory cytokine TGFβ1 and TGFβ1 receptor (TGFβ1R) (Fig. 7), but not for another inhibitory molecule IL-10, or for SDF-1 (data not shown).

thumbnail image

Figure 7. Expression rates of molecules involved in BMSC-mediated immunosuppression. BMSC cultured on transwell membranes impeding contact with the co-cultured PHA-stimulated allogeneic splenocytes (Transwell) significantly increase the expression of messenger RNA for TGFβ1 and TGFβ1, but not for IL-10 or SDF-1, compared with the amount of mRNA expressed by BMSC maintained in culture medium (Medium), and considered as a baseline. mRNA expression is shown as the averaged ratio between the gene expression level and that of GAPDH. Error bars indicate SD. *p<0.005 for the gene expression rate of cells cultured in transwell membrane compared to that of cells cultured in culture medium.

Download figure to PowerPoint

Targeted splenocytes responded to the contact of BMSC by down-regulating the expression of mRNA for the signal transductor molecules STAT5a and STAT5b, which amplify the signal from different receptors for growth factors and type I cytokines, albeit not in a statistically significant fashion (data not shown). They also modulated the expression of the receptors for TGFβ1, IL-10, and IL-12 (data not shown).

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods

BMSC are a population of progenitor cells that can generate different cell lineages, including cells of ectodermic and endodermic origin 1, 2 when exposed to different microenvironments. They have been used to engineer long bone segments 4, and are being proposed for regeneration of other tissues, such as central and peripheral nerve tissue, liver, heart, cartilage and tendons. A role of BMSC in regulating the immune response has been shown 8, 1012, but the mechanisms by which their function is exerted are still debated. Some of the discrepancies described by literature can be explained by considering the differences existing between human and murine cells, some others by the different protocols used for cell isolation and culture leading to the selection of cell clones of different phenotype and function. Lacking a general consensus over the definition of a clear pattern of molecular markers for BMSC, we have chosen to isolate and define the BMSC used for our study by functional criteria; we selected only BMSC populations maintaining their capability to differentiate into the chondrogenic, osteogenic, and adipogenic lineage.

We found that BMSC did not elicit proliferation and activation of lymphocytes from non-histocompatible responders, and they down-regulated the immune response of effector cells initiated by cellular or mitogenic stimuli. The mechanisms by which BMSC exert their role in the immune system were pleiotropic and redundant, involving the activation of the PD-1 pathway in a cell-to-cell contact fashion, and the release of TGFβ1. Disparate types of cells are the potential targets, among them T and B lymphocytes, but other elements included in the bulk population of spleen cells cannot be excluded. In particular, only B cells were sensitive to the inhibitory action of soluble factors present in supernatants of BMSC, whereas they were less affected by cell interactions via PD-1/PD-L1 or PD-L2. Furthermore, the interaction between PD-1 and PD-L1/PD-L2 appeared to be a dominant mechanism in restoring proliferation of T cells. Cognate contact between BMSC and target cells leads to activation of the PD-1 inhibitory pathway, which has been reported to be capable of blocking allograft rejection, and to modulate T and B cell-dependent pathological immune responses 13, 15. The PD-1 pathway is involved in regulation of activation of cells of the immune system by cells of different embryological origin, such as endothelial cells 26. On these premises, one could hypothesize that the role of the PD-1/PD-L1/PD-L2 molecular system can be extended to the nonspecific regulation of cell proliferation by different type of cells, including stem or progenitor cells. This is probably not true, since it has been reported that self-renewing progenitor cells isolated from the mammalian central nervous system do not use the PD-1 pathway to down-regulate the recipient's immune reaction following allotransplantation 27, therefore the role of the PD-1 pathway in regulating the immune response appears to be specific and confined to detailed types of cell populations.

Cognate interaction between BMSC and T lymphocytes has been indicated by Krampera et al. 11 as the main mechanism of BMSC-mediated immunosuppression, although they did not rule out the role of soluble factors. In contrast, Di Nicola et al. 10 demonstrate the major importance of the cytokines TGFβ1 and hepatocyte growth factor (HGF), in regulating the activation of T cells. Our results stress the significance of cell-to-cell contact for specific inhibition of T cells activation, while soluble factors are involved in suppressing B cell proliferation. This also implies that soluble factors can be released by T cells upon cognate interaction with BMSC, or that they can act on cells of not lymphoid origin to amplify the suppression process.

Upon activation of the PD-1 or TGFβ1 pathways, targeted cells present in the bulk population of splenocytes modulate the expression of receptors for stimulatory lymphokines, such as IL-12R, and down-regulate the expression of the STAT5a and STAT5b gene, rendering this molecular complex inefficient in transducing the proliferation signal of type I cytokines 28, 29.

Our data stress the fact that the molecular machineries involved in the regulatory function of BMSC are redundant, and that the spectrum of cell populations targeted is broad, including cells of non-lymphoid or myeloid origin. Moreover, the mechanisms of BMSC-mediated immunosuppression appear to be similar to the ones used by regulatory T cells to inhibit lymphocyte proliferation, and are also necessary for developing clones of regulatory cells 3032. On these premises, we can envision a possible scenario in which BMSC might be able to educate T regulatory lymphocytes that are non-MHC restricted, that are included in the whole population of spleen cells, and that are able to continue the inhibitory activity initiated by BMSC. Moreover, the finding that BMSC, when co-cultured with mitogen-stimulated target cells, increased the expression of both TGFβ1 and TGFβ1R suggests the existence of an autocrine loop for propagation and education of immunosuppressive BMSC.

The key issue of whether BMSC also use the PD-1 pathway to regulate the immune response in an in vivo setting is still open. Preliminary data from our lab are encouraging, showing that BMSC isolated from strains of mice susceptible to induction of autoimmune diseases expressed lower or undetectable levels of mRNA for PD-L1 and PD-L2, and had a weak effect on blocking cell proliferation (Tasso et al., manuscript in preparation). If these data are confirmed, it would open the perspective of using PD-L1 or PD-L2 as markers for identification and selection of a subpopulation of BMSC able to down-regulate the immune response, and using them for therapy of pathological conditions in which the balance of immunoresponses has to be restored.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods

Mice

C57BL/10 and BALB/c mice were purchased from Charles River Laboratories (Calco, LC, Italy). Mice were used between 6 and 8 weeks of age. Mice were bred and maintained at the Institution's animal facility. The care and use of the animals were in compliance with laws of the Italian Ministry of Health and the guidelines of the European Community.

Cells

BMSC were obtained from C57BL/10 mice (H2b haplotype). Mice were killed, and bone marrow cells were collected by flushing nucleate cells out of the femurs and tibiae with cold PBS. Cells were cultured (2×106 nucleated cells/10-cm petri dish) in Coon's modified Ham's F12 medium (Biochrom AG, Berlin, Germany) supplemented with 10% fetal calf serum (GIBCO, S. Giuliano Milanese, MI, Italy), 1% glutamine, 1% penicillin-streptomycin (standard medium). No cytokines were added at any stage. Cultures were incubated at 37°C in a 5% CO2 atmosphere. After 3 days, nonadherent cells were removed. When 80% confluent, the adherent cells were trypsinized (0.05% trypsin/EDTA at 37°C for 15 min) and expanded (P1 stage).

Cells from the same initial bone marrow sample were cultured at an initial plating density of 1×106 nucleated cells per dish to evaluate their CFU-f (CFU-fibroblast) as a quality control. After 2 weeks of culture, plates were washed with PBS, fixed with 3.7% paraformaldehyde, stained with 1% methylene blue, and colonies were counted.

As an additional quality control, we tested BMSC cultures for their ability to undergo differentiation into chondrocytes, osteocytes, and adipocytes. Cells were trypsinized, harvested and plated at 5×104 cells per well in 24-wells plates in standard medium. Medium was replaced 24 h after plating. Chondrogenic differentiation was induced in some of the cells of the initial culture by ascorbic acid (50 μg/ml) and TGFβ1 (1 ng/ml) in standard medium. After 1 week, plates were washed with PBS, fixed with 3.7% paraformaldehyde, and stained with 0.05% alcian blue. Osteogenic differentiation was induced in other cells of the initial culture by adding ascorbic acid (50 μg/ml), sodium β-glycerophosphate (10 mM), and dexamethasone (10–8 M) in standard medium. After 2 weeks, plates were washed with PBS, fixed with 3.7% paraformaldehyde, and stained with 1% alizarin red. Adipogenic differentiation was induced in a third aliquot of cells of the initial culture by the addition of dexamethasone (10–7 M) and insulin (6 ng/ml), in F12 medium supplemented with 1% fetal calf serum, 1% glutamine, 1% penicillin-streptomycin, to the cell culture. After 3 weeks, plates were washed with PBS, fixed with 3.7% paraformaldehyde, and stained with Sudan black.

Spleens from C57BL/10 (H2b haplotype) and BALB/c mice (H2d haplotype) were collected, and spleen cells were obtained by mechanical shredding and collected in RPMI 1640 medium (Sigma, Milano, Italy) supplemented with 2-ME, glutamine, nonessential amino acids, sodium pyruvate, antibiotics (Sigma) and 1% normal mouse serum. T and B lymphocytes were separated from spleen cells using a Pan T Cell Isolation Kit and a B Cell Isolation Kit (Miltenyi Biotec, Bergisch Gladbach, Germany).

Immunophenotype of BMSC

We determined the immunophenotype of BMSC by cytofluorometry using monoclonal antibodies to CD13, CD28, CD34, CD80, CD86, CD90.2, CD106, CD152, CD95, CD178, H2-Kb, H2-Kd, H2-IAb, H2-IEd (clone R3-242, 37.51, RAM34, 1G10, GL1, 30-H12, 429, UC10-4F10-11, Jo2, MFL4, AF6-88.5, SF1-1.1, AF6-120.1, 14-4-4S, respectively) (BD PharMingen, MI, Italy), and to PD-1, PD-L1, PD-L2 (clone J43, MIH5 and TY25, respectively) (eBioscience, San Diego, CA).

mRNA expression of cytokines and inhibitory molecules

We isolated total RNA using RNeasy Mini kit (Qiagen, Milano, Italy). RNA was treated with DNase (RNase-free DNase set, Qiagen, Milano, Italy) to avoid contamination of genomic DNA. A Superscript II First Strand Synthesis System (Invitrogen, S. Giuliano Milanese, MI, Italy) was used to synthesize cDNA.

RT-PCR and Real Time PCR was performed using specific primers and probes (Table 1). We measured gene expression levels as a ratio between expression values and internal GAPDH, and calculated the averaged gene:internal GAPDH ratio and SD for triplicate wells of each sample. Statistical significance of differences between observed values was evaluated using a two-tail t-test.

Table 1. Sequences of primers and probes used for RT-PCR or real-time PCRa)
GeneForward Primer (5′–3′)Reverse Primer (5′–3′)Probe (5′–3′)
  1. a) Probes for real-time PCR were 6-FAM-labeled. The probe for the reporter gene was VIC-labeled.

PD-1TTCACCTGCAGCTTGTCCAATGGGCAGCTGTATGATCTGG
PD-L1AAAGTCAATGCCCCATACCGTTCTCTTCCCACTCACGGGT
PD-L2TGAGGAGCTGTGCTGGGTGCACACTGCTGCCGACGTCTA
IL-1βGTGGCTGTGGAGAAGCTGTGCGTCATCATCCCACGAGTCACCAGCTACCTATGTCTTGCCCGTGGAGC
IL-10AGCATTTGAATTCCCTGGGTGGAGAAATCGATGACAGCGCCTGAAGACCCTCAGGATGCGGCTGA
IL-10RαATCCTGGACCTGGAGGCCTGCTGCCATGCAGGTCTGAGTCCCAAAGGTGTCACCCGAGCTGA
IL-12Rβ1TCGCGTCTCTGGGAAGCTTGCAGAGGTGGGCACAAGTGCCAGCGTCCTCCTCGTGGGC
OPNGTCTCAGCCCAGTTGCAGCGGCACAGGTGATGCCTAGGATGCCCAGCTTCTGAGCATGCCC
SDF-1AGCACAACAGCCCAAAGGACCTTGCATCTCCCACGGATGTTCCAGTAGACCCCCGAGGAAGGC
STAT5aGGCGAGTTTGACCTGGATGAGCCGGCGTAAAAGTTCTTCCAGCATGGATGTTGCCAGGCACG
STAT5bCTCGTGTTCCTGGCACAGAAAGGACACGGACATGCTGTTGTTCAACATCAGCAGCAACCACCTCGAG
TGFβ1CCTGCAAGACCATCGACATGACAGGATCTGGCCACGGATCTGGTGAAACGGAAGCGCATCGAA
TGFβ1R2GAGACTTTGACCGAGTGCTGGCTGAAGCGCTCTGCCACACCCGAAGCCCGTCTCACAGCACAGT

Proliferation and blocking assays

Proliferation of splenocytes to stimulation was tested by adding 0.2 μM of the mitogenic stimulus PHA (Sigma) to 5×105 γ-irradiated allogeneic splenocytes or BMSC, in presence or absence of γ-irradiated allogeneic BMSC. We plated 5×105 responder cells per well in a round-bottom 96-well plate (Corning BW Lifescience, Pero, MI, Italy). We also tested proliferation of T and B lymphocytes separately, using 0.2 μM PHA (Sigma) for T cells, and PWM (Sigma) for B cells, in presence or absence of γ-irradiated allogeneic BMSC. Again, 5×105 responder cells were plated per well in a round-bottom 96-well plate (Corning BW Lifescience). The optimal responder cells:BMSC ratio was calculated as 1:1.

Blocking experiments were performed by adding anti-PD-1, anti-PD-L1, or anti-PD-L2 monoclonal antibodies (clone J43, MIH5 and TY25, respectively) (eBioscience) at a concentration of 0.50, 0.25, 0.125, or 0.0625 μg/well to the cultures. Armenian hamster IgG antibodies (0.50 μg/well, eBioscience) were used as an isotype control. Cultures were incubated for 60 h and pulsed with [3H]thymidine (1.0 µCi/well) (Amersham Biosciences, Cologno Monzese, MI, Italy) for the last 18 h. Cells were harvested and cell proliferation evaluated by counting thymidine uptake. The averaged proliferation rate, measured as cpm, and SD were calculated for the triplicate wells of each sample. The statistical significance of differences between observed values was tested by a two-tail t-test.

Splenocytes (10×106/well) were cultured with 40 μg/well PHA, and irradiated allogeneic BMSC were plated at a 1:1 ratio in direct contact with the responder cells or on the transwell membrane (Corning BW Lifescience). After 72 h, splenocytes and BMSC were collected for RNA extraction.

  • 1

    WILEY-VCH

  • 2

    WILEY-VCH

  • 3

    WILEY-VCH

  • 4

    WILEY-VCH

  • 5

    WILEY-VCH

  • 6

    WILEY-VCH

  • 7

    WILEY-VCH

  • 1
    Caplan, A., Mesenchymal stem cells. J. Orthop. Res. 1991. 9: 641650.
  • 2
    Bianco, P., Riminucci, M., Gronthos, S. and Robey, P., Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells 2001. 19: 180192.
  • 3
    Caplan, A., In vivo remodeling. Ann. N. Y. Acad. Sci. 2002. 961: 307308.
  • 4
    Quarto, R., Mastrogiacomo, M., Cancedda, R., Kutepov, S., Mukhachev, V., Lavroukov, A., Kon, E. and Marcacci, M., Repair of large bone defects with the use of autologous bone marrow stromal cells. N. Engl. J. Med. 2001. 344: 385386.
  • 5
    Horwitz, E., Prockop, D., Fitzpatrick, L., Koo, W., Gordon, P., Neel, M., Sussman, M., Orchard, P., Marx, J., Pyeritz, R. and Brenner, M., Transplantability and therapeutic effects of bone marrow-derived mesenchymal cells in children with osteogenesis imperfecta. Nat. Med. 1999. 5: 309313.
  • 6
    Ishida, T., Inaba, M., Hisha, H., Sugiura, K., Adachi, Y., Nagata, N., Ogawa, R., Good, R. and Ikehara, S., Requirement of donor-derived stromal cells in the bone marrow for successful allogeneic bone marrow transplantation. Complete prevention of recurrence of autoimmune diseases in MRL/MP-Ipr/Ipr mice by transplantation of bone marrow plus bones (stromal cells) from the same donor. J. Immunol. 1994. 152: 31193127.
  • 7
    Ikehara, S., Successful allogeneic bone marrow transplantation. Crucial roles of stromal cells in prevention of graft rejection. Acta Haematol 2001. 105: 172178.
  • 8
    Maitra, B., Szekely, E., Gjini, K., Laughlin, M., Dennis, J., Haynesworth, S. and Koç1, O., Human mesenchymal stem cells support unrelated donor hematopoietic stem cells and suppress T cell activation. Bone Marrow Transplant. 2004. 33: 597604.
  • 9
    Le Blanc, K., Rasmusson, I., Sundberg, B., Gotherstrom, C., Hassan, M., Uzunel, M. and Ringden, O., Treatment of severe acute graft-versus-host disease with third party haploidentical mesenchymal stem cells. Lancet 2004. 363: 14391441.
  • 10
    Di Nicola, M., Carlo-Stella, C., Magni, M., Milanesi, M., Longoni, P., Matteucci, P., Grisanti, S. and Gianni, A., Human bone marrow stromal cells suppress T-lymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli. Blood 2002. 99: 38383843.
  • 11
    Krampera, M., Glennie, S., Dyson, J., Scott, D., Laylor, R., Simpson, E. and Dazzi, F., Bone marrow mesenchymal stem cells inhibit the response of naive and memory antigen-specific T cells to their cognate peptide. Blood 2003. 101: 37223729.
  • 12
    Potian, J., Aviv, H., Ponzio, N., Harrison, J. and Rameshwar, P., Veto-like activity of mesenchymal stem cells: functional discrimination between cellular responses to alloantigens and recall antigens. J. Immunol. 2003. 171: 34263434.
  • 13
    Ozkaynak, E., Wang, L., Goodearl, A., McDonald, K., Qin, S., O'Keefe, T., Duong, T., Smith, T., Gutierrez-Ramos, J., Rottman, J. et al., Programmed death-1 targeting can promote allograft survival. J. Immunol. 2002. 169: 65466553.
  • 14
    Yamazaki, T., Akiba, H., Iwai, H., Matsuda, H., Aoki, M., Tanno, Y., Shin, T., Tsuchiya, H., Pardoll, D., Okumura, K. et al., Expression of programmed death 1 ligands by murine T cells and APC. J. Immunol. 2002. 169: 55385545.
  • 15
    Gao, W., Demirci, G., Strom, T. and Li, X., Stimulating PD-1 negative signals concurrent with blocking CD154 co-stimulation induces long-term islet allograft survival. Transplantation 2003. 76: 994999.
  • 16
    Freeman, G., Long, A., Iwai, Y., Bourque, K., Chernova, T., Nishimura, H., Fitz, L., Malenkovich, N., Okazaki, T., Byrne, M. et al., Engagement of the PD-1 immunoinhibitory receptor by a novel B7 family member leads to negative regulation of lymphocyte activation. J. Exp. Med. 2000. 192: 10271034.
  • 17
    Latchman, Y., Wood, C., Chernova, T., Chaudhary, D., Borde, M., Chernova, I., Iwai, Y., Long, A., Brown, J., Nunes, R. et al., PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat. Immunol. 2001. 2: 261268.
  • 18
    Khaled, A. and Durum, S., Lymphocide: cytokines and the control of lymphoid homeostasis. Nat. Rev. Immunol. 2002. 2: 817830.
  • 19
    McKarns, S., Schwartz, R. and Kaminski, N., Smad3 is essential for TGF-beta1 to suppress IL-2 production and TCR-induced proliferation, but not IL-2-induced proliferation. J. Immunol. 2004. 172: 42754284.
  • 20
    Groux, H. and Cottrez, F., The complex role of interleukin-10 in autoimmunity. J. Autoimmun. 2003. 20: 281285.
  • 21
    Cooke, K. and Ferrara, J., A protective gene for graft-versus-host disease. N. Engl. J. Med. 2003. 349: 21832184.
  • 22
    Kuznetsov, S., Mankani, M., Gronthos, S., Satomura, K., Bianco, P. and Robey, P., Circulating skeletal stem cells. J. Cell Biol 2001. 153: 11331139.
  • 23
    Jiang, Y., Jahagirdar, B., Reinhardt, R., Schwartz, R., Keenek, C., Ortiz-Gonzalezk, X., Reyes, M., Lenvik, T., Lund, T., Blackstad, M. et al., Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 2002. 418: 4149.
  • 24
    Peister, A., Mellad, J., Larson, B., Hall, B., Gibson, L. and Prockop, D., Adult stem cells from bone marrow (MSCs) isolated from different strains of inbred mice vary in surface epitopes, rates of proliferation, and differentiation potential. Blood 2004. 103: 16621668.
  • 25
    Probst, H., McCoy, K., Okazaki, T., Honjo, T. and van den Broek, M., Resting dendritic cells induce peripheral CD8(+) T cell tolerance through PD-1 and CTLA-4. Nat. Immunol. 2005. 6: 280286.
  • 26
    Rodig, N., Ryan, T., Allen, J., Pang, H., Grabie, N., Chernova, T., Greenfield, E., Liang, S., Sharpe, A., Lichtman, A. and Freeman, G., Endothelial expression of PD-L1 and PD-L2 down-regulates CD8+ T cell activation and cytolysis. Eur. J. Immunol. 2003. 33: 31173126.
  • 27
    Hori, J., Ng, T., Shatos, M., Klassen, H., Streilein, J. and Young, M., Neural progenitor cells lack immunogenicity and resist destruction as allografts. Stem Cells 2003. 21: 405416.
  • 28
    Nelson, B., Martyak, T., Thompson, L., Moon, J. and Wang, T., Uncoupling of promitogenic and antiapoptotic functions of IL-2 by Smad-dependent TGF-beta signaling. J. Immunol. 2003. 170: 55635570.
  • 29
    Kelly, J., Spolski, R., Imada, K., Bollenbacher, J., Lee, S. and Leonard, W., A role for Stat5 in CD8+ T cell homeostasis. J. Immunol. 2003. 170: 210217.
  • 30
    Levings, M., Sangregorio, R., Sartirana, C., Moschin, A., Battaglia, M., Orban, P. and Roncarolo, M., Human CD25+CD4+ T suppressor cell clones produce transforming growth factor beta, but not interleukin 10, and are distinct from type 1 T regulatory cells. J. Exp. Med. 2002. 196: 13351346.
  • 31
    Zheng, S., Wang, J., Koss, M., Quismorio, F., Dixon Gray, J. and Horwitz, D., CD4+ and CD8+ regulatory T cells generated ex vivo with IL-2 and TGF-β suppress a stimulatory graft-versus-host disease with a lupus-like syndrome. J. Immunol. 2004. 172: 15311539.
  • 32
    Aramaki, O., Shirasugi, N., Takayama, T., Shimazu, M., Kitajima, M., Ikeda, Y., Azuma, M., Okumura, K., Yagita, H. and Niimi, M., Programmed death-1-programmed death-L1 interaction is essential for induction of regulatory cells by intratracheal delivery of alloantigen. Transplantation 2004. 77: 612.