SEARCH

SEARCH BY CITATION

Keywords:

  • KIR;
  • Evolution;
  • Gene regulation;
  • Human;
  • NK cell

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Killer-cell Ig-like receptors (KIR) are structurally and functionally diverse, and enable human NK cells to survey the expression of individual HLA class I molecules, often altered in infections and tumors. Multiple events of non-reciprocal recombination have contributed to the rapid diversification of KIR. We show that ∼4.5% of the individuals of a Caucasoid population bear a recombinant allele of KIR3DP1, officially designed KIR3DP1*004, that associates tightly with gene duplications of KIR3DP1, KIR2DL4 and KIR3DL1/KIR3DS1. The KIR3DP1 gene is normally silent, but the recombinant allele carries a novel promoter sequence and, as a consequence, is transcribed in all tested individuals. Messenger RNA of KIR3DP1*004 is made up of six exons; of these, exons 1–5 are similar to, and spliced like, those encoding the leader peptide and Ig-domains of KIR3D. By contrast, exon 6 is homologous to no other human KIR sequence, but only to possible homologs in chimpanzees and rhesus macaques, and encodes a short hydrophilic tail. The putative KIR3DP1*004 product, like those of the related genes LAIR-2 and LILRA3/ILT6/LIR4, is predicted to be secreted to the extracellular medium rather than anchored to the cell membrane.

See accompanying Commentary: http://dx.doi.org/10.1002/eji.200425743

Abbreviations:
KIR:

Killer-cell Ig-like receptor

SSOP:

Sequence-specific oligonucleotide probe

SSP:

Sequence-specific primer

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Killer-cell Ig-like receptors (KIR) enable human NK cells to survey the normal expression of self HLA class I molecules by healthy cells 13. KIR are encoded by a family of fifteen genes and two pseudogenes that cluster tightly in ∼150 kbp of the chromosome region 19q13.4 46. The organization of the KIR-gene cluster varies extensively in different individuals 57. Furthermore, it contains only three well-conserved or “framework” regions: both ends of the cluster (constituted by the KIR3DL3 and KIR3DL2 genes), and the central group of genes – KIR3DP1, KIR2DL4 and KIR3DL/S1 (i.e., KIR3DL1 or KIR3DS1, usually inherited as alleles of the same locus). Each of the other genes is found in only a variable proportion of humans 8, 9.

One of the five conserved genes, KIR3DP1 (also known as CD158c 10, KIR48 11, KIRX 5 or KIR2DS6 6), is truncated in comparison with all other KIR – it has regions homologous to exons 1–5 of KIR3D, which code for their leader peptides and extracellular Ig-domains, but lacks the downstream exons that encode the stalk, transmembrane and cytoplasmic regions. Two KIR3DP1 alleles (KIR3DP1*001 and *002) contain no further structural abnormalities, whereas another two (*00301 and *00302) have a deletion of ∼1.5 kbp that affects exon 2 and the flanking introns. The putative reading frame of KIR3DP1 is otherwise similar to those of KIR3D genes and contains no non-sense mutations. Nonetheless, KIR3DP1 is currently considered a silent gene or pseudogene 4 because its RNA is normally undetectable in PBMC – possibly related to its promoter being identical to those of non-transcribed KIR2DL5B alleles 12, 13. In this study, we present an analysis of KIR3DP1 in individuals that bear a duplication of the KIR3DP1KIR2DL4KIR3DL/S1 gene cluster. The results of our analysis challenge the current view of KIR3DP1, since we found it to be a functional gene in a significant minority of humans.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

The gene duplications of KIR2DL4 and KIR3DL/S1 are related to a recombination affecting KIR3DP1

KIR typing by a PCR sequence-specific oligonucleotide probe (PCR-SSOP) method has previously shown the presence of three KIR2DL4 and three KIR3DL/S1 alleles in certain individuals, which suggests they carry a KIR2DL4KIR3DL/S1 duplication in one of their chromosomes 14. Those individuals have diverse KIR types (Fig. 1), but common to most of them is the contrast between presence of KIR3DS1 and lack of the genes usually found downstream of it – KIR2DL5A, KIR2DS5 and KIR2DS15. We speculated that this genotype and the gene duplications could have a common origin.

thumbnail image

Figure 1. A new form of KIR3DP1 associates tightly with KIR haplotypes carrying duplications of KIR3DP1, KIR2DL4 and KIR3DL/S1. The presence or absence of each KIR gene is represented by black boxes and white spaces, respectively. Alleles of the KIR2DL5, KIR3DP1, KIR2DL4, KIR3DL/S1, KIR2DS4, and KIR3DL2 genes are shown inside the corresponding box. (A) Samples derived from unrelated donors. (B) Analysis of the inheritance of KIR genes and alleles in the relatives of two donors. The deduced parental haplotypes are shown below the KIR types of each family. Gene duplications in haplotypes containing the recombinant KIR3DP1 are boxed; genes whose inheritance could not be demonstrated by analysis of family segregation or genomic cloning are shown in parentheses.

Download figure to PowerPoint

To shed light on the gene arrangements creating this unusual genotype, we investigated which gene was located downstream of KIR3DS1 in one donor harboring the KIR2DL4KIR3DL/S1 duplication – MIS5005. Using a KIR-gene walking approach 12, we determined that KIR3DS1 was indeed followed by a chimeric KIR gene, of which the 5′-end (promoter region, exon 1 and intron 1) derives from KIR2DL5A – the gene usually found in that location – and the 3′-end corresponds to KIR3DP1*001 (Fig. 2). The limit between the regions derived from each of KIR2DL5 and KIR3DP1 can not be defined precisely, due to the sequence similarity of these genes in exon 2 and the adjacent intronic sequences.

thumbnail image

Figure 2. The KIR3DP1 chimera, and the associated gene duplications of KIR3DP1, KIR2DL4, and KIR3DL/S1, were possibly generated by recombination with KIR2DL5A. Each of the putative original chromosomes is displayed in a different way (black lettering on a white background or vice versa), which is then used to mark the origin of each region in the recombinant haplotypes and genes. Solid lines are used in the boxes representing framework genes, and dotted lines in those corresponding to variable genes. Haplotypes lacking KIR3DP1, KIR2DL4 and KIR3DL/S1, and a recombinant KIR2DL5 gene resembling those depicted here have been observed by us and others (see Discussion), and might be the counterparts of the gene duplications and recombinant KIR3DP1 reported in this manuscript.

Download figure to PowerPoint

The KIR2DL5A/KIR3DP1 chimera and gene duplications of cell MIS5005 were probably generated by an unequal crossing-over, similar to that reported in one family by Martin et al. during the course of our study 15. The gene arrangement resulting from this recombination (Fig. 2) explains not only the KIR2DL4KIR3DL/S1 duplication, but also the lack of association of KIR3DS1 with KIR2DL5A, KIR2DS5 and KIR2DS1 in MIS5005, since all those genes, normally telomeric to KIR3DS1, would have been replaced by the KIR2DL5A/KIR3DP1 chimera and an “A”-type haplotype 8, which contains KIR3DL1 and KIR2DS4 instead (Fig. 2).

The recombinant KIR3DP1 associates tightly with gene duplications affecting KIR3DP1KIR2DL4KIR3DL/S1 in different haplotypes

We next studied the distribution of the recombinant KIR3DP1 and the extent of its association with the KIR3DP1KIR2DL4KIR3DL/S1 duplication. To this end, we set up a subtyping method based on two PCR sequence-specific primer (PCR-SSP) reactions that target a single-nucleotide polymorphism of the KIR3DP1 promoter: one specific for the new KIR3DP1, one for other alleles (Fig. 3). Using this method, we found the chimeric KIR3DP1 in nine of ten additional cells in which allele typing had shown the KIR2DL4KIR3DL/S1 duplication, including the 10th Histocompatibility Workshop cell line E4181324 (Fig. 1). All nine cell lines carrying the KIR3DP1 recombination share with MIS5005 the unusual genotype KIR3DS1+, KIR2DL5AKIR2DS5KIR2DS1 (Fig. 1). In contrast, a single cell line (CO126) lacks the recombination and also differs in its KIR genotype (KIR2DL5AKIR2DS5+), indicating that its gene duplications were caused by an unrelated event.

thumbnail image

Figure 3. Subtyping of functional and silent variants of KIR3DP1. Two PCR-SSP mixes enable specific detection of the new KIR3DP1*004 (upper gel) and differentiation from other KIR3DP1 alleles (lower gel). KIR3DP1*003 is discriminated from other alleles by its shorter amplicon (owing to its exon-2 deletion). KIR genotype of cell C163: 2DL2, 2DL45, 3DL13, 2DS14, 2DP1, 3DP1*001/002; genotype of cell PP: 2DL1, 2DL3–4, 3DL1–3, 2DS4, 2DP1, 3DP1*0038, 38; see Fig. 1 for genotype of cell MIS5005.

Download figure to PowerPoint

An additional collection of 89 DNA samples, isolated from unrelated Spanish Caucasoid donors, was screened using the same method. Four donors were positive, indicating that the recombinant KIR3DP1 has a frequency in the population of ∼4.49% (1.24–11.11%, p<0.05). Duplications of KIR3DP1, KIR2DL4 and/or KIR3DL/S1 were then demonstrated in three of those samples (C150, LP237 and H318H1), either by detection of three alleles through genotyping, or by analysis of inheritance in available family members (Fig. 1). In one case (family H305), allelic typing showed evidence of the duplication of KIR3DP1, but not those of KIR2DL4 and KIR3DL/S1. This is possibly due to presence of two copies of the KIR2DL4*005 and KIR3DS1*013 alleles. Indeed, KIR-gene walking in donor H305M demonstrated the existence of two copies of KIR3DS1 – one followed by the recombinant KIR3DP1 and one by KIR2DL5A. This explains the presence of KIR2DL5A and KIR2DS1, and the absence of KIR3DL1 and KIR2DS4, in the same haplotype (Fig. 1). An additional implication is that detection of the recombinant haplotype and the gene duplications based solely on identification of three alleles at a given locus would lead to underestimation of their frequency, as previously pointed out 14.

Analysis of the KIR types of cells carrying the chimeric KIR3DP1 shows, in addition to the aforementioned features, that all but one share the alleles KIR2DL4*00102 and *005, the exception being H305M, as previously discussed. The inheritance of those KIR2DL4 alleles with the recombinant haplotype was demonstrated in family H318. In contrast, the fourteen cell lines vary greatly both in their gene content at the centromeric half of KIR cluster (KIR2DL1L3, KIR2DS2S3), and in the alleles encoded at loci telomeric to the recombination – KIR3DL1, KIR2DS4 and KIR3DL2. This diversity indicates either that the original haplotype containing the KIR3DP1KIR2DL4KIR3DL/S1 duplication has undergone further recombinations, or that multiple unequal crossing-over events with similar outcomes have taken place during human evolution.

The new KIR3DP1*004, unlike other alleles, is transcribed, and could encode a secreted protein with three Ig-like domains

Messenger RNA of previously described forms of KIR3DP1 is normally undetectable in PBMC 11, possibly related to their promoters being identical to those of the silent alleles of the KIR2DL5B gene 12, 13. On the contrary, the recombinant KIR3DP1 is preceded by a different promoter sequence that is functional in the KIR2DL5A gene 12. This led us to hypothesize that, unlike other alleles, the novel KIR3DP1 could be transcribed. To test this hypothesis, we performed KIR3DP1-specific RT-PCR assays using RNA of PBMC isolated from donors with different genotypes. As it can be seen in Fig. 4, no amplification was obtained from donors having only common alleles of KIR3DP1. By contrast, amplicons of ∼1.0 kbp and ∼0.7 kbp were produced from the cDNA of donors carrying the recombinant KIR3DP1. Sequence analysis confirmed that both amplicon species derive from KIR3DP1 – the larger product, from mRNA containing all of exons 1–5; the smaller amplicon, from transcripts in which exon 3, coding for the D0 Ig-like domain, has been spliced out of the RNA.

thumbnail image

Figure 4. The novel allele KIR3DP1*004 is transcribed in different donors, whereas others are not. RT-PCR experiments with primers specific for either the KIR3DP1 or the beta-2 microglobulin genes (as a positive control) were performed on RNA isolated from PBMC of donors carrying different alleles of KIR3DP1. The stronger ∼1.0-kbp band corresponds to cDNA containing exons 1–5 of KIR3DP1, whereas the weaker amplicon of ∼0.7 kbp (labeled as Δ exon 3) derives from an alternatively spliced RNA of KIR3DP1 lacking exon 3. KIR genotype of cell C167: 2DL1, 2DL34, 3DL13, 2DS4, 2DP1, 3DP1*003; see Fig. 1 for other cells.

Download figure to PowerPoint

Amplification products obtained from cDNA of donor H305M by both regular RT-PCR and 3′-RACE were subjected to molecular cloning and sequence analysis. A consensus sequence of 1294 bp was derived from several clones and it corresponded to full-length cDNA of a new KIR3DP1 variant, which was officially assigned the name KIR3DP1*004. The cDNA of KIR3DP1*004 contains an open reading frame of 987 bp that codes for a polypeptide of 328 amino acids. Residues 1–316 are encoded by exons 1–5; these are homologous to the corresponding exons of other KIR3D and, like them, are correctly spliced to each other and contain no abnormalities in the reading frame.

Exon 5 was previously believed to be the last exon of KIR3DP1; therefore, it might have been followed by the adjacent intronic sequence in mRNA of the transcribed KIR3DP1*004 variant. On the contrary, we found it to be unexpectedly spliced to a sixth exon that contains 12 coding triplets, a stop codon, and a 3′-untranslated region of 306 nucleotides. Exon 6 of KIR3DP1*004 is homologous to no other KIR sequence and derives from the region, located between KIR3DP1 and KIR2DL4, that was previously considered to be intergenic (Fig. 5). In three human KIR haplotypes carrying different KIR3DP1 alleles (5, 6 and accession number AY320039), exon 6 shows the following features: it contains no sequence polymorphisms in comparison with KIR3DP1*004; it is separated from exon 5 by a similarly conserved intron of 7.62 kbp; it is preceded by a canonical acceptor splice site; and it includes a polyadenylation signal (not shown). An additional implication of our finding is that the intergenic region that separates KIR3DP1 from KIR2DL4 is shorter than previously believed (∼5 kbp vs. ∼14 kbp) and more comparable in length to the distance between other KIR genes (less than 3 kbp) 5.

thumbnail image

Figure 5. Organization of the KIR3DP1 gene in comparison with that of a canonical KIR gene (KIR3DL1). Exon and intron lengths are depicted approximately to scale. The hatched box in the mRNA and the putative polypeptide of KIR3DP1*004 highlights the codons and amino acids derived from its non-homologous exon 6 (labeled as 6b in a black box to avoid confusion with the stem-encoding exon 6 of KIR3DL1). Boxes corresponding to the exons of KIR3DP1*001*003 alleles are represented with dotted lines to indicate their lack of transcription.

Download figure to PowerPoint

The product of KIR3DP1*004 is thus predicted to have D0, D1 and D2 Ig-like domains, but these would be followed by a tail of 12 amino acids, instead of the stem, transmembrane and cytoplasmic regions seen in other KIR (Fig. 6). The short KIR3DP1*004 tail contains a high proportion of charged amino acids (DSMKEKGKDVIL). These features, and the lack of a site for glycosylphosphatidylinositol-modification 16, preclude the direct anchoring of KIR3DP1 to the cell membrane. Furthermore, although several lysine residues are found close to the C terminus, they do not constitute a clear consensus motif for retention in the endoplasmic reticulum 17. Therefore, the KIR3DP1*004 product could be secreted as a soluble receptor to the extracellular medium (Fig. 5), as it was previously suggested 13 and is predicted with a 66.7% probability by the k-nearest neighbor algorithm of the PSORT II program 18, 19.

thumbnail image

Figure 6. Fig. 6. KIR3DP1 is more closely related to certain KIR genes of the common chimpanzee than to human KIR. The deduced amino acid sequence of KIR3DP1*004 was aligned with those of representative KIR genes of human and primates. Virtual translations of KIR2D pseudoexons 20 are shown in italics. Patr-BX842589 and Mamu-BX842591 stand for unnamed KIR genes of chimpanzees (Pan troglodytes – Patr) and rhesus macaques (Macaca mulatta – Mamu) located between nucleotides 84734–98085 and 36298–48579, respectively, of genomic sequences deposited in the GenBank under those accession numbers. White lettering on a black background highlights the unique tail of KIR3DP1*004, the residues proposed to be critical for proper folding/transport of KIR3DL1 27, and the cysteines implicated in Ig-domain disulfide bonds. Regions homologous to the ligand-contacting loops in KIR2DL1–Cw4 and KIR2DL2–Cw3 complexes 43, 44 are underlined. Asterisks stand for stop codons or unavailable sequence. Exon boundaries are indicated by arrowheads. To allow for better comparison, a 7-bp insertion in exon 4 of Patr-BX842589 and a 1-bp deletion in exon 5 of Mamu-BX842591 were corrected to maintain their reading frames.

Download figure to PowerPoint

The intricate phylogeny of KIR3DP1

KIR3DP1 has intricate phylogenetic relationships. The exons encoding the Ig-like domains are most closely related to certain KIR3D of chimpanzees and, more distantly, to human KIR2D containing pseudoexon 3 20, all of which belong to what has been called lineage III of KIR genes, recombinant in nature itself 3, 21, 22. On the other hand, the two alternative sequences found at the 5′ end of the gene (one in alleles KIR3DP1*001*003, one in *004) match perfectly those seen in KIR2DL5B and KIR2DL5A12, respectively; these are genes of a different descent that constitute, with KIR2DL4, the KIR-gene lineage I 3, 22. This supports the idea that KIR2DL5 and KIR3DP1 might have interchanged genetic material in recent evolutionary times, as previously pointed out 15.

Furthermore, exon 6 of KIR3DP1 has no significant homology to any other human KIR sequence, since it is located within one of the few non-repetitive areas of the KIR-gene cluster 5, 6. In contrast, this exon and the preceding intron are well conserved in one available KIR-haplotype of the common chimpanzee (GenBank BX842589, 98% identity/29 gaps in a 7988-bp overlap) and, at a lesser extent, in one of the rhesus macaque (BX842591, 90% average identity). Interestingly, those regions are also preceded in both species by KIR genes that are truncated after exon 5 (Fig. 6), besides other aberrations in their reading frames. The conservation of this arrangement is striking in the context of the rapid evolution of KIR genes and might reflect not only an evolutionary relationship, but also perhaps conservation in some humans of an ancestral function that is lost in those primates.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

KIR3DP1 was first identified during studies on the genomic organization of KIR 5, 6, 11. It was then agreed to be a pseudogene 4 because of differential features of its function and structure (namely, undetectability of its mRNA with methods used for other KIR genes and lack of certain exons). It was nonetheless remarkable at that time that, being possibly a pseudogene, KIR3DP1 has an intact reading frame and consensus sites for RNA splicing 11. Now we have shown that, at least in a significant part of a Caucasoid population, KIR3DP1 is a functional gene that is transcribed normally. Furthermore, mRNA of KIR3DP1 should not undergo the non-sense-mediated decay (NMD) process that degrades RNA of genes containing premature stop codons. Indeed, the reading frame of KIR3DP1 ends in its very last exon, whilst mRNA degradation is generally triggered by the occurrence of a termination codon more than 50–54 bp upstream of an exon–exon junction 23, 24. This distinguishes KIR3DP1*004 from a common allele of KIR2DS4 that might also encode a soluble protein 25, 26, but is expressed at low levels (reference 26 and our own unpublished observation) – possibly due to NMD, since the latter allele contains a premature stop codon 78 bp upstream of its penultimate splice junction.

KIR genes display different levels of complexity and diversity. One extreme aspect of KIR diversity is the fact that many individuals constitute natural “knock-outs” for several of those genes, due to the physical absence of the gene, a lack of transcription, or a failure in exportation of the protein to the cell membrane 3, 2729. Our finding of a functional allele of a KIR gene that appears to be silent in the majority of the population contributes in a qualitatively distinct manner to the structural and genetic diversity of KIR since it is the mirror image of those genes whose function is abolished in certain individuals.

Unequal crossing-over in the KIR-gene cluster can give rise not only to gene duplications 3, 30, but also to gene loss, as previously pointed out 15. Of possible relevance in this regard is the recent description by us and others of rare KIR haplotypes lacking precisely the otherwise conserved genes that are duplicated in the donors studied herein 31, 32. Moreover, one of those haplotypes contains a recombinant form of KIR2DL5, which looks like the counterpart of KIR3DP1*004 (N. Gómez-Lozano and R. de Pablo, unpublished data). It is thus possible that both types of haplotype are the reciprocal results of the same type of recombination (Fig. 2).

KIR3DP1 is predicted to encode a protein that would retain many features of other KIR, including residues that are critical for proper folding and transport, and many of those implicated in the KIR2D–HLA-C interaction (Fig. 6). The essential exception is its apparent inability to function as a membrane receptor. Instead, the putative KIR3DP1 product might be secreted to the extracellular medium, a possibly unique attribute among KIR molecules. Our finding further assimilates these to their closest relatives in humans, the LAIR (leukocyte-associated Ig-like receptor) and LILR (leukocyte Ig-like receptor) families of receptors, since each family now includes at least one putatively secreted member – KIR3DP1, LAIR-2 and LILRA3 (also known as CD85e, ILT6 or LIR-4), respectively 3336. Such secreted receptors might have a paracrine effect on cells expressing their ligands, or compete with the function of membrane receptors having an overlapping set of ligands, as has been speculated previously 34. However, such and other possible functions have not been investigated in any of those genes due to lack of specific reagents. We will undertake studies aimed at verifying the existence, distribution and possible function of the KIR3DP1 product.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Cells

DNA samples carrying apparent duplications of the KIR2DL4 and KIR3DL/S1 genes have been described elsewhere 14, and they derive mostly from Caucasoid donors of different geographical origins. E4181324 is an EBV-infected cell line established in the 10th International Histocompatibility Workshop from a donor of Caucasoid origin 37. An additional collection of DNA was obtained from 89 Spanish, Caucasoid, voluntary, unrelated donors and from the available relatives of two donors.

Genotyping

KIR-gene assignments were performed using the dual techniques of SSP 38 and SSOP analysis 39. KIR-allele assignments, with respect to KIR2DL4, KIR2DL5, KIR2DS4, KIR3DL/S1, and KIR3DL2 genes, were achieved by either PCR-SSOP or PCR-SSP methods designed for each respective locus 38, 4042. Screening for the presence of the novel allele KIR3DP1*004 and distinction from previously known alleles were done by PCR-SSP in two separate reactions. Using the PCR conditions reported for KIR2DL5 subtyping 38, we combined a reverse oligonucleotide primer specific for KIR3DP1 (LRt369, gtgctgaccacccagtgagGA) with each of the Fg-97a (tacgtcaccctcccgtgatgtg) and Fa-97b (gtacgtcaccctcccatgatgta) forward primers. These recognize a single nucleotide dimorphism located 97-bp upstream of the KIR3DP1 translation start codon – guanidine in the KIR3DP1*004 and adenosine in other KIR3DP1 alleles, respectively. KIR3DP1*003 is distinguished from other alleles by its shorter amplicon; KIR3DP1*001 and *002, which differ by two nucleotide changes (in exons 2 and 5), are indistinguishable with this method; for simplification, cells carrying either of those alleles are referred to as KIR3DP1*001 throughout the paper.

KIR-gene walking

We determined which gene was found downstream of KIR3DS1 in cell MIS5005 by means of a KIR-gene-walking approach that we have used successfully for KIR2DL512. The intergenic region located between KIR3DS1 and such unknown KIR gene was cloned and sequenced after amplification by long-range PCR using the Advantage-2 polymerase mix (BD-Clontech, Palo Alto, CA, USA). To that end, we used a forward primer specific for KIR3DS1 exon 9 (LFta1271, ggaggtgwcatacgcataattggAA – bases in upper-case are bound by exonuclease-resistant phosphorothioate bonds), and a reverse primer (LRcon389 aygatcaccabggggttgctgGG) that recognizes a consensus KIR sequence located at the 3′-end of exon (or pseudoexon) 3. PCR conditions were: 2 min at 95ºC, followed by 5 cycles of 2 s at 94ºC and 10 min at 72ºC; and 25 cycles of 2 s at 94ºC, 15 s at 70ºC and 10 min at 72ºC. Using a similar approach, we showed that one haplotype of cell H305M carries two copies of KIR3DS1, one followed by KIR2DL5A, one by KIR3DP1*004. The sequence of KIR3DP1*001 in the promoter region and exon 1, previously unavailable 11, was determined after amplification of genomic DNA from cell NV with primers LF1450 12 and LRt369.

Isolation of KIR3DP1 cDNA

The expression of KIR3DP1 was studied by RT-PCR in PBMC of donors carrying different alleles of the gene. Total RNA was isolated with Trireagent (MRC, Cincinnati, OH, USA). Complementary DNA was synthesized with the First-strand cDNA Synthesis Kit and an oligo-dT primer (Amersham Biosciences, Buckinghamshire, UK), and submitted to PCR with primers LFcon63 11 and LRt984 (tgacagaaacaagcagtgggtcactAA) in the following conditions: initial denaturation at 96ºC, 2 min, then 10 cycles of 5 s at 94ºC, 10 s at 70ºC and 3 min at 72ºC; and 25 cycles of 5 s at 94ºC, 10 s at 68ºC and 3 min at 72ºC. As a positive control of RT-PCR, the cDNA of each donor was amplified separately with primers recognizing the untranslated regions of the human beta-2 microglobulin gene (b2m5, sense, atgtctcgctccgtggc; and b2m3, antisense, tgcttacatgtctcgatc).

A PCR product derived from cell H305M as described above (except for substitution of Advantage-2 for Taq polymerase) was cloned, and a consensus cDNA sequence was established. Three-prime RACE experiments were then performed as previously described 11, using a forward primer specific for KIR3DP1 (LFg302, tacaacagagtattccgaaacacCG), and the PCR product was also submitted to cloning and sequence analysis. PCR conditions were: 94ºC 2 min, 10 cycles of 20 s at 94ºC, 30 s at 68ºC, 2 min at 72ºC; and 30 cycles of 20 s at 94ºC, 30 s at 66ºC, 2 min at 72ºC.

Cloning and sequence analysis

PCR products were cloned into pCR2.1-TOPO vector (Invitrogen, Paisley, UK). Plasmids were isolated from individual bacterial clones using either Qiaprep Spin (Qiagen, Hilden, Germany) or GFX Micro (Amersham Biosciences) miniprep kits, and sequenced using dye-labeled deoxy-terminators and a 3100-Avant automated DNA sequencer (Applied Biosystems, Foster City, CA, USA), or in a core DNA-sequencing facility (Universidad Autónoma de Madrid). Sequence alignments were done with BioEdit (Tom Hall, Ibis Therapeutics, Carlsbad, CA, USA). The PSORT II program (Kenta Nakay, Human Genome Center, IMS, University of Tokyo, Japan, http://psort.nibb.ac.jp) was used to predict the subcellular localization of the putative KIR3DP1*004-encoded polypeptide.

Nomenclature

The name KIR3DP1*004 was officially assigned by the KIR Nomenclature Committee in June 2004. This follows the agreed policy that, subject to the conditions stated in the most recent KIR nomenclature report 4, names will be assigned to new sequences as they are identified. Lists of such new names will be published in the following KIR nomenclature report. The nucleotide sequences presented in this paper have been submitted to the EMBL/GenBank/DDBJ databanks under accession numbers AJ630586 (H305M, KIR3DP1*004, mRNA), AJ639843 (H305M, KIR3DP1*004, promoter region and exon 1), AJ639844 (MIS5005, KIR3DP1*004, exons 1–3 and upstream regions), and AJ639845 (cell NV, KIR3DP1*001, promoter region and exon 1).

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

This work was supported by grant BMC 2001-0265 from the Spanish Ministerio de Ciencia y Tecnología. Natalia Gómez-Lozano was supported, successively, by fellowships from Fundación LAIR and Instituto de Salud Carlos III (CM0300028), Spain. Ernesto Estefanía is supported by a fellowship from Fundación LAIR.

  • 1

    WILEY-VCH

  • 2

    WILEY-VCH

  • 3

    WILEY-VCH

  • 4

    WILEY-VCH

  • 5

    WILEY-VCH

  • 6

    WILEY-VCH

  • 1
    Wagtmann, N., Biassoni, R., Cantoni, C., Verdiani, S., Malnati, M. S., Vitale, M., Bottino, C., Moretta, L., Moretta, A. and Long, E. O., Molecular clones of the p58 NK cell receptor reveal immunoglobulin-related molecules with diversity in both the extra- and intracellular domains. Immunity 1995. 2: 439449.
  • 2
    Colonna, M. and Samaridis, J., Cloning of immunoglobulin-superfamily members associated with HLA-C and HLA-B recognition by human natural killer cells. Science 1995. 268: 405408.
  • 3
    Vilches, C. and Parham, P., KIR: diverse, rapidly evolving receptors of innate and adaptive immunity. Annu. Rev. Immunol. 2002. 20: 217251.
  • 4
    Marsh, S. G., Parham, P., Dupont, B., Geraghty, D. E., Trowsdale, J., Middleton, D., Vilches, C., Carrington, M., Witt, C., Guethlein, L. A. et al., Killer-cell immunoglobulin-like receptor (KIR) nomenclature report, 2002. Tissue Antigens 2003. 62: 7986.
  • 5
    Wilson, M. J., Torkar, M., Haude, A., Milne, S., Jones, T., Sheer, D., Beck, S. and Trowsdale, J., Plasticity in the organization and sequences of human KIR/ILT gene families. Proc. Natl. Acad. Sci. U S A 2000. 97: 47784783.
  • 6
    Martin, A. M., Freitas, E. M., Witt, C. S. and Christiansen, F. T., The genomic organization and evolution of the natural killer immunoglobulin-like receptor (KIR) gene cluster. Immunogenetics 2000. 51: 268280.
  • 7
    Hsu, K. C., Chida, S., Geraghty, D. E. and Dupont, B., The killer cell immunoglobulin-like receptor (KIR) genomic region: gene-order, haplotypes and allelic polymorphism. Immunol. Rev. 2002. 190: 4052.
  • 8
    Uhrberg, M., Valiante, N. M., Shum, B. P., Shilling, H. G., Lienert-Weidenbach, K., Corliss, B., Tyan, D., Lanier, L. L. and Parham, P., Human diversity in killer cell inhibitory receptor genes. Immunity 1997. 7: 753763.
  • 9
    Yawata, M., Yawata, N., Abi-Rached, L. and Parham, P., Variation within the human killer cell immunoglobulin-like receptor (KIR) gene family. Crit. Rev. Immunol. 2002. 22: 463482.
  • 10
    Andre, P., Biassoni, R., Colonna, M., Cosman, D., Lanier, L. L., Long, E. O., Lopez-Botet, M., Moretta, A., Moretta, L., Parham, P. et al., New nomenclature for MHC receptors. Nat. Immunol. 2001. 2: 661.
  • 11
    Vilches, C., Rajalingam, R., Uhrberg, M., Gardiner, C. M., Young, N. T. and Parham, P., KIR2DL5, a novel killer-cell receptor with a D0-D2 configuration of Ig-like domains. J. Immunol. 2000. 164: 57975804.
  • 12
    Vilches, C., Gardiner, C. M. and Parham, P., Gene structure and promoter variation of expressed and non-expressed variants of the KIR2DL5 gene. J. Immunol. 2000. 165: 64166421.
  • 13
    Trowsdale, J., Barten, R., Haude, A., Stewart, C. A., Beck, S. and Wilson, M. J., The genomic context of natural killer receptor extended gene families. Immunol. Rev. 2001. 181: 2038.
  • 14
    Williams, F., Maxwell, L. D., Halfpenny, I. A., Meenagh, A., Sleator, C., Curran, M. D. and Middleton, D., Multiple copies of KIR 3DL/S1 and KIR 2DL4 genes identified in a number of individuals. Hum. Immunol. 2003. 64: 729732.
  • 15
    Martin, M. P., Bashirova, A., Traherne, J., Trowsdale, J. and Carrington, M., Cutting edge: expansion of the KIR locus by unequal crossing over. J. Immunol. 2003. 171: 21922195.
  • 16
    Eisenhaber, B., Bork, P. and Eisenhaber, F., Sequence properties of GPI-anchored proteins near the omega-site: constraints for the polypeptide binding site of the putative transamidase. Protein Eng. 1998. 11: 11551161.
  • 17
    Teasdale, R. D. and Jackson, M. R., Signal-mediated sorting of membrane proteins between the endoplasmic reticulum and the Golgi apparatus. Annu. Rev. Cell Dev. Biol. 1996. 12: 2754.
  • 18
    Nakai, K. and Kanehisa, M., A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics 1992. 14: 897911.
  • 19
    Horton, P. and Nakai, K., Better prediction of protein cellular localization sites with the k nearest neighbors classifier. Proc. Int. Conf. Intell. Syst. Mol. Biol. 1997. 5: 147152.
  • 20
    Vilches, C., Pando, M. J. and Parham, P., Genes encoding human killer-cell Ig-like receptors with D1 and D2 extracellular domains all contain untranslated pseudoexons encoding a third Ig-like domain. Immunogenetics 2000. 51: 639646.
  • 21
    Khakoo, S. I., Rajalingam, R., Shum, B. P., Weidenbach, K., Flodin, L., Muir, D. G., Canavez, F., Cooper, S. L., Valiante, N. M., Lanier, L. L. and Parham, P., Rapid evolution of NK cell receptor systems demonstrated by comparison of chimpanzees and humans. Immunity 2000. 12: 687698.
  • 22
    Rajalingam, R., Parham, P. and Abi-Rached, L., Domain shuffling has been the main mechanism forming new hominoid killer cell Ig-like receptors. J. Immunol. 2004. 172: 356369.
  • 23
    Thermann, R., Neu-Yilik, G., Deters, A., Frede, U., Wehr, K., Hagemeier, C., Hentze, M. W. and Kulozik, A. E., Binary specification of nonsense codons by splicing and cytoplasmic translation. EMBO J. 1998. 17: 34843494.
  • 24
    Zhang, J., Sun, X., Qian, Y., LaDuca, J. P. and Maquat, L. E., At least one intron is required for the nonsense-mediated decay of triosephosphate isomerase mRNA: a possible link between nuclear splicing and cytoplasmic translation. Mol. Cell Biol. 1998. 18: 52725283.
  • 25
    Maxwell, L. D., Wallace, A., Middleton, D. and Curran, M. D., A common KIR2DS4 deletion variant in the human that predicts a soluble KIR molecule analogous to the KIR1D molecule observed in the rhesus monkey. Tissue Antigens 2002. 60: 254258.
  • 26
    Hsu, K. C., Liu, X. R., Selvakumar, A., Mickelson, E., O'Reilly, R. J. and Dupont, B., Killer Ig-like receptor haplotype analysis by gene content: evidence for genomic diversity with a minimum of six basic framework haplotypes, each with multiple subsets. J. Immunol. 2002. 169: 51185129.
  • 27
    Pando, M. J., Gardiner, C. M., Gleimer, M., McQueen, K. L. and Parham, P., The protein made from a common allele of KIR3DL1 (3DL1*004) is poorly expressed at cell surfaces due to substitution at positions 86 in Ig domain 0 and 182 in Ig domain 1. J. Immunol. 2003. 171: 66406649.
  • 28
    Goodridge, J. P., Witt, C. S., Christiansen, F. T. and Warren, H. S., KIR2DL4 (CD158d) genotype influences expression and function in NK cells. J. Immunol. 2003. 171: 17681774.
  • 29
    Kikuchi-Maki, A., Yusa, S., Catina, T. L. and Campbell, K. S., KIR2DL4 is an IL-2-regulated NK cell receptor that exhibits limited expression in humans but triggers strong IFN-gamma production. J. Immunol. 2003. 171: 34153425.
  • 30
    Gómez-Lozano, N., Gardiner, C. M., Parham, P. and Vilches, C., Some human KIR haplotypes contain two KIR2DL5 genes: KIR2DL5A and KIR2DL5B. Immunogenetics 2002. 54: 314319.
  • 31
    Gómez-Lozano, N., de Pablo, R., Puente, S. and Vilches, C., Recognition of HLA-G by the NK cell receptor KIR2DL4 is not essential for human reproduction. Eur. J. Immunol. 2003. 33: 639644.
  • 32
    Norman, P. J., Carrington, C. V., Byng, M., Maxwell, L. D., Curran, M. D., Stephens, H. A., Chandanayingyong, D., Verity, D. H., Hameed, K., Ramdath, D. D. and Vaughan, R. W., Natural killer cell immunoglobulin-like receptor (KIR) locus profiles in African and South Asian populations. Genes Immun. 2002. 3: 8695.
  • 33
    Colonna, M., Navarro, F., Bellon, T., Llano, M., Garcia, P., Samaridis, J., Angman, L., Cella, M. and Lopez-Botet, M., A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. J. Exp. Med. 1997. 186: 18091818.
  • 34
    Borges, L., Hsu, M. L., Fanger, N., Kubin, M. and Cosman, D., A family of human lymphoid and myeloid Ig-like receptors, some of which bind to MHC class I molecules. J. Immunol. 1997. 159: 51925196.
  • 35
    Arm, J. P., Nwankwo, C. and Austen, K. F., Molecular identification of a novel family of human Ig superfamily members that possess immunoreceptor tyrosine-based inhibition motifs and homology to the mouse gp49B1 inhibitory receptor. J. Immunol. 1997. 159: 23422349.
  • 36
    Meyaard, L., Adema, G. J., Chang, C., Woollatt, E., Sutherland, G. R., Lanier, L. L. and Phillips, J. H., LAIR-1, a novel inhibitory receptor expressed on human mononuclear leukocytes. Immunity 1997. 7: 283290.
  • 37
    Yang, S. Y., Milford, E., Hämmerling, U. and Dupont, B., Description of the reference panel of B-lymphoblastoid cell lines for factors of the HLA system: the B-cell line panel designed for the Tenth International Histocompatibility Workshop. In Dupont, B. (Ed.), Immunobiology of HLA, Springer-Verlag, New York 1989, pp pp 1118.
  • 38
    Gómez-Lozano, N. and Vilches, C., Genotyping of human killer-cell immunoglobulin-like receptor genes by polymerase chain reaction with sequence-specific primers: an update. Tissue Antigens 2002. 59: 184193.
  • 39
    Middleton, D., Curran, M. and Maxwell, L., Natural killer cells and their receptors. Transpl. Immunol. 2002. 10: 147164.
  • 40
    Williams, F., Meenagh, A., Sleator, C. and Middleton, D., Investigation of killer cell immunoglobulin-like receptor gene diversity: I. KIR2DL4. Hum. Immunol. 2004. 65: 3138.
  • 41
    Maxwell, L. D., Williams, F., Gilmore, P., Meenagh, A. and Middleton, D., Investigation of killer cell immunoglobulin-like receptor gene diversity: II. KIR2DS4. Hum. Immunol. 2004. 65: 613621.
  • 42
    Halfpenny, I. A., Middleton, D., Barnett, Y. A. and Williams, F., Investigation of killer cell immunoglobulin-like receptor gene diversity: IV. KIR3DL1/S1. Hum. Immunol. 2004. 65: 602612.
  • 43
    Fan, Q. R., Long, E. O. and Wiley, D. C., Crystal structure of the human natural killer cell inhibitory receptor KIR2DL1-HLA-Cw4 complex. Nat. Immunol. 2001. 2: 452460.
  • 44
    Boyington, J. C., Motyka, S. A., Schuck, P., Brooks, A. G. and Sun, P. D., Crystal structure of an NK cell immunoglobulin-like receptor in complex with its class I MHC ligand. Nature 2000. 405: 537543.