SEARCH

SEARCH BY CITATION

Keywords:

  • Apoptosis;
  • Colitis;
  • IL-15;
  • Intestinal epithelial cells;
  • Mucosa

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

IL-15, a T-cell growth factor, has been shown to be increased in inflammatory bowel disease (IBD). It has been suggested that neutralization of IL-15 could protect from T cell-dependent autoimmune inflammation. On the other hand, an anti-apoptotic effect of IL-15 has been demonstrated in kidney epithelial cells during nephritis. We therefore tested the role of IL-15 in two different experimental models of colitis in vivo, and in models of intestinal epithelial cell (IEC) apoptosis in vitro. IL-15 blockade in chronic dextran sulphate sodium-induced colitis resulted in aggravation of the disease with a significantly 2.1-fold increased epithelial damage score compared to controls. TUNEL staining clearly revealed increased apoptosis. IL-6, TNF and IFN-γ secretion by mesenteric lymph node cells were increased. In the T cell-dependent SCID transfer model of colitis IL-15 neutralization reduced the inflammatory infiltration and proinflammatory cytokine production. Despite that, the intestinal epithelial damage was not reduced. In vitro, IL-15 pre-incubation prevented up to 75% of CH11 antibody-induced apoptosis in SW-480 cells and reduced caspase-3 activity. According to this, endogenously produced IL-15 in chronic colitis does not only act as a proinflammatory cytokine but has at the same time the potential to reduce mucosal damage by preventing IEC apoptosis.

Abbreviations:
DSS:

dextran sulphate sodium

IBD:

inflammatory bowel disease

IEC:

intestinal epithelial cells

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

IL-15 is a cytokine with complex biological functions 14. The receptors for IL-15 and IL-2 share two subunits (the IL-2Rβ and the common γ chain) 58. However, the functions of both cytokines during T cell-dependent immune responses are distinct and contrasting.

The specificity for IL-15 is conferred by the α chain of the IL-15 receptor (IL-15R) 810. Both, IL-15 and IL-2 are able to stimulate T cell proliferation 11, 12. T cell expansion has been shown to be a major contributor to induction and pathophysiology of colitis in a number of animal models of inflammatory bowel disease (IBD) 1319. Whereas IL-2 is able to promote T cell apoptosis, this is not the case with IL-15. In contrast, IL-15 protects T cells from IL-2-induced apoptosis 12, 2025. Moreover, IL-15 has been shown to be a growth factor for memory CD8 T cells and NK cells 2629.

Despite the fact that IL-15 and IL-2 share two chains of their receptors, these cytokines are not expressed in the same cells. Whereas IL-2 expression is found in activated T cells, IL-15 is constitutively expressed by a broad array of cell types, including macrophages and epithelial cells 3. IL-15 expression has been shown in intestinal epithelial cell (IEC) lines as well as in the intestinal mucosa 3034.

Increased IL-15 production at the site of autoimmune disease has been associated with exacerbation of rheumatoid arthritis 2, 3540 and IBD 31, 41, 42. In addition, increased expression of IL-15 has been found in human allograft rejection 43, 44.

On the other hand, in a manuscript by Kelley and co-workers 45, IL-15 was identified as a survival factor for kidney epithelial cells counteracting apoptosis during nephritis. These data suggest on the one hand a proinflammatory role of IL-15 during colitis, but imply on the other hand the possibility of a IL-15-induced protection of epithelial cells. As the role of an intact epithelial barrier for the prevention of mucosal inflammation has recently gained increasing attention, we further characterized the effects of IL-15 neutralization in two different murine models of chronic colitis. Furthermore, we examined whether IL-15 influences apoptosis of IEC.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

IL-15 neutralization aggravates epithelial damage in chronic dextran sulphate sodium-induced colitis.

To investigate the role of IL-15 in chronic colitis in vivo, we first used the dextran sulphate sodium (DSS)-induced model of chronic experimental colitis. Epithelial damage is a characteristic feature of this model and apoptosis of epithelial cells has been suggested to play an important role in the pathogenesis of intestinal inflammation in both DSS-induced colitis and human IBD 46, 47. IL-15 effects were blocked using soluble (s) IL-15Rα. In Fig. 1A (histological scores) and Fig. 1B (representative H&E sections), the effects of IL-15 neutralization on epithelial cell damage and intestinal inflammation are illustrated. Treatment with sIL-15Rα resulted in a significantly 2.1-fold increased epithelial damage score compared to controls (p<0.01), whereas the inflammatory infiltrate showed only a trend to increase (Fig. 1A). This indicated a protective role of IL-15 for epithelial cells in chronic DSS-induced colitis. Immunohistochemistry in sIL-15Rα-treated mice indicated a reduction in CD3+ cells but an increase of CD11c+ cells corresponding to a decrease in T cell numbers and an increased infiltration of dendritic cells induced by IL-15 neutralization (data not shown).

thumbnail image

Figure 1. Effect of IL-15 neutralization on histological parameters and cytokine secretion from mesenteric lymph node cells in chronic DSS-induced colitis. Mice with chronic DSS-induced colitis received either sIL-15Rα (50 μg) or PBS 100 μL (control) per mouse and day for 5 days. The histological score (A) was determined as described in the materials and methods. Data points were derived from five mice per group from two independent experiments and represent mean ± SEM. * Significantly different from control group. (B) Two representative colonic sections from sIL-15Rα treated or control mice (H&E-stained) are presented (magnification 100-fold). (C) Cells from pooled mesenteric lymph nodes were isolated and incubated in quadruplicate cultures for 24 h. Supernatants were used for cytokine measurement by ELISA. Bars represent mean ± SEM. * Significantly different from control groups.

Download figure to PowerPoint

As IL-15 has been characterized as a proinflammatory cytokine contributing to the activation and proliferation of lymphocytes, we measured the influence of IL-15 neutralization on cytokine secretion from draining mesenteric lymph node cells. In accordance with the increase of the histological score, there was a significant 1.9-fold increase of IFN-γ, a 2.4-fold increase in IL-6 and a 1.4-fold increase in TNF secretion. No significant changes were found with respect to the secretion of IL-10, IL-5 and IL-12 (Fig. 1C).

IL-15 neutralization reduces inflammation in the SCID transfer model of colitis

According to the surprising deterioration of DSS-induced colitis after IL-15 neutralization, we wanted to check whether IL-15 has also protective effects in a model of T cell-driven intestinal inflammation. In contrast to DSS-induced colitis, in which epithelial cell apoptosis plays a dominant pathogenetic role, in the SCID transfer model, colitis is induced by transferred CD4+ lymphocytes undergoing homeostatic proliferation in the SCID host. In this model, epithelial cell damage is a secondary effect which, during the course of non-treated/manipulated disease, usually correlates well with the degree of inflammation. In contrast to DSS-induced colitis after 5 days of IL-15 neutralization, a strongly reduced inflammatory infiltration was observed in the SCID transfer model of colitis (Fig. 2A). Despite this clear decrease in inflammatory cell infiltration, surprisingly no reduction in the level of epithelial cell damage could be detected (Fig. 2A). Along with the reduced number of infiltrating cells, IL-15 neutralization resulted in a strong reduction of proinflammatory cytokine secretion (Fig. 2B).

thumbnail image

Figure 2. Effect of IL-15 neutralization on histological parameters and cytokine secretion from mesenteric lymph node cells in the SCID transfer model of colitis. After the onset of colitis, SCID mice received either PBS (control) or sIL-15Rα (50 μg) i.p. over 5 days. The histological score (A) was determined as described in the Materials and methods. Cells from pooled mesenteric lymph nodes were isolated and incubated in quadruplicate cultures for 24 h. Supernatants were used for cytokine measurement by ELISA (B). Each group consisted of five to ten mice. Bars represent mean ± SEM. * Significantly different from control group.

Download figure to PowerPoint

sIL-15Rα increases IEC apoptosis in chronic DSS-induced colitis

To verify whether the increase in IEC damage found in chronic DSS-induced colitis was caused by increased apoptosis, histological specimens were subjected to TUNEL staining. As indicated in Fig. 3A, there was a clear increase in apoptotic epithelial cells in sIL-15Rα-treated mice with chronic DSS-induced colitis. The average percentage of apoptotic IEC increased from 18% in colitis control mice to 34% in colitis mice treated with sIL-15Rα (p=0.001) (Fig. 3B). In contrast, epithelial cell proliferation, as indicated by BrdU staining, did not differ in either group (data not shown).

thumbnail image

Figure 3. Effect of IL-15 neutralization on apoptosis (TUNEL staining). Mice with chronic DSS-induced colitis received either sIL-15Rα (50 μg) or PBS (control) per mouse and day for 5 days. Colonic sections were used for TUNEL staining. (A) Representative histological sections are demonstrated. Apoptotic cells can be identified by the presence of a distinct brown staining of the nucleus. (B) Quantification of apoptotic epithelial cells was performed as described in the Materials and methods. Each group consisted of five mice. Bars represent mean ± SEM. * Significantly different from control group.

Download figure to PowerPoint

IL-15 protects human colonic epithelial cells from Fas-induced apoptosis

IL-15 neutralization resulted in an increased IEC damage and IEC apoptosis in chronic DSS-induced colitis and in a persistence of epithelial damage in the SCID transfer colitis model, despite a clear reduction of T cell-mediated inflammation. Therefore, we investigated whether the protective effect of IL-15 on colon epithelial cells as demonstrated in these murine colitis models could be reproduced in vitro in human IEC cultures. As freshly isolated primary epithelial cells show a high rate of spontaneous apoptosis (“anoikis”), we used SW-480 cells for these experiments. For the induction of apoptosis, cells were incubated with the anti-Fas (Apo-1, CD95) cross-linking antibody CH11, which is an established inductor of apoptosis.

Apoptosis was measured through quantification of the pre-G1 peak of propidium iodide incorporation by flow cytometry. Under the conditions used, the spontaneous rate of pre-G1 cells was around 15%. Incubation of cells for 20 h with CH11 increased apoptosis up to 40% as shown in Fig. 4 (p<0.001). Pre-incubation of the cells with IL-15 over 20 h decreased Fas-induced apoptosis, with an optimal inhibition at 10 U/mL to 25% of that induced by Fas ligation (Fig. 4, p<0.001).

thumbnail image

Figure 4. Quantification of the anti-apoptotic effect of IL-15 on CH11-induced apoptosis in SW-480 cells. Apoptosis of SW-480 cells was measured by propidium iodine staining and FACS analysis. Pre-incubation of the cells with IL-15 decreased Fas-induced apoptosis with an optimal inhibition at 10 U/mL to 25% of that induced by Fas-ligation. # Significantly different from control, * significantly different from only CH11-treated cells.

Download figure to PowerPoint

Increasing concentrations of IL-15 were used in a colorimetric assay for caspase-3 activity. Again apoptosis was induced by CH11. At a dose of 12.5 U/mL IL-15 there was a significant reduction of caspase activity to 75%. A further increase in IL-15 concentrations showed only a minor effect with a maximum reduction of caspase-3 activity to 60% at 50 U/mL compared to non IL-15-exposed cells (Fig. 5).

thumbnail image

Figure 5. Colorimetric assay for caspase 3 in CH11-stimulated SW-480 cells treated with increasing amounts of IL-15. CH11 mAb was used for the induction of apoptosis. At a dose of 12.5 U/mL IL-15, there was a significant reduction of caspase activity to 75% of control. A further increase in IL-15 concentrations showed only a minor effect with a maximum reduction of caspase-3 activity to 60% at 50 U/mL compared to non IL-15 exposed cells

Download figure to PowerPoint

IL-15 RNA and protein production of human IEC

Because IL-15 prevented apoptosis in vitro, we tested its expression in IEC. Fig. 6A shows PCR for two isoforms of IL-15 with long and short signal peptide. Under our PCR conditions expression of SSP-IL-15 mRNA (288 bp) was demonstrated in primary IEC, SW-480 and HT-29 cells. The weak signal at 407 bp corresponds to the LSP-IL-15 mRNA.

thumbnail image

Figure 6. Demonstration of IEC IL-15 production on RNA and protein level. (A) IL-15 mRNA expression in primary IEC and IEC cell lines. RT-PCR from IEC, SW-480 and HT-29 cells shows IL-15 mRNA corresponding to short signal peptide IL-15 (288 bp) and a weak signal for long signal peptide IL-15 RNA (407 bp) in HT-29 cells. (B) Intracellular IL-15 content; ELISA from cell lysates (cytosol) shows intracellularly stored IL-15.

Download figure to PowerPoint

Western blot analysis (data not shown) and ELISA (Fig. 6B) clearly showed production of IL-15 protein in SW-480, primary IEC and HT-29 cells corresponding to the mRNA data.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Our results indicate an anti-apoptotic effect of IL-15 on IEC in vitro and in vivo. IL-15 protein is produced by primary IEC and IEC lines. Neutralization of IL-15 caused increased epithelial damage and epithelial cell apoptosis in chronic DSS-induced colitis. In in vitro assays an anti-apoptotic effect of IL-15 could be demonstrated for IEC, similar to the one that was shown for kidney epithelial cells 45. Therefore, IL-15 has protective effects for IEC. Besides the novel role of IL-15 on IEC apoptosis described in this manuscript, a previously described IL-15-induced enhanced production of tight-junction proteins and the ensuing increase in transepithelial resistance 48 may contribute to epithelial protection, and further explain the increased epithelial damage following neutralization of IL-15 in DSS-induced colitis.

In contrast to the detrimental effects of IL-15 neutralization in chronic DSS-induced colitis, sIL-15 Rα treatment had a strong anti-inflammatory effect in the SCID-transfer model of colitis; despite this strong anti-inflammatory effect with reduced numbers of infiltrating cells and reduced proinflammatory cytokine production from draining mesenteric lymph node cells, the epithelial damage score was not ameliorated. This may again be explained by the described epithelial cell protective effects of IL-15. Due to the neutralization of IL-15, the intestinal epithelial cells were less protected from inflammation induced apoptosis in this setting. Consequently, even a significantly reduced inflammation may result in the same extent of epithelial damage when the protective effect is also missing.

The differential overall histological outcome in the chronic DSS and SCID-transfer models underlines the different pathomechanisms involved in colitis in both models. In the DSS model of colitis, epithelial cell damage and apoptosis are crucial mechanisms triggering inflammation and disease 46, whereas colitis in the SCID-transfer model is initiated by infiltrating T lymphocytes undergoing homeostatic proliferation in the SCID host, which is known to be driven by IL-15 49. Epithelial damage in this model is a secondary event following inflammation. Therefore, neutralization of IL-15, which has both epithelial cell protective effects and proinflammatory effects on T lymphocytes, results in different outcomes depending on the dominant pathogenic mechanism of the colitis model used.

In respect to the potential proinflammatory effects of IL-15, the observed increase in IFN-γ, TNF and IL-6 secretion after IL-15 neutralization in chronic DSS-induced colitis is most likely to be a secondary effect resulting from the increased epithelial damage caused by IL-15 neutralization. The sIL-15Rα induced increase in epithelial barrier dysfunction may result in a further acceleration of the previously demonstrated exaggerated immune response towards intestinal bacteria and bacterial constituents 50 in chronic DSS-induced colitis.

In contrast to our data, a recent report suggests that in IL-15-deficient mice DSS-induced colitis is less severe 51. This discrepancy might be explained by the fact that in knockout mice some functions of IL-15, e.g., its epithelial cell protective function, may be compensated already during early development by other factors. Moreover, in the knockout model, IL-15 is absent before and during colitis induction. In contrast to this, in our experiments, IL-15 was neutralized after the establishment of chronic colitis. This experimental setting is much closer to a potential therapeutic approach in human IBD.

Regarding the results presented here, the increased expression of IL-15 found during human IBD 31, 42, 52, 53 may not only drive T cell-mediated inflammation, but also contribute to the protection of the intestinal epithelial layer.

Our results obtained from the SCID-transfer model of colitis clearly show that IL-15 also has important proinflammatory qualities in T cell-dependent intestinal inflammation. This is in line with previous results characterizing IL-15 as a strong proinflammatory stimulus leading to increased IFN-γ production by T lymphocytes in celiac disease 54, 55.

This report provides evidence for the first time that endogenous IL-15 has not only the potential to act as a proinflammatory cytokine in intestinal inflammation but has also strong protective, anti-apoptotic effects on colonic epithelial cells. We demonstrated that these protective anti-apoptotic effects can even outweigh the negative proinflammatory effects of IL-15 in established chronic DSS-induced colitis in which epithelial damage plays a dominant pathogenic role.

Based on the data presented, it is hard to predict which effect of IL-15 neutralization will prevail in the clinical situation as both T lymphocyte activation and defects in epithelial barrier function play an essential role in human IBD 56, 57.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Mice

Female BALB/c mice weighing 20–22 g and C.B.-17 SCID (18–20 g) mice (Charles River, Germany) were used for the experiments and were housed in a conventional facility. Animal studies were approved by the local Institutional Review Board.

Reagents

DSS was purchased from ICN (Mr 37000–50000, Eschwege, Germany). Soluble murine IL-15Rα was obtained from F. Y. Liew (Glasgow, UK) 58, 59 and S. Sulfone-Paus (Research Center Borstel, Germany) and stored in a final concentration of 1 mg/mL in PBS at –20°C. Recombinant human IL-15 was obtained from Biosource International (CA, USA). In the batch obtained 1 mg was equivalent to 2 × 106 U as defined by the proliferation of CTLL-2 cells.

Induction and treatment of chronic DSS-induced colitis

For induction of chronic colitis, BALB/c mice received four cycles of DSS treatment as described 60. Each cycle consisted of 3% DSS in drinking water for 7 days, followed by a 10-day interval with normal drinking water. In contrast to the self limited inflammation in acute DSS colitis, which is induced by only one cycle of DSS feeding, chronic DSS-induced colitis is characterized by a self-perpetuating chronic inflammation, which lasts for several month 61. At 4 weeks after the induction phase, mice were treated with sIL-15Rα (50 μg) dissolved in 100 µL PBS or with PBS alone (100 µL, control) i.p. daily for 5 days as indicated.

Mice used for experiments were age matched and had received DSS treatment simultaneously.

Induction and treatment of colitis in the CD4+CD62L+ T cell transfer model

Splenic CD4+CD62L+ T cells from BALB/c mice were isolated as described previously with slight modifications 62. CD62L+CD4+ T cells were resuspended (0.25 × 106 cells in 200 μL of sterile PBS) and injected i.p. into recipient C.B.-17 SCID mice. sIL-15Rα (50 μg) or PBS (100 μL, control) were given i.p. daily over 5 days after the onset of colitis (5 weeks after transfer).

Assessment of histological score

The distal third of the colon was removed and used for histological analysis as described before 60, 63. Three sections were evaluated obtained each at a 100-μm distance. Mice were scored individually, each score representing the mean of three sections. Histological examination was performed by two independent investigators blinded to the type of treatment. Histology was scored as follows: epithelium: (E) 0: normal morphology; 1: loss of goblet cells, 2: loss of goblet cells in large areas; 3: loss of crypts; 4: loss of crypts in large areas; infiltration (mononuclear cells and granulocytes): (I) 0: no infiltrate; 1: infiltrate around crypt basis; 2: infiltrate reaching to L. muscularis mucosae; 3: extensive infiltration reaching the L. muscularis mucosae and thickening of the mucosa with abundant edema; 4: infiltration of the L. submucosa.

The total histological score represents the sum of the epithelium and infiltration score and ranges from 0 to 8.

Isolation and incubation of mesenteric lymph node cells

Mesenteric lymph nodes (pooled from each group of mice) were collected under sterile conditions in cold cell culture medium [RPMI 1640, 10% FCS, 100 U/mL penicillin and 100 μg/mL streptomycin from GIBCO-BRL (Eggenstein, Germany) and 3 × 10–5 M 2-mercaptoethanol (Sigma, Deisenhofen, Germany)]. Lymph nodes were mechanically disrupted and filtered through a cell strainer (70 μm). Cells (2 × 105/well) were incubated in 200 μL culture medium over 24 h and spontaneous cytokine secretion into the supernatants was measured by ELISA (all from Endogene, Woburne, MA), using four wells per condition.

TUNEL staining

Tissue samples were snap-frozen in liquid nitrogen embedded in OCT and 5- to 10-µm cryostat-sections cut. TUNEL assays were performed using the In Situ Cell Death Detection Kit, AP (Roche, Penzberg, Germany) according to the manufacturer's recommendations. Apoptotic cells were identified by the presence of a distinct brown staining. For quantitative analysis of epithelial cell apoptosis, the number of apoptotic epithelial cells per 500 epithelial cells was counted per section in two sections per mouse from five mice per group.

Isolation of colonic epithelial cells

A method for the isolation of a viable epithelial cell preparation has been developed based on standard protocols, and is described in more detail elsewhere 64. IEC were seeded into collagen A (Biochrom, Berlin, Germany) -coated Millicell-CM cell culture plate inserts suitable for 24-well culture plates with a translucent and permeable membrane at the bottom (Millipore, Eschborn, Germany). The cells were incubated at 37°C in air with 10% CO245.

Determination of IL-15 protein

Cells were lysed with 0.1% SDS. IL-15 was measured by ELISA (Biotrak-Amersham, Braunschweig, Germany) according to the manufacturer's protocol.

Cell culture conditions

SW-480 cells (generously provided by Prof. M. Herlyn, The Wistar Institute, Philadelphia, PA) were cultured in RPMI 1640 (PAN Biotech GmbH, Passau, Germany) containing 10% FCS and 1% NEA(non-essential amino acids) in 75-cm2 flasks from Costar (Cambridge, UK).

In vitro treatment of SW-480 cells

SW-480 cells were incubated with 125 ng or 500 ng/ mL CH11 antibody (Upstate, NY, USA) as indicated for 20 h with or without a 20-h preincubation period with recombinant IL-15 (5–50 U/mL as indicated).

PCR

cDNA were synthesized from 1 μg total RNA using 2.5 μM poly(dT), 12.5 U AMV reverse transcriptase, 0.5 mM of each dNTP, 5 mM MgCl2 and 32 U RNase inhibitor in a final volume of 20 μL (all reagents from Amersham, Biosciences). PCR was performed for 40 cycles (0.5 min at 95°C, 0.5 min at 55°C, 0.5 min at 72°C) in a volume of 40 μL. The reaction mixture contained 10 mM Tris, pH 8.3, 50 mM KCl, 2 mM MgCl2, 400 μM of each dNTP, 1 U Taq DNA polymerase (all from Amersham Biosciences). Primers (TipMolBiol, Berlin, Germany) for IL-15 were added to a final concentration of 250 nM: primer (upstream): CCATAGCCAGCTCTTCTTCAATAC; primer (downstream): GTGAACATCACTTTCCGTATATAATAAAG.

Flow cytometry

Apoptotic cells from the media supernatant and non-apoptotic adherent cells were scraped off the culture insert, collected and pelleted at 2000 U/min. Pellets were washed in PBS and DNA propidium iodide staining was performed using the CycleTestTMPlus DNA Reagent Kit according to the manufacturer's recommendations (Becton Dickinson, CA). The samples were analyzed using an EPICS XL-MCL (Coulter Immunotech, Hamburg, Germany) flow cytometer.

Caspase-activity assay

Caspase activation was determined from cytosol of IEC. The colorimetric activity assays were performed with a commercially available caspase assay kit (Biomol Res. Lab., Plymouth meeting, USA) according to the manufacturer's recommendations. In brief, following the respective treatment, cells were collected and briefly spun down. Cells were lysed (50 mM HEPES pH 7.4, 0.1% CHAPS, 1 mM DTT, 0.1 mM EDTA), nuclei were removed (10 000 rpm, 10 min), and the cytosolic preparations were quickly frozen and stored at –80°C until usage (max. 2 weeks). Equal amounts of cytosolic protein were added to the assay buffer (50 mM HEPES pH 7.4, 100 mM NaCl, 0.1% CHAPS, 10 mM DTT, 1 mM EDTA, 10% glycerol, caspase-3 substrate Ac-DEVD-pNA) in 96-well ELISA plates. The OD405 nm was quantified with an ELISA-plate reader.

Statistics

Statistical analysis was performed using the Student's t-test (cytokine levels, quantification of apoptosis) or the Mann-Whitney Rank Sum Test (histological score). *, # Statistically significant with p<0.05.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

This work was supported by DFG grants to F.O. (OB-135/8–1) and G.R. (GR-1236/10–2 and 10–3).

  • 1

    WILEY-VCH

  • 2

    WILEY-VCH

  • 3

    WILEY-VCH

  • 4

    WILEY-VCH

  • 5

    WILEY-VCH

  • 6

    WILEY-VCH

  • 1
    He, Y. W. and Malek, T. R., The structure and function of gamma c-dependent cytokines and receptors: regulation of T lymphocyte development and homeostasis. Crit. Rev. Immunol. 1998. 18: 503524.
  • 2
    Kirman, I., Vainer, B. and Nielsen, O. H., Interleukin-15 and its role in chronic inflammatory diseases. Inflamm. Res. 1998. 47: 285289.
  • 3
    Perera, L. P., Interleukin 15: its role in inflammation and immunity. Arch. Immunol. Ther. Exp. (Warsz) 2000. 48: 457464.
  • 4
    Lodolce, J., Burkett, P., Koka, R., Boone, D., Chien, M., Chan, F., Madonia, M. et al., Interleukin-15 and the regulation of lymphoid homeostasis. Mol. Immunol. 2002. 39: 537544.
  • 5
    Carson, W. E., Giri, J. G., Lindemann, M. J., Linett, M. L., Ahdieh, M., Paxton, R., Anderson, D. et al., Interleukin (IL) 15 is a novel cytokine that activates human natural killer cells via components of the IL-2 receptor. J. Exp. Med. 1994. 180: 13951403.
  • 6
    Giri, J. G., Ahdieh, M., Eisenman, J., Shanebeck, K., Grabstein, K., Kumaki, S., Namen, A. et al., Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15. EMBO J. 1994. 13: 28222830.
  • 7
    Grabstein, K. H., Eisenman, J., Shanebeck, K., Rauch, C., Srinivasan, S., Fung, V., Beers, C. et al., Cloning of a T cell growth factor that interacts with the beta chain of the interleukin-2 receptor. Science 1994. 264: 965968.
  • 8
    Cosman, D., Kumaki, S., Ahdieh, M., Eisenman, J., Grabstein, K. H., Paxton, R., DuBose, R. et al., Interleukin 15 and its receptor. Ciba Found. Symp. 1995. 195: 221229.
  • 9
    Giri, J. G., Kumaki, S., Ahdieh, M., Friend, D. J., Loomis, A., Shanebeck, K., DuBose, R. et al., Identification and cloning of a novel IL-15 binding protein that is structurally related to the alpha chain of the IL-2 receptor. EMBO J. 1995. 14: 36543663.
  • 10
    Anderson, D. M., Kumaki, S., Ahdieh, M., Bertles, J., Tometsko, M., Loomis, A., Giri, J. et al., Functional characterization of the human interleukin-15 receptor alpha chain and close linkage of IL15RA and IL2RA genes. J. Biol. Chem. 1995. 270: 2986229869.
  • 11
    Agostini, C., Trentin, L., Sancetta, R., Facco, M., Tassinari, C., Cerutti, A., Bortolin, M. et al., Interleukin-15 triggers activation and growth of the CD8 T-cell pool in extravascular tissues of patients with acquired immunodeficiency syndrome. Blood 1997. 90: 11151123.
  • 12
    Li, X. C., Demirci, G., Ferrari-Lacraz, S., Groves, C., Coyle, A., Malek, T. R. and Strom, T. B., IL-15 and IL-2: a matter of life and death for T cells in vivo. Nat. Med. 2001. 7: 114118.
  • 13
    De Winter, H., Cheroutre, H. and Kronenberg, M., Mucosal immunity and inflammation. II. The yin and yang of T cells in intestinal inflammation: pathogenic and protective roles in a mouse colitis model. Am. J. Physiol. 1999. 276: 13171321.
  • 14
    Iqbal, N., Oliver, J. R., Wagner, F. H., Lazenby, A. S., Elson, C. O. and Weaver, C. T., T helper 1 and T helper 2 cells are pathogenic in an antigen-specific model of colitis. J. Exp. Med. 2002. 195: 7184.
  • 15
    Watanabe, M., Hosoda, Y., Okamoto, S., Yamazaki, M., Inoue, N., Ueno, Y., Iwao, Y. et al., CD45RChighCD4+ intestinal mucosal lymphocytes infiltrating in the inflamed colonic mucosa of a novel rat colitis model induced by TNB immunization. Clin. Immunol. Immunopathol. 1998. 88: 4655.
  • 16
    Simpson, S. J., Shah, S., Comiskey, M., de Jong, Y. P., Wang, B., Mizoguchi, E., Bhan, A. K. et al., T cell-mediated pathology in two models of experimental colitis depends predominantly on the interleukin 12/Signal transducer and activator of transcription (Stat)-4 pathway, but is not conditional on interferon gamma expression by T cells. J. Exp. Med. 1998. 187: 12251234.
  • 17
    Elson, C. O., Beagley, K. W., Sharmanov, A. T., Fujihashi, K., Kiyono, H., Tennyson, G. S., Cong, Y. et al., Hapten-induced model of murine inflammatory bowel disease: mucosa immune responses and protection by tolerance. J. Immunol. 1996. 157: 21742185.
  • 18
    Neurath, M. F., Fuss, I., Kelsall, B. L., Stuber, E. and Strober, W., Antibodies to interleukin 12 abrogate established experimental colitis in mice. J. Exp. Med. 1995. 182: 12811290.
  • 19
    Powrie, F., Leach, M. W., Mauze, S., Menon, S., Caddle, L. B. and Coffman, R. L., Inhibition of Th1 responses prevents inflammatory bowel disease in scid mice reconstituted with CD45RBhi CD4+ T cells. Immunity 1994. 1: 553562.
  • 20
    Bulfone-Paus, S., Durkop, H., Paus, R., Krause, H., Pohl, T. and Onu, A., Differential regulation of human T lymphoblast functions by IL-2 and IL- 15. Cytokine 1997. 9: 507513.
  • 21
    Lorenz, H. M., Hieronymus, T., Grunke, M., Manger, B. and Kalden, J. R., Differential role for IL-2 and IL-15 in the inhibition of apoptosis in short-term activated human lymphocytes. Scand. J. Immunol. 1997. 45: 660669.
  • 22
    Bulfone-Paus, S., Ungureanu, D., Pohl, T., Lindner, G., Paus, R., Ruckert, R., Krause, H. et al., Interleukin-15 protects from lethal apoptosis in vivo. Nat. Med. 1997. 3: 11241128.
  • 23
    Inagaki-Ohara, K., Nishimura, H., Mitani, A. and Yoshikai, Y., Interleukin-15 preferentially promotes the growth of intestinal intraepithelial lymphocytes bearing gamma delta T cell receptor in mice. Eur. J. Immunol. 1997. 27: 28852891.
  • 24
    Chu, C. L., Chen, S. S., Wu, T. S., Kuo, S. C. and Liao, N. S., Differential effects of IL-2 and IL-15 on the death and survival of activated TCR gamma delta+ intestinal intraepithelial lymphocytes. J. Immunol. 1999. 162: 18961903.
  • 25
    Naora, H. and Gougeon, M. L., Interleukin-15 is a potent survival factor in the prevention of spontaneous but not CD95-induced apoptosis in CD4 and CD8 T lymphocytes of HIV-infected individuals. Correlation with its ability to increase BCL-2 expression. Cell Death Differ. 1999. 6: 10021011.
  • 26
    Kanegane, H. and Tosato, G., Activation of naive and memory T cells by interleukin-15. Blood 1996. 88: 230235.
  • 27
    Lai, Y. G., Gelfanov, V., Gelfanova, V., Kulik, L., Chu, C. L., Jeng, S. W. and Liao, N. S., IL-15 promotes survival but not effector function differentiation of CD8+ TCRalphabeta+ intestinal intraepithelial lymphocytes. J. Immunol. 1999. 163: 58435850.
  • 28
    Niedbala, W., Wei, X. and Liew, F. Y., IL-15 induces type 1 and type 2 CD4+ and CD8+ T cells proliferation but is unable to drive cytokine production in the absence of TCR activation or IL-12 / IL-4 stimulation in vitro. Eur. J. Immunol. 2002. 32: 341347.
  • 29
    Thulesen, S., Nielsen, M., Petersen, T. R., Holst Nissen, M., Odum, N. and Ropke, C., Interleukin 15 is a growth factor for human thymocytes with preferential effect on CD8(+)cells. Cytokine 2000. 12: 751755.
  • 30
    Reinecker, H. C., MacDermott, R. P., Mirau, S., Dignass, A. and Podolsky, D. K., Intestinal epithelial cells both express and respond to interleukin 15. Gastroenterology 1996. 111: 17061713.
  • 31
    Sakai, T., Kusugami, K., Nishimura, H., Ando, T., Yamaguchi, T., Ohsuga, M., Ina, K. et al., Interleukin 15 activity in the rectal mucosa of inflammatory bowel disease. Gastroenterology 1998. 114: 12371243.
  • 32
    Murray, A. M., Simm, B. and Beagley, K. W., Cytokine gene expression in murine fetal intestine: potential for extrathymic T cell development. Cytokine 1998. 10: 337345.
  • 33
    Liu, Z., Geboes, K., Colpaert, S., D'Haens, G. R., Rutgeerts, P. and Ceuppens, J. L., IL-15 is highly expressed in inflammatory bowel disease and regulates local T cell-dependent cytokine production. J. Immunol. 2000. 164: 36083615.
  • 34
    Hiroi, T., Yanagita, M., Ohta, N., Sakaue, G. and Kiyono, H., IL-15 and IL-15 receptor selectively regulate differentiation of common mucosal immune system-independent B-1 cells for IgA responses. J. Immunol. 2000. 165: 43294337.
  • 35
    McInnes, I. B. and Liew, F. Y., Interleukin 15: a proinflammatory role in rheumatoid arthritis synovitis. Immunol. Today 1998. 19: 7579.
  • 36
    McInnes, I. B., Leung, B. P., Sturrock, R. D., Field, M. and Liew, F. Y., Interleukin-15 mediates T cell-dependent regulation of tumor necrosis factor-alpha production in rheumatoid arthritis. Nat. Med. 1997. 3: 189195.
  • 37
    McInnes, I. B., al-Mughales, J., Field, M., Leung, B. P., Huang, F. P., Dixon, R., Sturrock, R. D. et al., The role of interleukin-15 in T-cell migration and activation in rheumatoid arthritis. Nat. Med. 1996. 2: 175182.
  • 38
    Carson, D. A., Unconventional T-cell activation by IL-15 in rheumatoid arthritis. Nat. Med. 1997. 3: 148149.
  • 39
    Thurkow, E. W., van der Heijden, I. M., Breedveld, F. C., Smeets, T. J., Daha, M. R., Kluin, P. M., Meinders, A. E. et al., Increased expression of IL-15 in the synovium of patients with rheumatoid arthritis compared with patients with Yersinia-induced arthritis and osteoarthritis. J. Pathol. 1997. 181: 444450.
  • 40
    Shah, M. H., Hackshaw, K. V. and Caligiuri, M. A., A role for IL-15 in rheumatoid arthritis? Nat. Med. 1998. 4: 643.
  • 41
    Kirman, I. and Nielsen, O. H., Increased numbers of interleukin-15-expressing cells in active ulcerative colitis. Am. J. Gastroenterol. 1996. 91: 17891794.
  • 42
    Vainer, B., Nielsen, O. H., Hendel, J., Horn, T. and Kirman, I., Colonic expression and synthesis of interleukin 13 and interleukin 15 in inflammatory bowel disease. Cytokine 2000. 12: 15311536.
  • 43
    Pavlakis, M., Strehlau, J., Lipman, M., Shapiro, M., Maslinski, W. and Strom, T. B., Intragraft IL-15 transcripts are increased in human renal allograft rejection. Transplantation 1996. 62: 543545.
  • 44
    Baan, C. C., Niesters, H. G., Metselaar, H. J., Mol, W. M., Loonen, E. H., Zondervan, P. E., Tilanus, H. W. et al., Increased intragraft IL-15 mRNA expression after liver transplantation. Clin. Transplant. 1998. 12: 212218.
  • 45
    Shinozaki, M., Hirahashi, J., Lebedeva, T., Liew, F. Y., Salant, D. J., Maron, R. and Kelley, V. R., IL-15, a survival factor for kidney epithelial cells, counteracts apoptosis and inflammation during nephritis. J. Clin. Invest. 2002. 109: 951960.
  • 46
    Vetuschi, A., Latella, G., Sferra, R., Caprilli, R. and Gaudio, E., Increased proliferation and apoptosis of colonic epithelial cells in dextran sulfate sodium-induced colitis in rats. Dig. Dis. Sci. 2002. 47: 14471457.
  • 47
    Strater, J., Wellisch, I., Riedl, S., Walczak, H., Koretz, K., Tandara, A., Krammer, P. H. et al., CD95 (APO-1/Fas)-mediated apoptosis in colon epithelial cells: a possible role in ulcerative colitis. Gastroenterology 1997. 113: 160167.
  • 48
    Nishiyama, R., Sakaguchi, T., Kinugasa, T., Gu, X., MacDermott, R. P., Podolsky, D. K. and Reinecker, H. C., Interleukin-2 receptor beta subunit-dependent and -independent regulation of intestinal epithelial tight junctions. J. Biol. Chem. 2001. 276: 3557135580.
  • 49
    Wherry, E. J., Becker, T. C., Boone, D., Kaja, M. K., Ma, A. and Ahmed, R., Homeostatic proliferation but not the generation of virus specific memory CD8 T cells is impaired in the absence of IL-15 or IL-15Ralpha. Adv. Exp. Med. Biol. 2002. 512: 165175.
  • 50
    Obermeier, F., Dunger, N., Strauch, U. G., Hofmann, C., Bleich, A., Grunwald, N., Hedrich, H. J. et al., CpG motifs of bacterial DNA essentially contribute to the perpetuation of chronic intestinal inflammation. Gastroenterology 2005. 129: 913927.
  • 51
    Yoshihara, K., Yajima, T., Kubo, C. and Yoshikai, Y., Role of interleukin 15 in colitis induced by dextran sulphate sodium in mice. Gut 2006. 55: 334341.
  • 52
    Inoue, S., Matsumoto, T., Iida, M., Mizuno, M., Kuroki, F., Hoshika, K. and Shimizu, M., Characterization of cytokine expression in the rectal mucosa of ulcerative colitis: correlation with disease activity. Am. J. Gastroenterol. 1999. 94: 24412446.
    Direct Link:
  • 53
    Bitton, A., Peppercorn, M. A., Antonioli, D. A., Niles, J. L., Shah, S., Bousvaros, A., Ransil, B. et al., Clinical, biological, and histologic parameters as predictors of relapse in ulcerative colitis. Gastroenterology 2001. 120: 1320.
  • 54
    Maiuri, L., Ciacci, C., Ricciardelli, I., Vacca, L., Raia, V., Auricchio, S., Picard, J. et al., Association between innate response to gliadin and activation of pathogenic T cells in coeliac disease. Lancet 2003. 362: 3037.
  • 55
    Di Sabatino, A., Ciccocioppo, R., Cupelli, F., Cinque, B., Millimaggi, D., Clarkson, M. M., Paulli, M. et al., Epithelium-derived interleukin-15 regulates intraepithelial lymphocyte Th1 cytokine production, cytotoxicity and survival in coeliac disease. Gut 2005. 55: 469477.
  • 56
    Yu, Y., Sitaraman, S. and Gewirtz, A. T., Intestinal epithelial cell regulation of mucosal inflammation. Immunol. Res. 2004. 29: 5568.
  • 57
    Cobrin, G. M. and Abreu, M. T., Defects in mucosal immunity leading to Crohn's disease. Immunol. Rev. 2005. 206: 277295.
  • 58
    Wei, X., Orchardson, M., Gracie, J. A., Leung, B. P., Gao, B., Guan, H., Niedbala, W. et al., The Sushi domain of soluble IL-15 receptor alpha is essential for binding IL-15 and inhibiting inflammatory and allogenic responses in vitro and in vivo. J. Immunol. 2001. 167: 277282.
  • 59
    Liew, F. Y. and McInnes, I. B., Role of interleukin 15 and interleukin 18 in inflammatory response. Ann. Rheum. Dis. 2002. 61 Suppl 2: 100102.
  • 60
    Obermeier, F., Dunger, N., Deml, L., Herfarth, H., Scholmerich, J. and Falk, W., CpG motifs of bacterial DNA exacerbate colitis of dextran sulfate sodium-treated mice. Eur. J. Immunol. 2002. 32: 20842092.
  • 61
    Okayasu, I., Hatakeyama, S., Yamada, M., Ohkusa, T., Inagaki, Y. and Nakaya, R., A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology 1990. 98: 694702.
  • 62
    Neurath, M. F., Weigmann, B., Finotto, S., Glickman, J., Nieuwenhuis, E., Iijima, H., Mizoguchi, A. et al., The transcription factor T-bet regulates mucosal T cell activation in experimental colitis and Crohn's disease. J. Exp. Med. 2002. 195: 11291143.
  • 63
    Obermeier, F., Kojouharoff, G., Hans, W., Scholmerich, J., Gross, V. and Falk, W., Interferon-gamma (IFN-gamma)- and tumour necrosis factor (TNF)-induced nitric oxide as toxic effector molecule in chronic dextran sulphate sodium (DSS)-induced colitis in mice. Clin. Exp. Immunol. 1999. 116: 238245.
  • 64
    Daig, R., Rogler, G., Aschenbrenner, E., Vogl, D., Falk, W., Gross, V., Scholmerich, J. et al., Human intestinal epithelial cells secrete interleukin-1 receptor antagonist and interleukin-8 but not interleukin-1 or interleukin-6. Gut 2000. 46: 350358.