SEARCH

SEARCH BY CITATION

Keywords:

  • Cornea;
  • Gene therapy;
  • Rodent;
  • Transplantation

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Indoleamine 2,3-dioxygenase (IDO) suppresses T cell responses by its action in catabolising tryptophan. It is important in maintenance of immune privilege in the placenta. We investigated the activity of IDO in the cornea, following corneal transplantation and the effect of IDO over-expression in donor corneal endothelium on the survival of corneal allografts. IDO expression was analysed and functional activity was quantified in normal murine cornea and in corneas following transplantation as allografts. Low levels of IDO, at both mRNA and protein levels, was detected in the normal cornea, up-regulated by IFN-γ and TNF. Expression of IDO in cornea was significantly increased following corneal transplantation. However, inhibition of IDO activity in vivo had no effect on graft survival. Following IDO cDNA transfer, murine corneal endothelial cells expressed functional IDO, which was effective at inhibiting allogeneic T cell proliferation. Over-expression of IDO in donor corneal allografts resulted in prolonged graft survival. While, on one hand, our data indicate that IDO may augment corneal immune privilege, up-regulated IDO activity following cytokine stimulation may serve to inhibit inflammatory cellular responses. While increasing IDO mRNA expression was found in allogeneic corneas at rejection, over-expression in donor cornea was found to significantly extend survival of allografts.

Abbreviations:
EIAV:

equine infectious anaemia virus

IDO:

indoleamine 2,3-dioxygenase

MCEC:

murine corneal endothelial cells

MST:

median survival time

1-MT:

1-methyl tryptophan

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Corneal transplantation is the only treatment for many blinding disorders, and cornea is the most commonly transplanted tissue. These grafts show immune privilege, which, in addition to lack of blood and lymphatic vessels, is due to factors that include the paucity of donor-derived MHC class II+ APC 1, corneal epithelial and endothelial expression of Fas ligand 2 and the induction by a corneal allograft of deviation of systemic delayed-type hypersensitivity 3, 4. However despite a comparative degree of immune privilege, allogeneic rejection is the commonest cause of corneal graft failure 5.

As a tissue enjoying comparative immune privilege, it is of particular interest to investigate expression of indoleamine 2,3-dioxygenase (IDO) in the cornea. This monomeric intracellular enzyme degrades the essential amino acid tryptophan. It leads directly to an opening of the indole ring of tryptophan, thus forming N-formylkynurenine, which rapidly degrades to L-kynurenine 6. The strongest known inducer is IFN-γ, shown in cultured fibroblasts 7, macrophages 8, dendritic cells 9 and many cancer cell lines 10. The IDO-induced tryptophan depletion, as well as the release of its catabolites in the extracellular environment, arrests activated T lymphocytes in the G1 phase, thereby promoting tolerance 11, 12 and leading to apoptosis. Munn et al. 13 reported that inhibition of IDO by exposure of pregnant mice to the specific inhibitor 1-methyl-tryptophan (1-MT) induced T cell-mediated rejection of allogeneic but not syngeneic concepti, leading the authors to hypothesise that IDO expression at the foeto-maternal interface is necessary to prevent rejection of the foetus. In other contexts, IDO has increased activity in anti-microbial defence mechanisms to intracellular pathogens such as Toxoplasma14, viruses 15 and tumour development 16.

A possible role for IDO in modulating the allogeneic response to a graft was first suggested when over-expression of IDO in donor pancreatic islets prior to transplantation extended survival in an animal model 17. We examined the cornea for the presence of functionally active IDO, testing the hypothesis that IDO is involved in maintenance of relative immune privilege by contributing to allograft acceptance. Mindful of the central role of T lymphocytes in allogeneic rejection of cornea as in other tissues 18, we also investigated the effect on allograft survival of vector-mediated over-expression of IDO in donor corneas transduced ex vivo prior to transplantation.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

IDO is expressed in corneal endothelium and up-regulated following pro-inflammatory cytokine stimulation

The levels of IDO mRNA in murine corneal endothelial cells (MCEC) and in intact corneas were assessed by quantitative RT-PCR. A low level of mRNA expression was found in resting MCEC and corneas, increasing following stimulation with 100 ng/mL TNF, IFN-γ and, to a greater extent, with a combination of the two cytokines (Fig. 1A, B). We then examined for IDO protein in MCEC by Western blotting. Compared to murine placenta, minimal IDO protein was detected in unstimulated MCEC, with significantly increased expression following combined TNF and IFN-γ stimulation (Fig. 2A). No IDO protein was detected by Western blotting in whole corneas (data not shown), presumably because of dilution by the large amounts of protein present in the stroma. However, immunohistochemical analysis of whole corneas following IFN-γ stimulation demonstrated IDO expression. This was restricted to the endothelial layer (Fig. 2B). Unstimulated cornea did not show IDO expression (Fig. 2C).

thumbnail image

Figure 1. Effect of cytokine stimulation on IDO mRNA expression in cornea. IDO mRNA expression following stimulation with cytokines for 48 h in MCEC (A) and 72 h in full-thickness mouse cornea (B). In (B) PCR products result from RNA extracted from five pooled corneas. Lane 1, unstimulated; lane 2, 100 ng/mL IFN-γ; lane 3, 100 ng/mL TNF; lane 4, 100 ng/mL IFN-γ + 100 ng/mL TNF. Lower panels show agarose gel electrophoresis bands for IDO and β-actin for each condition.

Download figure to PowerPoint

thumbnail image

Figure 2. Detection of IDO protein and morphological localization in cornea. (A) Western blot indicates IDO expression to be strongest in placenta (lane 1), undetectable in liver homogenates (lane 2) and minimal in unstimulated MCEC (lane 3). Clear up-regulation of protein expression is seen following cytokine stimulation for 48 h with 100 ng/mL IFN-γ (lane 4), 20 ng/mL IFN-γ (lane 5) and 100 ng/mL IFN-γ + 100 ng/mL TNF (lane 6). (B) Detectable IDO expression is localised to the endothelial layer of cornea by immunohistochemistry with anti-IDO antibody following stimulation for 72 h with 100ng/mL IFN-γ. (C) No IDO is detected in unstimulated murine cornea. A 50-μm scale bar is shown in (B).

Download figure to PowerPoint

Enzymatic activity of IDO is up-regulated in corneal endothelial cells

Having found the expression of IDO at mRNA and protein levels in MCEC, we then tested its functional activity by detection of L-kynurenine, the catabolite of tryptophan. Stimulation of MCEC by IFN-γ and/or TNF resulted in cytokine dose-dependent increase in concentration of L-kynurenine in the culture supernatant, indicating that the IDO expressed by the corneal cells was biologically active (Fig. 3).

thumbnail image

Figure 3. Functional activity of IDO expressed by corneal cells. MCEC were stimulated for 48 h with IFN-γ and TNF at a range of concentrations to 100 ng/mL. Cytokine dose-dependent enzymatic activity of IDO was quantified by measurement of L-kynurenine in cell culture supernatant of MCEC and found to be maximal with 100 ng/mL IFN-γ.

Download figure to PowerPoint

IDO up-regulated in corneal endothelial cells has modest functional effect on T cell proliferation

We went on to determine whether the IDO expressed following stimulation of MCEC had an effect on allogeneic T cell proliferation. When cytokine-stimulated MCEC were used as stimulators in an allogeneic lymphocyte proliferation assay, T cell proliferation was observed. The addition of the specific IDO antagonist 1-MT resulted in a modest increase in the proliferation, with 500 µM 1-MT showing an insignificant increase in T cell proliferation (p=0.06 compared to stimulated untreated MCEC) and 1000 µM 1-MT resulting in greater proliferation (p=0.004) (Fig. 4). These data suggest that IDO expression in the cornea does have a small effect on T cell proliferation, augmented in circumstances of inflammation in which there is IDO up-regulation.

thumbnail image

Figure 4. Effect of IDO expressed by corneal cells on T cell proliferation. Following stimulation for 48 h with pro-inflammatory cytokines, 1 × 105 MCEC were cultured with allogeneic T cells (1 × 105 cells/well). As a control T cells were incubated with unstimulated MCEC (bar labelled ‘APC alone’) or with no other cells. T cell proliferation was determined by [3H]thymidine incorporation on day 4. To determine if there was any functional effect of the IDO up-regulated by cytokine stimulation, IDO activity was inhibited by addition of the specific antagonist 1-MT. A small 1-MT dose-dependent increase in T cell proliferation is seen, indicating that there is some inhibitory effect of IDO on proliferation. 1-MT (500 µM) does not significantly alter T cell proliferation (p=0.6); however, on increasing the 1-MT dose to 1000 µM, T cell proliferation is significantly higher (p=0.02).

Download figure to PowerPoint

IDO mRNA expression is up-regulated following corneal allotransplantation

Having found that IDO expression in corneal endothelium is up-regulated by pro-inflammatory cytokines, we went on to use quantitative PCR to measure IDO mRNA levels in homogenised corneas obtained from both allogeneic and syngeneic grafts up to day 12. Median survival time (MST) of C3H allografts was 12 days and syngeneic BALB/c donor corneas showed no signs of rejection up to 50 days post transplantation. Considerable up-regulation of IDO mRNA was seen in allogeneic grafts, increasing from 100-fold on day 3 to 10 000-fold on day 12, at which time rejection was evident in all allografts (Fig. 5A). In striking contrast, maximal increase in expression in syngeneic corneal grafts was 100-fold, found at day 5 following transplantation, probably reflecting inflammation associated with non-specific surgical trauma.

thumbnail image

Figure 5. Function of IDO in the allogeneic response to cornea. (A) IDO mRNA was quantified by real-time PCR. Products shown result from RNA extracted from five pooled corneas at each time point following corneal transplantation. IDO mRNA levels are normalised to HPRT. Higher levels of IDO mRNA expression are seen in allogeneic than syngeneic corneas from day 3 following transplantation until rejection onset, observed at day 12 in each allograft recipient. Y-axis indicates fold change. (B) BALB/c mice received unilateral C3H donor corneal allografts and also subcutaneous implantation of a slow-release pellet either containing 1-MT (n=12) or placebo (n=12). No significant difference in survival (p=0.29) was found.

Download figure to PowerPoint

Inhibition of IDO has no effect on graft survival

To determine whether IDO mRNA up-regulation during allograft rejection correlated with functional IDO involvement in the allogeneic response, we inhibited IDO activity by systemic 1-MT treatment from the time of transplantation using slow-release pellets. No difference in allograft survival was found between the 1-MT-treated (MST 11 days) and the placebo pellet-treated (MST 12 days) groups (p=0.29, Fig. 5B).

Vector-mediated IDO gene over-expression in corneal endothelial cells

We investigated the feasibility of over-expression of IDO in corneal endothelial cells. Use of equine infectious anaemia virus (EIAV) as a vector for gene transfer was based on previous reports of efficient and long-term gene transfer to corneal cells with lentiviral vectors 19, 20. Following IDO transduction, we detected high-level expression of IDO in MCEC at mRNA (Fig. 6A) and protein (Fig. 6C) level. Using confocal microscopy, we demonstrated that expression of IDO in MCEC following transfection was intracellular (Fig. 6E). Immunohistochemistry of intact transduced corneas demonstrated that IDO expression was confined to the corneal endothelial layer IDO (Fig. 6F).

thumbnail image

Figure 6. Transduction of corneal cells by EIAV-mediated transfer of IDO cDNA. Increasing efficiency of gene transfer to MCEC at 3 days post infection is seen as the MOI is increased from 10 to 200 as determined by: (A) RT-PCR for IDO mRNA, (B) β-actin mRNA shown as a housekeeping control and (C) Western blotting for IDO protein. (D) IDO mRNA in MCEC treated with cytokines: lane 1, unstimulated; lane 2, 80 ng/mL IFN-γ; lane 3, 40 ng/mL IFN-γ; lane 4, 40 ng/mL IFN-γ + 40 ng/mL TNF; with corresponding β-actin bands. (E) Confocal microscopy indicates IDO protein to be intracellular by anti-IDO antibody (green); cell nuclei (blue) and cytoskeletal F-actin (red) are also shown. (F) IDO expression is shown to be localised to the endothelium (arrow) in transduced full-thickness corneas.

Download figure to PowerPoint

Functional effects of IDO following over-expression by corneas

To confirm that IDO gene transfer leads to increased functional enzymatic activity, we measured the levels of the tryptophan metabolite L-kynurenine in conditioned medium derived from MCEC maintained in culture following transduction at a multiplicity of infection (MOI) of 100 with EIAV-IDO, control EIAV-GFP or mock-infected. In comparison with mock or control transduction, treatment with EIAV-IDO resulted in dose-dependent augmentation of L-kynurenine (Fig. 7A). Transduction of MCEC with EIAV-IDO, but not EIAV-eGFP, at an MOI of 100 resulted in inhibition of allogeneic T cell proliferation (Fig. 7B), which could be reversed by addition of 1-MT, demonstrating that it was due to over-expression of IDO.

thumbnail image

Figure 7. IDO overexpression in corneal cells results in dose-dependent IDO enzymatic activity and inhibition of allogeneic T cell proliferation. (A) Three days following MCEC incubation with virus-free medium, EIAV-eGFP, EIAV-IDO (MOI 50 or 100), the concentration of L-kynurenine in the culture supernatant was measured. Increased L-kynurenine is seen in the supernatant of MCEC transduced with EIAV-IDO. (B) A mixed lymphocyte reaction was carried out by incubation of 1 × 105 T cells with 1 × 106 unmodified or EIAV-eGFP or EIAV-IDO transduced (MOI 50) MCEC. The MCEC were stimulated with 100 ng/mL IFN-γ for 48 h. In some wells 500 µM or 1000 µM 1-MT was added for the entire MLR. Proliferation was determined after 72 h by [3H]thymidine incorporation. Transduction of MCEC with EIAV-IDO results in inhibition of the MLR, which is reversed by addition of 1-MT. Histogram bars indicate a mean of three assays and proliferation counts.

Download figure to PowerPoint

IDO over-expression in donor cornea results in prolongation of allograft survival

While on the one hand, we had found that IDO mRNA expression increased prior to corneal allograft rejection onset, we were prompted by the effects on allogeneic T cells of IDO overexpression in corneal cells in vitro to examine the effect in vivo of donor cornea IDO over-expression on graft survival. Excised donor C3H corneas were transduced with EIAV-IDO (n=15), EIAV-GFP (n=8) or incubated in virus-free medium (n=6) for 60 min ex vivo prior to transplantation into BALB/c recipients. Significantly prolonged survival of IDO-transduced allografts (MST 21 days) resulted, compared to GFP-transduced (MST 11 days, p=0.0001) or mock-transduced corneas (MST 11 days, p=0.0003) (Fig. 8A).

thumbnail image

Figure 8. IDO over-expression in donor corneas results in prolonged allograft survival. Excised donor C3H corneas were transduced with EIAV-IDO, EIAV-eGFP or maintained in virus-free medium for 60 min ex vivo prior to transplantation. (A) Unilateral transplants were performed. Significantly prolonged survival of IDO-transduced allografts (MST 21 days) is seen compared to GFP-transduced (MST 12 days) or mock-transduced corneas (MST 11 days). Of 12 IDO-transduced syngeneic grafts, 10 maintain normal function for the 50-day observation period. (B) Bilateral transplants were performed in which an IDO-transduced cornea was grafted to one eye and a GFP-transduced cornea was grafted to the other. Prolonged survival of IDO-transduced allografts (MST 21 days) is seen compared to GFP-transduced corneas (MST 17 days).

Download figure to PowerPoint

To determine whether IDO was acting on afferent or efferent components of the allogeneic response, bilateral transplants (n=6) were performed in which an IDO-transduced cornea was grafted in one eye and a GFP-transduced cornea was grafted to the other. The survival of IDO-transduced allografts (MST 21 days) was greater than that of GFP-transduced corneas (MST 17 days, p=0.03), and no IDO-transduced cornea was rejected before its contralateral counterpart (Fig. 8B), indicating that IDO expression had a local effect, presumably on the efferent arm of the immune response. However, the survival of GFP over-expressing corneas on the contralateral side (MST 17 days) was also extended compared to survival of unilateral GFP over-expressing corneal allografts in unilateral transplantation (MST 12 days, p=0.008). This suggests that at least some of the effect of IDO in allotransplantation is due to IDO modulation of the afferent component of the allogeneic response, delaying rejection of a genetically identical, but not IDO over-expressing, cornea transplanted contemporaneously.

To determine the kinetics of IDO mRNA expression in transduced corneas following transplantation and to compare with expression in unmodified corneas following transplantation, corneas were removed at selected time points from day 5 to day 35 following transplantation. As higher levels of IDO mRNA expression were sustained to days 25–35 in syngeneic transduced than allogeneic transduced corneas (Fig. 9A), this is likely to be due to loss of donor endothelial cells due to rejection in a high proportion of allografts. It is noteworthy that higher levels of IDO mRNA were found at the same time points in IDO-transduced corneas than in untransduced allografts prior to and at the time of observed rejection in the latter. To examine whether the transduced corneas were still expressing IDO at the time of rejection, corneas were harvested on days 5 and 15 (prior to rejection onset) and on days 25 and 35 (after rejection). Immunohistochemistry indicated that IDO was expressed in the endothelial layer (data not shown). However, it was not possible to determine if this was due to endogenous or transduced expression. Quantitative RT-PCR and Western blotting showed similar IDO expression (Fig. 9A, B). We also performed PCR for DNA containing the WPRE sequence, which is carried on the vector. The presence of this sequence could only be explained by the presence of viral DNA, presumably integrated into the genome of the cell. As can be seen (Fig. 9C), this viral sequence could be seen as late as day 35 after transplantation, although the levels were reduced, presumably due to death of transduced donor endothelial cells during rejection.

thumbnail image

Figure 9. Kinetics of IDO over-expression. To determine the kinetics of IDO expression in vivo following transduction with EIAV-IDO, corneas from EIAV-IDO transduced syngeneic and allografts were removed on days 5, 15, 25 and 35. Protein and mRNA from five corneas at each time point were pooled. The allograft samples from days 25 and 25 were taken post rejection. IDO expression was determined using RT-PCR for mRNA (A, in which Y-axis indicates fold change) and Western blotting for IDO protein (B). As can be seen, there is IDO expression at day 35; however, it was not possible to differentiate between endogenous and exogenous IDO expression. To detect viral DNA, real-time PCR was performed on DNA derived from the same samples to detect the WPRE region of the viral genome (C). While there is a significant decrease in WPRE levels by day 35 (presumably due to loss of endothelial cells during rejection), the virus-derived sequence are still detectable at all time points. WPRE is not detectable in normal cornea.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Considerable evidence derived from a number of in vitro studies and disease models now points to a role for IDO in T cell suppression and tolerance induction. Constitutive or inducible IDO has been demonstrated to function in a range of adaptive immune responses 21. The earliest report that IDO might function as a natural immunoregulatory mechanism was based on data demonstrating that IDO inhibited maternal T cell immunity to fetal tissue 13. In comparison to placenta, we found that a low level of IDO was expressed in cornea. Consistent with published findings in brain microvascular endothelial cells 22 and microglia 23, we found that IDO was inducible in cornea by inflammatory mediators. In particular, TNF acted synergistically with IFN-γ to enhance IDO expression 23, 24. Although IDO in the cornea was biologically active, as determined by an assay for the tryptophan degradation product L-kynurenine, inhibition of IDO did not shorten graft survival nor was it capable of meaningful enhancement of allogeneic T cell responses to corneal endothelial cells in vitro. This indicates that it does not have a role in our high-responder donor-recipient strain combination model in preventing corneal allograft rejection. It might, however, operate in weaker responding strains. While IDO expression might be considered a relatively minor aspect of privilege in the context of transplantation, it might be significant for other immunological challenges with weaker antigens. In addition, up-regulation of IDO by inflammatory cytokines may operate as an immune protection mechanism in the eye, as depletion of tryptophan will inhibit growth of infectious pathogens 25, 26, or more generally constitute a negative feedback loop to limit immune responses in the anterior chamber.

During corneal allograft rejection, there is secretion of a range of pro-inflammatory cytokines, including TNF 25 and IFN-γ 2729. There is up-regulation of cytokines in both syngeneic and allogeneic grafts, although this is higher at later time points in allogeneic grafts undergoing rejection, and high levels of IFN-γ were only ever seen in allografts 28. Following corneal transplantation, we found a very significant up-regulation of IDO mRNA in allograft corneas compared to syngeneic controls, and increasing to the time of rejection onset. As treatment of graft recipients with the competitive inhibitor 1-MT had no effect on allograft survival, we consider that this IDO mRNA up-regulation corresponds to increased cytokine activity in syngeneic and allogeneic transplanted tissue; although IDO may or may not be functionally active, it is not effective at blocking rejection. The possibility raised by a recent report that cross-linking of CD80/CD86 by the costimulatory molecule CTLA-4 induces IDO via IFN-γ up-regulation 30 can be discounted as a mechanism for IDO regulation in corneal endothelium, as we have found that MCEC do not express CD80 or CD86 molecules (manuscript in preparation).

The biologically insignificant effect of endogenous IDO in corneal endothelial cells on allogeneic T cell proliferation in vitro (as seen in Fig. 4) and also the finding that IDO blockade did not significantly shorten corneal allograft survival prompted our strategy to increase IDO function by a gene-based approach. In this way we tested the hypothesis that over-expression of IDO in donor cornea would extend allograft survival. Over-expression of IDO has been shown to increase survival of pancreatic islet allografts 17. Furthermore, we and others have shown that dendritic cells transduced or transfected with the gene encoding IDO can inhibit allogeneic T cell responses, either inducing apoptosis in the T cells or rendering them anergic to the alloantigen 31, 32.

The endothelial monolayer on the intraocular surface of the cornea is responsible for maintenance of corneal transparency, and therefore for donor graft function. The endothelial cells, which replicate at low rates in humans 33, are the critical target for intraocular allogeneic effector cells in rejection 34. For these reasons, but also on account of the accessibility of the endothelium and feasibility of storage of excised donor corneas ex vivo for extended periods, corneal endothelium is an appealing target for gene-based approaches to immunomodulation and protection 3537. In these studies we used the lentivirus EIAV as the vector for gene transfer, on account of longer term transgene expression and minimal immunogenicity seen with this vector 38, 39. It has been previously demonstrated that a lentivirus containing a reporter gene transduces corneal endothelial cells efficiently, and expression is persistent in corneal cultures maintained up to 60 days.19 We observed expression of IDO in the cornea at the time of rejection (up to 35 days following transplantation), although there may have been a contribution from endogenous IDO. More significantly, viral DNA was present in the corneas at these times, although the levels of virus present were reduced as might be expected following damage to the endothelial cells.

Donor corneas that had been transduced with EIAV-IDO survived longer in allogeneic recipients than mock-infected or EIAV-GFP transduced negative controls. When bilateral grafts were performed, in which IDO- and GFP-transduced corneas were transplanted at the same time, the IDO expressing grafts always survived longer than the GFP grafts (except in one animal when rejection was simultaneous). This indicates that at least some of the effect of IDO over-expression is local, and is on the efferent arm of the rejection response. However, in otherwise identical experimental conditions, GFP over-expressing allografts survived longer in hosts which received a contralateral IDO over-expressing cornea than in hosts in which the contralateral eye did not receive a graft. One possible explanation is that at least some of the effect of IDO in allotransplantation is due to modulation of the afferent arm of the allogeneic response. However this finding must be interpreted with caution and will be further investigated. Finally, although IDO over-expression has been demonstrated to prolong corneal allograft survival, tolerance induction has not been examined or demonstrated.

In summary, these studies demonstrate that cornea is an immune privileged tissue in which IDO is normally expressed at a low, and possibly insignificant, level. In keeping with reports on other cell types, functional activity of IDO is induced by pro-inflammatory mediators. However, inhibition of IDO activity has no effect on graft survival and little effect on allogeneic T cell proliferation. Vector-mediated IDO over-expression significantly extends survival of corneal allografts following transduction of excised donor cornea ex vivo prior to transplantation. While the mechanisms of IDO modulation of the allogeneic response in this setting have yet to be clarified, there is a clear potential role for ex vivo IDO gene transfer in transplantation of corneas and possibly other tissues.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Cell culture

SV-40-immortalized BALB/c strain corneal endothelial cells (MCEC, a gift from Dr J. Y. Niederkorn, Dallas, TX) were maintained in Eagle's MEM supplemented with 1% (vol) penicillin and streptomycin and non-essential amino acids (Gibco-BRL, Paisley, UK) and 10% decomplemented FCS (Gibco-BRL). Cells were cultured at 37°C in 5% CO2 in 75-cm2 flasks (T-75; Corning Inc, Acton, MA), and passaged using 0.05% trypsin and 0.02% EDTA 30.

Cytokine treatment

Recombinant murine pro-inflammatory cytokines TNF and IFN-γ (PeproTech EC, London, UK) were added directly to cell cultures at final concentrations of between 25 ng/mL and 100 ng/mL and subsequently cultured for 48 h. Cells were cultured to 70% confluence during routine culture and prior to stimulation.

RNA extraction and reverse transcription

Corneal tissue was ground using the beads and reagent supplied with the Fast RNA Pro Green Kit (QBiogene, Carlsbad, CA). RNA extraction and quantification was performed as previously described 28. Before the reverse transcription, RNA were treated with RNase-free DNase (RQ RNase-free DNase, Promega, Madison, WI) for 30 min to eliminate genomic DNA contamination. Extracted RNA (5 μg) was subjected to reverse transcription using random primers (Amersham Pharmacia Biotech, Amersham, UK) and M-MLV reverse transcriptase (Invitrogen, Life Technologies, Grand Island, NY). The protocol provided by the enzyme manufacturer was strictly followed except in the omission from the reaction mix of DTT, which was found to reduce the efficiency of the real-time PCR and did not result in any difference in cDNA formation. The RT products were then double-diluted so that more volume could be added to the PCR reaction mix to reduce errors in pipetting.

Quantitative PCR

The PCR protocol comprised an initial denaturation step at 95ºC for 3 min followed by 40 cycles of amplification. The conditions were denaturation at 95°C for 5 s, annealing at 56°C for 10 s, elongation at 72°C for 13 s, and quantitation at 81°C (once). Amplification was performed using a LightCycler machine (Roche Molecular Biochemicals, Hertfordshire, UK) and the HotStart Sybr-Green mastermix (Roche), according to the manufacturer's protocols. Specificity of the amplification was assessed by the melting temperature of the product determined using the LightCycler. Quantitative, real-time PCR data were analysed with LightCycler software (Roche). Quantification of IDO mRNA was carried out using the paired primers 3′-TGGCAAACTGGAAGAAAAAG-5′ (forward) and 3′-AATGCTTTCAGGTCTTGACG-5′ (reverse) spanning 197 bp of the IDO gene. Transcripts were normalised to levels of hypoxanthine phosphoribosyl transferase (HPRT) mRNA, using a plasmid encoding a fragment of the HPRT gene. This plasmid was obtained by amplification of a 176-bp fragment of the HPRT gene from a plasmid encoding HPRT gene 28 using the following primers (forward 3′-GTAATGATCCAGTCAACGGGGGAC-5′and reverse 3′-CCAGCAAGCTTGCAACCTTAACCA-5′). The PCR product was purified using Roche DNA purification kit and cloned into the pCMV script vector (Stratagene) by blunt end cloning. The same primers were used for quantification of HPRT mRNA.

Western blotting

Cell lysates were prepared by re-suspending 1 × 106 cells first in 250 µL lysis buffer (1% NP40, 150 mM NaCl, 5 mM MgCl2, 10 mM HEPES buffer, 1 mg/mL leupeptin, 1 mg/mL pepstatin A) and then an equal volume of 2* Laemmli sample buffer (125 mM Tris-HCl pH 6.8, 2% β-mercaptoethanol, 4.4% SDS, 0.01 mg/mL bromophenol blue, 20% glycerol). Protein samples were separated on 10% SDS-PAGE and then transferred to nitrocellulose membrane using standard electrophoretic transfer methods 40. Membranes were probed using anti-mouse IDO mAb (MAB5412, Chemicon, Temecula, CA), followed by rabbit anti-mouse antibody conjugated with horseradish peroxidase (Amersham Bioscience). Murine placenta lysates were used as a positive control. Blots were developed using ECL plus system (Amersham Pharmacia Biotech).

Immunoperoxidase staining

Immunohistochemistry was performed as previously described 41. Briefly, tissue embedded in paraffin was cut in 3–5-µm-thick sections, dried at 55°C for 2 h and then deparaffinized in xylene for 20 min, followed by hydration through graded alcohols. Endogenous peroxidase activity was blocked with 3% H2O2 in methanol. Non-specific binding was blocked using normal goat serum diluted 1:25 with PBS. Tissue proteolysis was performed by treatment with 0.1% protease (protease XIV, EC 3.4.24.31, Sigma, Vienna, Austria) in 0.05 M Tris-HCl, pH 7.6. After washing in EDTA-buffered saline (pH 7.6), sections were incubated with polyclonal rabbit anti-mouse IDO antibody (a kind gift of Dr. Osamu Takikawa, Hokkaido University, Sapporo, Japan) 42 diluted 1:100 for 18 h at 4°C. To prevent non-specific binding of the antibody, all sections were blocked for 45 min in 1:25 diluted goat serum. This was followed by the addition of biotinylated goat anti-rabbit antibody (Dakopatts, Glostrup, Denmark; 15 min, room temperature). After washes with Tris-HCl buffer (pH 7.4), sections were incubated with streptDAB Complex/HRP (Dako) for 5 min at room temperature. The reaction product was visualized with 3,3′-diaminobenzidine (Sigma) prior to counterstaining.

Measurement of L-kynurenine

The biological activity of IDO was evaluated by measuring levels of the tryptophan metabolite L-kynurenine in conditioned medium or culture supernatant as previously described 4345. Briefly, 2 mL of tissue culture medium was incubated with 2 mL 0.2 M trichloroacetic acid to precipitate the proteins. After centrifugation, 0.5 mL of supernatant was incubated with an equal volume of 2% dimethyl-p-aminobenzaldehyde in HCl (Sigma-Aldrich, UK) for 10 min at room temperature. Absorption of the resulting solution was measured at 490 nm by spectrophotometer. The values of kynurenine in conditioned medium were calculated by a standard curve with defined levels of kynurenine (Sigma) concentrations.

T cell proliferation assays

Lymph node and spleen cells from C57BL/6 mice were treated with a mixture of anti-CD45R/B220, anti-CD8 and anti-MHC class II supernatants (RA3–6B2, M5/114, YTS169, and YTS191) for 30 min. After antibody treatment, the cells were washed and incubated with goat anti-mouse IgG and goat anti-rat IgG coated beads (Dynal, Bromborough, UK) for 30 min. MHC class II-positive cells, B cells and CD8+ T cells bound to the beads were removed with a magnet. Responder CD4+ T cells (1 × 105 cells/well) were stimulated with irradiated (60 Gray) MCEC 1 × 104 in 96-well plates for 3 days. A previous experiment demonstrated that irradiation at this dose had no significant effect on L-kynurenine production by MCEC following IDO cDNA transfection (data not shown). Proliferation was measured by a 16-h pulse with [3H]thymidine (10 µL, ∼5 µCi/mL, Amersham Pharmacia Biotech) 46.

Corneal transplantation

Inbred adult female adult BALB/c mice (H-2d, Harlan Olac, Bicester, UK) received either BALB/c or C3H/He (H-2b, Harlan Olac) strain 2.5-mm diameter donor corneas as orthotopic transplants. Procedure for transplantation and post-operative assessment of rejection was as described 47, 48, with the assessment being done by a masked observer. All transplants were unilateral unless otherwise specified, on the right eye. Technically satisfactory grafts had corneal opacity grade 0–1 at all times until suture removal on day 7 47. In one experiment, mice received a slow release polymer pellet containing 1-MT (0.9 mg/h for 15 days) or placebo (Innovative Research of America, Sarasota, FL) subcutaneously as described previously 49. Animals were maintained in a specific pathogen-free facility and at all times were treated in accordance with the United Kingdom Home Office regulations for care of experimental animals.

Replication-defective EIAV vector production

An EIAV lentiviral construct was generated encoding IDO. The gene for murine IDO was amplified from mature dendritic cells by PCR using 5′-ATCGTTAATTAAGTGGGGGGTCAGTGGAGTAG-3′ (forward) and 5′-ATCGGCTAGCCTGTGCCCTGATAGAAGTGG-3′ (reverse) as primers. The PCR conditions were as follows: 95°C for 5 min, followed by 25 cycles with 95°C, 58°C and 72°C for 30 s each. The PCR was completed with a final 10-min extension at 72°C. To generate the plasmid designated pSMART-IDO, plasmid pSMART2G 50 was cut with HindIII and XhoI restriction enzymes, removing the enhanced GFP gene originally present. A linker oligonucleotide (forward AGCTTAGCGTTAATTAAAGCTGGTACCAGCTGCTAGCAGCTC, reverse TCGAGAGCTGCTAGCAGCTGGTACCAGCTTTAATTAACGCTA) containing HindIII, PacI, KpnI, NheI and XhoI-restriction site was ligated into the plasmid using T4 ligase. The gene for IDO was inserted between the PacI and NheI sites. All restriction enzymes and DNA-modifying enzymes were purchased from New England Biolabs (Beverly, MA). The cloned IDO insert was confirmed by sequencing, and the resulting plasmid designated pSMART-IDO.

Lentiviral vectors encoding IDO (EIAV-IDO) or eGFP (EIAV-GFP, as a control) were produced using the plasmids pSMART-IDO, pSMART2G, pONY3.1 and pRV67 as described elsewhere 51, 52. The concentration of viruses was measured using quantitative PCR of DNA sequences found in the woodchuck hepatitis post-regulatory element (WPRE) since a marker gene was not present in the EIAV-IDO construct to allow direct visualization 53.

Gene transfer to cornea

MCEC were transduced with EIAV-IDO or EIAV-GFP at a final MOI of 10–200. As an additional negative control, we used virus-free medium. Medium was exchanged with full medium after 1 h. Gene transfer to full-thickness corneas was carried out as previously described 35, 54, corneal specimens were incubated in 250 µL of the virus preparation at an MOI of 100 for 60 min prior to transplantation. MOI was estimated based on the known density of corneal endothelial cells in untreated specimens 55. Persistence of the virus was confirmed using quantitative PCR, quantifying the WPRE region within the virus 53.

Confocal microscopy

Confocal imaging was performed as described 56. Briefly, cells were grown on coverslips (borosilicate, 16 mm, No. 1; VWR, Poole, UK). Following transduction, cells were washed in PBS and fixed in 4% paraformaldehyde for 15 min at 4°C. They were then permeabilised with PBS containing 0.1% Triton X-100–5% FCS and stained with phalloidin-TRITC (Sigma Aldrich) to detect F-actin. Cells were then washed with PBS for three times for 5 min and then incubated with 1:50 diluted rabbit anti-mouse IDO antibody 38. The IDO was detected with rabbit-specific secondary antibody conjugated to Alexa-488 (Molecular Probes, Eugene, OR) as described previously 57. Cells were then washed twice in PBS and once in water, mounted and subsequently analysed using a Zeiss META confocal microscope linked to LSM 510 imaging software (Carl Zeiss, Jena, Germany). The acquired images were post-processed using the Zeiss LSM software and Adobe Photoshop 7 and are presented as single X-Y sections.

Statistical analysis

Mean values with SD are given for all data. Statistical differences were calculated using a two-tailed and paired t-test, using Bonferroni correction for multiple comparisons. Differences in graft survival were analysed using log rank test and plotted according to the Kaplan-Meyer-method. Differences in survival of bilateral corneal grafts were analysed using a Wilcoxon signed rank test. All statistical analyses were performed using GraphPad Prism version 4.00 for Windows, GraphPad Software (San Diego, CA). A value of p<0.05 was regarded as statistically significant.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Research training fellowships from Gertrud-Kusen-Stiftung Foundation, Germany (S.C.B.), the Wellcome Trust (071527, M.P.W.) and Royal College of Surgeons of Edinburgh/MRC (P.H.T.), a Research Development Fellowship from the Biotechnology and Biological Sciences Research Council (A.J.T.G.) and Action Medical Research (project grant SP 3683).

  • 1

    WILEY-VCH

  • 2

    WILEY-VCH

  • 3

    WILEY-VCH

  • 4

    WILEY-VCH

  • 5

    WILEY-VCH

  • 6

    WILEY-VCH

  • 7

    WILEY-VCH

  • 8

    WILEY-VCH

  • 9

    WILEY-VCH

  • 1
    Ross, J., He, Y. G., Pidherney, M., Mellon, J. and Niederkorn, J. Y., The differential effects of donor versus host Langerhans cells in the rejection of MHC-matched corneal allografts. Transplantation 1991. 52: 857861.
  • 2
    Griffith, T. S., Brunner, T., Fletcher, S. M., Green, D. R. and Ferguson, T. A., Fas ligand-induced apoptosis as a mechanism of immune privilege. Science 1995. 270: 11891192.
  • 3
    Sonoda, A., Sonoda, Y., Muramatu, R., Streilein, J. W. and Usui, M., ACAID induced by allogeneic corneal tissue promotes subsequent survival of orthotopic corneal grafts. Invest. Ophthalmol. Vis. Sci. 2000. 41: 790798.
  • 4
    Niederkorn, J. Y., The immune privilege of corneal allografts. Transplantation 1999. 67: 15031508.
  • 5
    George, A. J. T. and Larkin, D. F. P., Corneal transplantation: the forgotten graft. Am. J. Transplant. 2004. 4: 678685.
  • 6
    Higuchi, K. and Hayaishi, O., Enzymic formation of d-kynurenine from d-tryptophan. Arch. Biochem. Biophys. 1967. 120: 397403.
  • 7
    Dai, W. and Gupta, S. L., Regulation of indoleamine 2,3-dioxygenase gene expression in human fibroblasts by interferon-gamma. Upstream control region discriminates between interferon-gamma and interferon-alpha. J. Biol. Chem. 1990. 265: 1987119877.
  • 8
    Carlin, J. M., Borden, E. C., Sondel, P. M. and Byrne, G. I., Interferon-induced indoleamine 2,3-dioxygenase activity in human mononuclear phagocytes. J. Leukoc. Biol. 1989. 45: 2934.
  • 9
    Hwu, P., Du, M. X., Lapointe, R., Do, M., Taylor, M. W. and Young, H. A., Indoleamine 2,3-dioxygenase production by human dendritic cells results in the inhibition of T cell proliferation. J. Immunol. 2000. 164: 35963599.
  • 10
    Taylor, M. W. and Feng, G. S., Relationship between interferon-gamma, indoleamine 2,3-dioxygenase, and tryptophan catabolism. FASEB J. 1991. 5: 25162522.
  • 11
    Munn, D. H., Shafizadeh, E., Attwood, J. T., Bondarev, I., Pashine, A. and Mellor, A. L., Inhibition of T cell proliferation by macrophage tryptophan catabolism. J. Exp. Med. 1999. 189: 13631372.
  • 12
    Frumento, G., Rotondo, R., Tonetti, M., Damonte, G., Benatti, U. and Ferrara, G. B., Tryptophan-derived catabolites are responsible for inhibition of T and natural killer cell proliferation induced by indoleamine 2,3-dioxygenase. J. Exp. Med. 2002. 196: 459468.
  • 13
    Munn, D. H., Zhou, M., Attwood, J. T., Bondarev, I., Conway, S. J., Marshall, B., Brown, C. et al., Prevention of allogeneic fetal rejection by tryptophan catabolism. Science 1998. 281: 11911193.
  • 14
    Pfefferkorn, E. R., Interferon gamma blocks the growth of Toxoplasma gondii in human fibroblasts by inducing the host cells to degrade tryptophan. Proc. Natl. Acad. Sci. USA 1984. 81: 908912.
  • 15
    Bodaghi, B., Goureau, O., Zipeto, D., Laurent, L., Virelizier, J. L. and Michelson, S., Role of IFN-gamma-induced indoleamine 2,3 dioxygenase and inducible nitric oxide synthase in the replication of human cytomegalovirus in retinal pigment epithelial cells. J. Immunol. 1999. 162: 957964.
  • 16
    Yoshida, R., Park, S. W., Yasui, H. and Takikawa, O., Tryptophan degradation in transplanted tumor cells undergoing rejection. J. Immunol. 1988. 141: 28192823.
  • 17
    Alexander, A. M., Crawford, M., Bertera, S., Rudert, W. A., Takikawa, O., Robbins, P. D. and Trucco, M., Indoleamine 2,3-dioxygenase expression in transplanted NOD islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. Diabetes 2002. 51: 356365.
  • 18
    Larkin, D. F. P., Calder, V. L. and Lightman, S. L., Identification and characterisation of cells infiltrating the graft and aqueous humour in rat corneal allograft rejection. Clin. Exp. Immunol. 1997. 107: 381391.
  • 19
    Wang, X., Appukuttan, B., Ott, S., Patel, R., Irvine, J., Song, J., Park, J. H. et al., Efficient and sustained transgene expression in human corneal cells mediated by a lentiviral vector. Gene Ther. 2000. 7: 196200.
  • 20
    Bainbridge, J. W., Stephens, C., Parsley, K., Demaison, C., Halfyard, A., Thrasher, A. J. and Ali, R. R., In vivo gene transfer to the mouse eye using an HIV-based lentiviral vector; efficient long-term transduction of corneal endothelium and retinal pigment epithelium. Gene Ther. 2001. 8: 16651668.
  • 21
    Mellor, A. L. and Munn, D. H., IDO expression by dendritic cells: tolerance and tryptophan catabolism. Nat. Rev. Immunol. 2004. 4: 762774.
  • 22
    Adam, R., Russing, D., Adams, O., Ailyati, A., Sik Kim, K., Schroten, H. and Daubener, W., Role of human brain microvascular endothelial cells during central nervous system infection. Significance of indoleamine 2,3-dioxygenase in antimicrobial defence and immunoregulation. Thromb. Haemost. 2005. 94: 341346.
  • 23
    Kwidzinski, E., Bunse, J., Aktas, O., Richter, D., Mutlu, L., Zipp, F., Nitsch, R. et al., Indoleamine 2,3-dioxygenase is expressed in the CNS and down-regulates autoimmune inflammation. FASEB J. 2005. 19: 13471349.
  • 24
    Robinson, C. M., Shirey, K. A. and Carlin, J. M., Synergistic transcriptional activation of indoleamine dioxygenase by IFN-gamma and tumor necrosis factor-alpha. J. Interferon Cytokine Res. 2003. 23: 413421.
  • 25
    Carlin, J. M., Borden, E. C. and Byrne, G. I., Interferon-induced indoleamine 2,3-dioxygenase activity inhibits Chlamydia psittaci replication in human macrophages. J. Interferon Res. 1989. 9: 329337.
  • 26
    Beatty, W. L., Belanger, T. A., Desai, A. A., Morrison, R. P. and Byrne, G. I., Tryptophan depletion as a mechanism of gamma interferon-mediated chlamydial persistence. Infect. Immun. 1994. 62: 37053711.
  • 27
    Rayner, S. A., King, W. J., Comer, R. M., Isaacs, J. D., Hale, G., George, A. J. and Larkin, D. F. P., Local bioactive tumour necrosis factor (TNF) in corneal allotransplantation. Clin. Exp. Immunol. 2000. 122: 109116.
  • 28
    King, W. J., Comer, R. M., Hudde, T., Larkin, D. F. P. and George, A. J. T., Cytokine and chemokine expression kinetics after corneal transplantation. Transplantation 2000. 70: 12251233.
  • 29
    Huq, S., Liu, Y., Benichou, G. and Dana, M. R., Relevance of the direct pathway of sensitization in corneal transplantation is dictated by the graft bed microenvironment. J. Immunol. 2004. 173: 44644469.
  • 30
    Grohmann, U., Orabona, C., Fallarino, F., Vacca, C., Calcinaro, F., Falorni, A., Candeloro, P. et al., CTLA-4-Ig regulates tryptophan catabolism in vivo. Nat. Immunol. 2002. 3: 10971101.
  • 31
    Funeshima, N., Fujino, M., Kitazawa, Y., Hara, Y., Hayakawa, K., Okuyama, T., Kimura, H. et al., Inhibition of allogeneic T-cell responses by dendritic cells expressing transduced indoleamine 2,3-dioxygenase. J. Gene Med. 2004. 7: 565575.
  • 32
    Tan, P. H., Beutelspacher, S. C., Wang, Y. H., McClure, M. O., Ritter, M. A., Lombardi, G. and George, A. J., Immunolipoplexes: an efficient, non-viral alternative for transfection of human dendritic cells with potential for clinical vaccination. Mol. Ther. 2005. 11: 790800.
  • 33
    Joyce, N. C., Meklir, B., Joyce, S. J. and Zieske, J. D., Cell cycle protein expression and proliferative status in human corneal cells. Invest. Ophthalmol. Vis. Sci 1996. 37: 645655.
  • 34
    Sagoo, P., Chan, G., Larkin, D. F. P. and George, A. J. T., Inflammatory cytokines induce apoptosis of corneal endothelium through nitric oxide. Invest. Ophthalmol. Vis. Sci. 2004. 45: 39643973.
  • 35
    Oral, H. B., Larkin, D. F., Fehervari, Z., Byrnes, A. P., Rankin, A. M., Haskard, D. O., Wood, M. J. et al., Ex vivo adenovirus-mediated gene transfer and immunomodulatory protein production in human cornea. Gene Ther. 1997. 4: 639647.
  • 36
    Klebe, S., Sykes, P. J., Coster, D. J., Krishnan, R. and Williams, K. A., Prolongation of sheep corneal allograft survival by ex vivo transfer of the gene encoding interleukin-10. Transplantation 2001. 71: 12141220.
  • 37
    Arancibia-Carcamo, C. V., Oral, H. B., Haskard, D. O., Larkin, D. F. and George, A. J., Lipoadenofection-mediated gene delivery to the corneal endothelium: prospects for modulating graft rejection. Transplantation 1998. 65: 6267.
  • 38
    Naldini, L. and Verma, I. M., Lentiviral vectors. Adv. Virus Res. 2000. 55: 599609.
  • 39
    O'Rourke, J. P., Hiraragi, H., Urban, K., Patel, M., Olsen, J. C. and Bunnell, B. A., Analysis of gene transfer and expression in skeletal muscle using enhanced EIAV lentivirus vectors. Mol. Ther. 2003. 7: 632639.
  • 40
    Sambrook, J., Maniatis, T. and Fritsch, E. F., Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbour Laboratory, New York 1989
  • 41
    Depboylu, C., Reinhart, T. A., Takikawa, O., Imai, Y., Maeda, H., Mitsuya, H., Rausch, D. et al., Brain virus burden and indoleamine-2,3-dioxygenase expression during lentiviral infection of rhesus monkey are concomitantly lowered by 6-chloro-2′,3′-dideoxyguanosine. Eur. J. Neurosci. 2004. 19: 29973005.
  • 42
    Takikawa, O., Littlejohn, T. K. and Truscott, R. J., Indoleamine 2,3-dioxygenase in the human lens, the first enzyme in the synthesis of UV filters. Exp. Eye Res. 2001. 72: 271277.
  • 43
    Takikawa, O., Kuroiwa, T., Yamazaki, F. and Kido, R., Mechanism of interferon-gamma action. Characterization of indoleamine 2,3-dioxygenase in cultured human cells induced by interferon-gamma and evaluation of the enzyme-mediated tryptophan degradation in its anticellular activity. J. Biol. Chem 1988. 263: 20412048.
  • 44
    Feng, G. S. and Taylor, M. W., Interferon gamma-resistant mutants are defective in the induction of indoleamine 2,3-dioxygenase. Proc. Natl. Acad. Sci. USA 1989. 86: 71447148.
  • 45
    Damonte, G., Sdraffa, A., Zocchi, E., Guida, L., Polvani, C., Tonetti, M., Benatti, U. et al., Multiple small molecular weight guanine nucleotide-binding proteins in human erythrocyte membranes. Biochem. Biophys. Res. Commun. 1990. 166: 13981405.
  • 46
    Tsang, J. Y., Chai, J. G. and Lechler, R., Antigen presentation by mouse CD4+ T cells involving acquired MHC class II:peptide complexes: another mechanism to limit clonal expansion? Blood 2003. 101: 27042710.
  • 47
    Ardjomand, N., McAlister, J. C., Rogers, N. J., Tan, P. H., George, A. J. and Larkin, D. F. P., Modulation of costimulation by CD28 and CD154 alters the kinetics and cellular characteristics of corneal allograft rejection. Invest. Ophthalmol. Vis. Sci. 2003. 44: 38993905.
  • 48
    Zhang, E. P., Schrunder, S. and Hoffmann, F., Orthotopic corneal transplantation in the mouse–a new surgical technique with minimal endothelial cell loss. Graefes Arch. Clin. Exp. Ophthalmol. 1996. 234: 714719.
  • 49
    Seo, S. K., Choi, J. H., Kim, Y. H., Kang, W. J., Park, H. Y., Suh, J. H., Choi, B. K. et al., 4–1BB-mediated immunotherapy of rheumatoid arthritis. Nat. Med. 2004. 10: 10881094.
  • 50
    Bienemann, A. S., Martin-Rendon, E., Cosgrave, A. S., Glover, C. P., Wong, L. F., Kingsman, S. M., Mitrophanous, K. A. et al., Long-term replacement of a mutated nonfunctional CNS gene: reversal of hypothalamic diabetes insipidus using an EIAV-based lentiviral vector expressing arginine vasopressin. Mol. Ther. 2003. 7: 588596.
  • 51
    Tan, P. H., Beutelspacher, S. C., Xue, S. A., Wang, Y. H., Mitchell, P., McAlister, J. C., Larkin, D. F. et al., Modulation of human dendritic cell function following transduction with viral vectors; implications for gene therapy. Blood 2005. 105:38243832.
  • 52
    Beutelspacher, S. C., Ardjomand, N., Tan, P. H., Patton, G. S., Larkin, D. F., George, A. J. and McClure, M. O., Comparison of HIV-1 and EIAV-based lentiviral vectors in corneal transduction. Exp. Eye Res. 2005. 80: 787794.
  • 53
    Lizee, G., Aerts, J. L., Gonzales, M. I., Chinnasamy, N., Morgan, R. A. and Topalian, S. L., Real-time quantitative reverse transcriptase-polymerase chain reaction as a method for determining lentiviral vector titers and measuring transgene expression. Hum. Gene Ther. 2003. 14: 497507.
  • 54
    Larkin, D. F. P., Oral, H. B., Ring, C. J., Lemoine, N. R. and George, A. J. T., Adenovirus-mediated gene delivery to the corneal endothelium. Transplantation 1996. 61: 363370.
  • 55
    Behndig, A., Karlsson, K., Brannstrom, T., Sentman, M. L. and Marklund, S. L., Corneal endothelial integrity in mice lacking extracellular superoxide dismutase. Invest. Ophthalmol. Vis. Sci. 2001. 42: 27842788.
  • 56
    Manunta, M., Tan, P. H., Sagoo, P., Kashefi, K. and George, A. J., Gene delivery by dendrimers operates via a cholesterol dependent pathway. Nucleic Acids Res. 2004. 32: 27302739.
  • 57
    Munn, D. H., Sharma, M. D. and Mellor, A. L., Ligation of B7–1/B7–2 by human CD4+ T cells triggers indoleamine 2,3-dioxygenase activity in dendritic cells. J. Immunol. 2004. 172: 41004110.