SEARCH

SEARCH BY CITATION

Keywords:

  • Glucocorticoids;
  • Innate immunity;
  • Macrophage migration inhibitory factor;
  • Macrophages;
  • Mitogen-activated protein kinase phosphatase-1

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

The pro-inflammatory cytokine macrophage migration inhibitory factor (MIF) acts as a physiological counter-regulator of the immuno-suppressive effects of glucocorticoids. However, the mechanisms whereby MIF exerts its counter-balancing effect remain largely unknown. Here we report that MAPK phosphatase 1 (MKP-1), an archetypal member of dual specificity phosphatase that inactivates MAPK activity in response to pro-inflammatory stimuli, is a critical target of MIF-glucocorticoid crosstalk. Recombinant MIF counter-regulated in a dose-dependent fashion dexamethasone inhibition of TNF and IL-8 production by RAW 264.7 macrophages and U-937 promonocytes stimulated with lipoplysaccharides (LPS) or with LPS plus phorbol 12-myristate 13-acetate. Stimulation of RAW 264.7 macrophages with dexamethasone or dexamethasone plus LPS led to a robust up-regulation of MKP-1 mRNA and protein expressions that were counter-regulated by addition of recombinant MIF. Antisense MIF macrophages expressing reduced levels of endogenous MIF produced higher amount of MKP-1 and lower amount of TNF after exposure to dexamethasone and dexamethasone plus LPS, indicating that endogenous MIF acts in an autocrine fashion to override glucocorticoid-induced MKP-1 expression and inhibition of cytokine production. Taken together, these data identify MKP-1 as a molecular target of MIF-glucocorticoid crosstalk and provide a molecular basis for the control of macrophage responses by a pair of physiological regulators of innate immunity.

See accompanying commentary: http://dx.doi.org/10.1002/eji.200535556

Abbreviations:
ARE:

AU-rich elements

Dex:

Dexamethasone

ERK:

Extracellular-signal-regulated kinase

JNK:

c-jun-N-terminal kinase

MIF:

Macrophage migration inhibitory factor

MKP-1:

Mitogen-activated protein kinase phosphatase-1

UTR:

untranslated region

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Sensing and eliminating microbial pathogens is an essential function of the innate immune system 1. Mounting of an inflammatory response is critical for the host antimicrobial defenses and is triggered by the binding of microbial products to pathogen-recognition molecules expressed by innate immune cells. Cytokines are key immunoregulatory effector molecules coordinating the cellular and humoral responses intended to contain or eradicate invasive microorganisms. On the one hand, failure to mount an inflammatory response promotes unrestricted microbial proliferation and the development of life-threatening infections. On the other hand, superabundant production of pro-inflammatory mediators may also be life threatening, as observed in patients with severe sepsis or septic shock 2, 3. Innate immune responses must therefore be tightly regulated.

Counter-regulatory systems are needed to balance opposing pro-inflammatory and anti-inflammatory reactions. Glucocorticoids are key regulators of immune responses and powerful down-modulators of cytokine production 4. Several experimental and clinical lines of evidence support the critical role played by glucocorticoids in infection and immunity. First, adrenalectomy had been shown to increase susceptibility to infection and host responses to microbial products, including cytokine production 5. Secondly, concentrations of glucocorticoids are elevated during sepsis and endotoxemia 6. Thirdly, relative adrenal insufficiency is associated with poor outcome in septic patients 7. Fourthly, steroid replacement therapy has improved survival of patients with severe sepsis or septic shock and relative adrenal insufficiency 8.

Lately, macrophage migration inhibitory factor (MIF), has been shown to act as a physiological counter-regulator of the anti-inflammatory and immunosuppressive effects of glucocorticoids 9, 10. First described in the 1960s as a T-cell cytokine, MIF was rediscovered in the early 1990s as a neuroendocrine peptide and pivotal modulator of innate immunity (reviewed in 11). Constitutively expressed by endocrine and immune cells, MIF is released in a hormone-like fashion by the anterior pituitary gland and adrenal cortex after exposure to endotoxin (LPS), corticotropin-releasing hormone, or physiological stress 9, 10, 12, 13. Likewise, MIF is released by innate immune cells such as monocytes and macrophages when exposed to microbial products and pro-inflammatory mediators and promotes inflammatory and immune responses 14, 15. More recently, MIF has been shown to up-regulate the expression of TLR4 and to facilitate host responses to endotoxin-bearing bacteria 16 and to sustain pro-inflammatory function of macrophages by inhibiting p53-dependent apoptosis 17. MIF also activates the extracellular signal-regulated kinase-1/2 (ERK) MAPK pathway 18 and inhibits the activity of JAB-1/CSN5 a co-activator of the activator protein 1 (AP-1) 19. As a modulator of inflammatory and innate immune responses, MIF plays a pathogenic role in severe sepsis and septic shock, acute respiratory distress syndrome, rheumatoid arthritis, glomerulonephritis and inflammatory bowel diseases (reviewed in 11).

A rather unique and entirely unanticipated feature for a prototypical pro-inflammatory cytokine was the fact that glucocorticoids induced MIF release by immune cells, which then served to counterbalance the anti-inflammatory and immunosuppressive effects of glucocorticoids 10. Taken together with the fact that MIF is an integral component of the innate immune system, these data strongly suggest that MIF and glucocorticoids function as a physiological counter-regulatory dyad modulating inflammatory and immune responses. Yet, very little is known about the subcellular mechanisms whereby MIF counterbalances glucocorticoid-mediated inhibition of innate immune responses.

NF-κB and MAPK families play a seminal role in the activation and regulation of key molecules, including pro-inflammatory mediators, controlling innate and adaptive immune responses. Reversible activation of the three main members of the MAPK, ERK, c-jun-N-terminal kinase (JNK) and p38, requires phosphorylation on threonine and tyrosine residues of the activation domain of these kinases. MAPK activity is negatively regulated by a family of dual specificity protein phosphatases 2022. MAPK phosphatase 1 (MKP-1) (originally described as 3CH134 or its human homolog CL100) is a prototype of dual specificity phosphatase induced by mitogenic, stress and pro-inflammatory stimuli, that inactivates ERK, JNK and p38 MAPK 2325. Interestingly, MKP-1 was recently shown to be induced by glucocorticoids and to mediate glucocorticoid inhibition of ERK, JNK and p38 MAPK activities and cytokine production induced by pro-inflammatory stimuli such as LPS or IL-1 2629. Here, we report that MKP-1 is a critical target of MIF-glucocorticoid crosstalk regulating innate immune responses of macrophages. Dexamethasone or dexamethasone plus LPS up-regulates macrophage MKP-1 expression which is counter-regulated by endogenous MIF or exogenously added recombinant MIF acting in an autocrine fashion to override glucocorticoid inhibition of cytokine production.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

MIF counter-regulates dexamethasone inhibition of cytokine production by macrophages

Dexamethasone inhibited IL-8 and TNF production by U-937 monocytes and RAW 264.7 macrophages stimulated with LPS and PMA or with LPS, respectively (Fig. 1A and B). Treatment of U-937 and RAW 264.7 cells with MIF overcame, in a dose-dependent fashion, dexamethasone inhibition of IL-8 and TNF production. Maximum overriding effect occurred at a concentration of 10 ng/mL of MIF, which is well within the range of circulating concentrations of MIF measured in humans with infectious or inflammatory diseases 30, 31 and which was therefore used in subsequent experiments.

thumbnail image

Figure 1. MIF overcomes dexamethasone-induced inhibition of IL-8 and TNF protein and mRNA production by U-937 monocytes and RAW 264.7 macrophages. U-937 (A and C) and RAW 264.7 (B and D) cells were pre-incubated for 1 h with dexamethasone or with dexamethasone plus MIF at the indicated concentrations before stimulation with LPS and PMA (A and C) or with LPS (B and D). (A, B) Cell culture supernatants were harvested and concentrations of secreted cytokines quantified as described in Sect. 4. Data are mean ± SD of three separate experiments. *p = 0.06, 0.05, 0.05 and 0.009 versus U-937 cells pre-incubated with dexamethasone without MIF (A); *p = 0.001 versus RAW 264.7 cells pre-incubated with dexamethasone without MIF (B). (C, D) Northern blots of IL-8, TNF and GAPDH mRNA 4 h (C) and 2 h (D) after stimulation with LPS and PMA or LPS. Results are representative of two separate experiments.

Download figure to PowerPoint

We next performed Northern blot analyses of IL-8 and TNF mRNA expression by U-937 and RAW 264.7 cells pretreated with dexamethasone with or without recombinant MIF prior to stimulation. As shown in Fig. 1C and 1D, 1 nM of dexamethasone was sufficient to inhibit IL-8 mRNA in U-937 cells stimulated with LPS and PMA, whereas 10 nM of dexamethasone was needed to inhibit LPS-induced TNF mRNA in RAW 264.7 cells. As observed for cytokine secretion, treatment of cells with recombinant MIF restored IL-8 and TNF mRNA expression to levels almost similar to those measured in cells treated with LPS and PMA or with LPS.

TLR4 is not the target of the anti-glucocorticoid MIF effects

TLR are an essential component of the host innate immune antimicrobial defense system. Acting as sensors of microbes via the recognition of conserved microbial molecules, TLR activate signal transduction pathways resulting in the transcription of immunoregulatory genes 32, 33. We have shown recently that MIF up-regulates the expression of macrophage TLR4, the signal transducing molecule of the LPS receptor complex 34, promoting the recognition of LPS and Gram-negative bacteria by innate immune cells 16. TLR4 was therefore an obvious candidate as a target molecule of the antagonistic effects of MIF and glucocorticoids on macrophage activation by LPS. This hypothesis was tested by measuring TLR4 expression by RAW 264.7 macrophages exposed to dexamethasone (10–1000 nM). TLR4 cell surface levels remained unchanged 18 h after exposure to dexamethasone (Fig. 2A). Likewise, dexamethasone did not inhibit TLR4 mRNA steady state levels (Fig. 2B). As a positive control, TLR2 mRNA levels were found to be markedly reduced after dexamethasone treatment, a finding in agreement with a recent report 35. These results indicated that TLR4 was not a target molecule of the anti-glucocorticoid effects mediated by MIF.

thumbnail image

Figure 2. Dexamethasone does not inhibit TLR4 expression in RAW 264.7 macrophages. (A) Cells were cultured for 18 h with dexamethasone, stained with anti-TLR4-MD2 antibody and analyzed by flow cytometry. The dotted line shows the fluorescence of cells stained with specific antibody, whereas the grey area shows the fluorescence of cells stained with an isotype control antibody. Dexamethasone concentration (in nM) used during culture is shown in the upper right corner of each panel. (B) In parallel experiments, total RNA was extracted, subjected to agarose-formaldehyde gels electrophoresis, blotted and sequentially hybridized with mouse TLR4, TLR2 and GAPDH probes.

Download figure to PowerPoint

Dexamethasone inhibition of NF-κB activity is counter-balanced by MIF

The transcription factor NF-κB is a pivotal regulator of the expression of numerous inflammatory and immune genes, including cytokines, chemokines, adhesion molecules, immune receptors and enzymes implicated in the generation of pro-inflammatory mediators. In turn, NF-κB is a main target of the anti-inflammatory and immunosuppressive effects of glucocorticoids, which are potent inhibitors of NF-κB 36, 37. To examine whether MIF may antagonize dexamethasone-mediated inhibition of NF-κB nuclear translocation, nuclear extracts from U-937 and RAW 264.7 cells were prepared and electrophoretic mobility shift assay (EMSA) were performed using a NF-κB consensus oligonucleotide probe. Stimulation of U-937 and RAW 264.7 cells with LPS and PMA or with LPS increased NF-κB DNA binding activity fourfold and sixfold over baseline, respectively. Preincubation of cells with dexamethasone markedly reduced NF-κB DNA binding activity in a dose-dependent fashion (data not shown) and recombinant MIF nearly fully reversed this inhibitory effect when added to cell cultures together with dexamethasone (Fig. 3A and B).

thumbnail image

Figure 3. MIF overcomes dexamethasone-induced inhibition of NF-κB activity by U-937 monocytes and RAW 264.7 macrophages. U-937 (A) and RAW 264.7 (B) cells were pre-incubated for 1 h with dexamethasone (Dex, 1–10 nM) or with dexamethasone plus MIF (10 ng/mL) and then stimulated with LPS plus PMA (A) or with LPS (B). After 30 min, NF-κB binding activity was analyzed by EMSA. Results are representative of at least two independent experiments. (C) RAW 264.7 macrophages were transiently transfected with a NF-κB-luciferase reporter vector together with the Renilla pRL-TK vector. Cells were pre-incubated for 1 h with dexamethasone or with dexamethasone plus MIF and then stimulated for 6 h with LPS. Results are mean ± SD of three independent experiments. *p = 0.02 versus cells pre-incubated with dexamethasone in the absence of MIF.

Download figure to PowerPoint

To study whether the overriding effects of MIF on dexamethasone-induced transrepression of NF-κB led to increased gene transcription, we measured NF-κB-mediated transcriptional activity in RAW 264.7 cells transfected with a NF-κB-driven luciferase reporter plasmid (Fig. 3C). LPS stimulation induced a robust increase of luciferase activity, which was reduced by 40% in cells preincubated with 10 nM of dexamethasone. Corroborating the results obtained by EMSA, MIF fully overcame dexamethasone inhibition of NF-κB-driven luciferase activity. Taken together, these data clearly indicate that MIF acts as a counter-regulator of glucocorticoid transrepression of NF-κB-mediated cytokine gene transcription in monocytes and macrophages.

MIF overcomes dexamethasone enhancement of TNF mRNA degradation

In addition to repressing transcriptional activity of immune genes, glucocorticoids have been shown to down-regulate inflammatory responses by increasing the degradation of mRNAs of pro-inflammatory genes containing AU-rich elements (ARE) in the 3′ untranslated region (UTR) 29, 38, 39. Indeed, AU-rich sequences of the TNF 3′ UTR play a critical role in the regulation of LPS-induced TNF expression and in its down-regulation by dexamethasone. Blocking cytokine mRNA degradation might therefore be another mode of action by which MIF counterbalances the inhibitory effects of glucocorticoids. This question was examined by measuring TNF mRNA half-life in LPS-stimulated RAW 264.7 cells with or without pre-incubation with dexamethasone or dexamethasone plus MIF (Fig. 4). Mean TNF mRNA half-lives (average of two determinations) were 27, 17 and 24 min in cells pre-treated without dexamethasone, with dexamethasone and with dexamethasone plus MIF, respectively. Thus, MIF counter-balanced the inhibitory effect exerted by dexamethasone on translational derepression of TNF expression following exposure to LPS, providing evidence for a post-transcriptional component of the MIF overriding effect.

thumbnail image

Figure 4. MIF overcomes dexamethasone-induced augmentation of TNF mRNA decay in RAW 264.7 macrophages. RAW 264.7 macrophages were pre-incubated for 1 h with dexamethasone (Dex, 10 nM) or with dexamethasone plus MIF (10 ng/mL) and then stimulated for 2 h with LPS before adding actinomycin D for 0, 15 or 30 min. Total RNA was extracted and analyzed by Northern blotting. TNF mRNA levels were normalized for GAPDH mRNA levels and expressed as a percent of the signal present at time 0 (i.e. before the addition of actinomycin D). Data are representative of two independent experiments.

Download figure to PowerPoint

MIF counter-regulates dexamethasone-induced MKP-1 up-regulation

MKP are essential components of the negative feedback loop modulating innate and adaptive immune responses 2022. Induced by pro-inflammatory stimuli including LPS, PMA and IL-1, MKP-1, the archetypical MKP known to inhibit ERK, JNK and p38 MAPK was recently found to be induced by glucocorticoids and to suppress cytokine and cyclooxygenase-2 production [26–-29]. The properties ascribed to MKP-1 made it an intriguing candidate target of the MIF-glucocorticoids crosstalk. To examine this hypothesis we first analyzed the MKP-1 contents of resting and stimulated RAW 264.7 macrophages (Fig. 5A). Low levels of MKP-1 were constitutively expressed in resting, unstimulated RAW 264.7 cells. MKP-1 was up-regulated (1.9-fold and 6-fold, respectively) after a short exposure to LPS (100 ng/mL) or dexamethasone (100 nM). Of note, dexamethasone and LPS exerted powerful synergistic effects. Pre-incubation of cells with dexamethasone prior to LPS exposure resulted in a massive up-regulation of MKP-1 mRNA (41-fold) and protein (34-fold) expression, consistent with a key role for MKP-1 as an effector molecule of glucocorticoids negatively regulating MAPK signal transduction pathways (Fig. 5A and B). Exogenous addition of MIF given at the same time as dexamethasone counter-regulated the synergistic up-regulation of MKP-1 mRNA and protein expression induced by dexamethasone plus LPS (64 and 54% inhibition, respectively) (Fig. 5A and B). Likewise, MIF was found to fully override in a dose-dependent manner MKP-1 up-regulation induced by dexamethasone alone (Fig. 5C).

thumbnail image

Figure 5. MIF inhibits dexamethasone-induced MKP-1 up-regulation in RAW 264.7 macrophages. (A, B) RAW 264.7 macrophages were pre-incubated for 1 h with dexamethasone or with dexamethasone plus MIF before stimulation with LPS for 15 min. Cellular content of MKP-1 protein and mRNA levels were analyzed by Western (A) and Northern (B) blotting. Results are representative of two to five independent experiments. *, Nonspecific band (C) RAW 264.7 macrophages were incubated for 1 h with dexamethasone or with dexamethasone plus MIF. MKP-1 content of cell lysates was analyzed by Western blotting. Data are representative of two independent experiments. *, Nonspecific band. (D) Intracellular MIF content in wild-type (RAW 264.7), pBK control and antisense MIF RAW 264.7 macrophages was analyzed by Western blotting. MIF (20 ng) was transferred as a standard. (E) Control and antisense MIF RAW 264.7 macrophages were incubated for 1 h with dexamethasone and MKP-1 content analyzed by Western blotting. *, Nonspecific band. (F) Control and antisense MIF RAW 264.7 macrophages were pre-incubated for 1 h with dexamethasone before stimulation with LPS for 4 h. TNF concentrations in cell culture supernatants were expressed as the relative percent inhibition of TNF cytokine production calculated by the following formula: % inhibition = ([LPS-induced cytokine]−[dexamethasone plus LPS-induced cytokine])/(LPS-induced cytokine) × 100. Open circles: antisense macrophages, closed squares: control macrophages. Results are mean ± SD of six determinations from three independent experiments. *p = 0.004 and 0.03 when comparing TNF production by antisense MIF versus wild-type macrophages.

Download figure to PowerPoint

As MIF is a constitutively expressed and released autocrine macrophage mediator 14, we reasoned that reducing the endogenous content of MIF should cause an augmentation of MKP-1 levels after exposure to dexamethasone, thus rendering macrophages more sensitive to the anti-inflammatory effects of glucocorticoids. To test this hypothesis, we used RAW 264.7 cells stably transfected with an antisense MIF mRNA expression plasmid that contain markedly reduced endogenous MIF levels (i.e. 20 to 30% of the MIF levels of control RAW 264.7 macrophages transfected with an empty plasmid) (Fig. 5D). As shown in Fig. 5E, antisense MIF macrophages expressed higher amounts of MKP-1 than control macrophages in response to dexamethasone stimulation, confirming the results obtained with exogenously added MIF. Consistent with these findings, antisense MIF macrophages were substantially more sensitive than control macrophages to glucocorticoids as reflected by an approximately tenfold reduction of the dose of dexamethasone needed to achieve comparable inhibition of TNF production (Fig. 5F). Altogether, these data strongly suggest that MIF can act in an autocrine fashion to overcome MKP-1 up-regulation and inhibition of innate immune responses of macrophages exposed to glucocorticoids.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Tight regulation of the immune system is essential to ensure that activation or inhibitory signals do not result in either exuberant inflammation or undue immunosuppression. An abundant literature spanning nearly the entire 20th century has shown that glucocorticoids are key players in this delicate balancing act (reviewed in 4). Glucocorticoids regulate a wide variety of immune cell functions, suppressing the maturation, differentiation and proliferation of innate and acquired immune cells and inhibiting the expression of numerous immune mediators via transcriptional and post-transcriptional control mechanisms. Until recently, no endogenous neuroendocrine or immune mediator had been identified that would function as a counter-regulatory partner of glucocorticoids to modulate immune responses. A few years ago, the pro-inflammatory cytokine MIF was found to be induced by low concentrations of glucocorticoids and to overcome glucocorticoid inhibition of innate immunity 10. However, very little is known about the molecular basis of MIF-glucocorticoid interactions within the immune system. Data by Michell et al.18 provided initial insights into MIF-glucocorticoid crosstalk by suggesting a role for MIF-induced activation of protein kinase A, ERK MAPK pathway, cytoplasmic phospholipase A2 and arachidonic acid in MIF reversal of dexamethasone inhibition of arachidonic acid production by TNF-activated NIH-3T3 cells.

The present data show that MIF counterbalances glucocorticoids anti-inflammatory and immunosuppressive effects by affecting transcriptional and post-transcriptional regulation of cytokine gene expression. Numerous molecules of the NF-κB and MAPK signaling pathways are implicated at a transcriptional or post-transcriptional level in the control of cytokine production. Among these, the p65 subunit of NF-κB, IκB, and MKP-1 were prominent candidate targets of MIF-glucocorticoids crosstalk.

NF-κB, a premier transcription factor regulating the expression of numerous inflammatory and immune genes, is a target of the inhibitory effects of glucocorticoids 36, 37. Glucocorticoids suppress NF-κB-mediated gene transcription by inhibiting NF-κB binding to the promoter region of responsive genes (NF-κB transrepression) or by up-regulating IκBα expression. Here we found that MIF fully overcame glucocorticoids inhibition of NF-κB-mediated transcriptional activity in monocytes and macrophages (Fig. 3). Glucocorticoids have been shown to increase the cytoplasmic levels of IκBα, which serves to capture NF-κB in the cytoplasm preventing its nuclear translocation and the transactivation of NF-κB-responsive genes 40, 41. Recently, Daun and Cannon 42 have shown that MIF inhibits hydrocortisone-induced increase of IκBα, providing an elegant explanation for the overriding effect of MIF at a transcriptional level (Fig. 3).

Originally identified as an immediate early gene induced by serum growth factors, MKP-1 was then found to be a dual specificity (threonine/tyrosine) phosphatase acting as a negative regulator of ERK, JNK and p38 MAPK activities, with predominant effects on the latter two 2025. Recently, MKP-1 expression was observed to be induced by glucocorticoids in myeloid and non-myeloid cells and to function as a negative regulator of MAPK activities 2729. Several pro-inflammatory stimuli (such as LPS, peptidoglycan, PMA and IL-1) also stimulate monocytes/macrophages MKP-1 expression (Fig. 5A), which activates a negative feed back loop down-regulating the production of pro-inflammatory cytokines (TNF, IL-1 and IL-6) 26, 43, 44. Besides inhibiting gene transcription, glucocorticoids also act at a post-transcriptional level via an accelerated turnover of mRNAs of pro-inflammatory genes, such as GM-CSF and TNF. These genes contain ARE in the 3′ UTR acting either as translational modulators or RNA instability determinants. TNF, IL-2 and IL-3, GM-CSF, cyclooxygenase-2, c-fos and c-myc mRNA are prototypical members of short-lived mRNAs containing ARE which are recognized by trans-acting ARE binding proteins implicated in mRNA stability or translational modulation 38, 39, 45. p38, JNK and ERK have been shown to control pro-inflammatory cytokine production (such as TNF and IL-1) at a post-transcriptional level and are key targets of glucocorticoid-induced and MKP-1-mediated inhibition of pro-inflammatory stimuli 2629. The fact that MIF inhibits MKP-1 expression induced by glucocorticoids or by glucocorticoids plus LPS (Fig. 5) indicates that MKP-1 is a main target of the MIF overriding effects on post-transcriptional regulation of cytokine production. Work is in progress to identify at a subcellular level the mechanism whereby MIF affects glucocorticoid-induced MKP-1 up-regulation.

In summary, MIF has the unique feature to be a constitutively expressed cytokine that functions as an endogenous counter-regulator of glucocorticoids suppression of innate immune responses. MIF overrides glucocorticoid-induced down-regulation of cytokine gene expression by acting at a transcriptional level (NF-κB transrepression) through an inhibition of glucocorticoid-induced IκBα expression 42 and at a post-transcriptional (translational derepression of cytokine mRNA) through an inhibition of glucocorticoid-induced MKP-1 expression. The identification of MKP-1 as a target of MIF-glucocorticoids crosstalk provides a novel molecular basis of the interplay between an important pair of physiological regulators of innate and acquired immunity. These observations may help developing anti-MIF-based therapeutic strategies for the management of patients with glucocorticoid-resistant inflammatory and autoimmune diseases.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Reagents and cytokines

Escherichia coli O111:B4 LPS, PMA and dexamethasone were obtained from Sigma (St. Louis, MO). Recombinant human and murine MIF were prepared as described 46 and contained less than 10 pg of endotoxin per microgram of protein as determined by the Limulus amebocyte lysate assay (Endosafe, Charles River, Charleston, SC).

Cells and transfections

Human U-937 monocytic cells and mouse RAW 264.7 macrophages (American Type Culture Collection, Rockville, MD) were cultured in RPMI 1640 medium containing 2 mM glutamine, 10% heat-inactivated FCS (Seromed, Berlin, Germany) and antibiotics. RAW 264.7 macrophages (106 cells/ well in 6-well plates) were transiently transfected using Fugene 6™ transfection reagent (Roche Diagnostics, Basel, Switzerland), 2 μg of a multimeric NF-κB-luciferase reporter vector and 50 ng of the Renilla pRL-TK vector (Promega, Madison, WI). Twenty-four hours after transfection, cells were stimulated as indicated in the Sect. 2. Luciferase and Renilla luciferase activities were measured using the Dual-Luciferase™ Reporter Assay System (Promega). Results were expressed as relative luciferase activity (ratio of luciferase to Renilla luciferase activities). RAW 264.7 macrophages were transfected with the parental pBK vector or the antisense MIF vector using DOTAP (Roche Diagnostics) as described 16. Stable transfected cell lines were selected using G418 and clones obtained by limited dilution.

MIF overriding of glucocorticoid-mediated inhibition of cytokine production

RAW 264.7 or U-937 cells (106 cells/well in 6-well plates) were pre-incubated for 1 h with dexamethasone (1–10 nM) or with dexamethasone plus MIF (1–10 ng/mL) before the addition of either LPS (100 ng/mL) (RAW 264.7) or LPS (100 ng/mL) and PMA (1 ng/mL) (U-937). Cell-culture supernatants were collected after 4 h (RAW 264.7) or 15 h (U-937). TNF and IL-8 were measured using WEHI 164 clone 13 mouse fibrosarcoma cells (TNF) or ELISA (IL-8).

RNA and Northern blot analysis

Total RNA was extracted from cells using TRIzol™ (Invitrogen, Gaithersburg, MD). Expression of IL-8, TNF, TLR2, TLR4, MKP-1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was assessed by Northern blotting using specific cDNA probes. Gene-specific mRNA signals were quantified using an Instant Imager 2024 (Packard, Meriden, CT). Analysis of TNF mRNA decay induced by dexamethasone was performed in parallel cultures of RAW 264.7 macrophages pre-incubated for 1 h either with dexamethasone (10 nM) or with dexamethasone and MIF (10 ng/mL). This was followed by stimulation for 2 h with LPS (100 ng/mL) before the addition of actinomycin D (10 μg/mL) for 0, 15 or 30 min. Total RNA was extracted and processed as described above. The IL-8, TNF, GAPDH, TLR2, TLR4 and MKP-1 probes were obtained by PCR amplification of U-937 or RAW 264.7 cDNA using the following sense and antisense primers: IL-8: AAGGCACAGTGGAACAAGGA and CACACTGCGCCAACACAGAA; TNF: GCGGAGTCCGGGCAGGTCTA and GGGGGGCTGGCTCTGTGAGG; GAPDH: CTCATGACCACAGTCCATGC and CACATTGGGGGTAGGAACAC; TLR2: ACTCTGAAAAACCTGACCTC and GATGTTGTCAATGATCCATT; TLR4: AGACATCTAAAGGAATACTGCAA and GCGGCTGCTCAGAAACTGCCATG; MKP-1: ATTGTCCTAACCACTTTGA and GATACTCCGCCTCTGCTTC.

Flow cytometric analysis

After blocking Fc receptors with 2.4G2 hybridoma supernatant, expression of membrane-bound TLR4 by RAW 264.7 macrophages was evaluated by first incubating cells for 30 min with a rat anti-mouse TLR4-MD-2 monoclonal antibody or an isotype-matched control antibody and then with a FITC-conjugated goat anti-rat antibody as previously described 47. Macrophages were counterstained with a phytorerythrin-conjugated anti-Mac1 monoclonal antibody and analyzed on a FACScan (Becton Dickinson, Erembodegem, Belgium).

Electrophoretic mobility shift assay (EMSA)

Nuclear extracts of control and RAW 264.7 or U-937 cells pre-incubated for 1 h with dexamethasone or with dexamethasone plus MIF before a 30-min LPS (RAW 264.7) or LPS and PMA (U-937) stimulation were analyzed by EMSA using a consensus NF-κB probe as described 16, 47.

Western blotting analysis of intracellular MKP-1 and MIF

Cells were lysed with Mammalian Protein Extraction Reagent (Pierce). Cell lysates were centrifuged and protein concentration of supernatants was measured using the BCA protein assay (Pierce). Cell-lysates were electrophoresed through 15% (w/v) polyacrylamide gels and transferred onto nitrocellulose membranes (Schleicher & Schuell, Keene, NH). Membranes were incubated with rabbit anti-MKP-1 antibody (sc1102, Santa Cruz Biotechnology). After washing, membranes were incubated with HRP-conjugated goat anti-rabbit IgG. Signals were revealed using the ECL Western blotting analyses system (Amersham, Arlington Heights, IL). Additionally, control and antisense MIF RAW 264.7 macrophages were lysed for 30 min at 4°C in RIPA buffer and cellular debris were pelleted. Cell-lysate supernatants adjusted for protein concentration were electrophoresed through 15% (w/v) polyacrylamide gels under reducing conditions and transferred onto nitrocellulose membrane for Western blot analysis as previously described 14.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

We are grateful to Dr. G. Waeber (CHUV, Lausanne, Switzerland) for the generous gift of the antisense MIF mRNA and to Dr. K. Miyake (Saga Medical School, Osaka, Japan) who kindly provided anti-mouse TLR4-MD-2 monoclonal antibody. This work was supported by grants from the Swiss National Science Foundation to T.C. (32–49129.96 and 3100–066972), the Bristol-Myers Squibb Foundation, the Leenaards Foundation and the Santos-Suarez Foundation for Medical Research. TC is a recipient of a career award from the Leenaards Foundation.

  • 1

    WILEY-VCH

  • 2

    WILEY-VCH

  • 3

    WILEY-VCH

  • 4

    WILEY-VCH

  • 5

    WILEY-VCH

  • 1
    Janeway, C. A., Jr. and Medzhitov, R., Innate immune recognition. Annu. Rev. Immunol. 2002. 20: 197216.
  • 2
    Waage, A., Halstensen, A. and Espevik, T., Association between tumour necrosis factor in serum and fatal outcome in patients with meningococcal disease. Lancet 1987. 1: 355357.
  • 3
    Girardin, E., Grau, G. E., Dayer, J. M., Roux-Lombard, P. and Lambert, P. H., Tumor necrosis factor and interleukin-1 in the serum of children with severe infectious purpura. N. Engl. J. Med 1988. 319: 397400.
  • 4
    Webster, J. I., Tonelli, L. and Sternberg, E. M., Neuroendocrine regulation of immunity. Annu. Rev. Immuno.l 2002. 20: 125163.
  • 5
    Scott, W. J. M., The influence of the adrenal glands on resistance. II. The toxic effect of killed bacteria in adrenalectomized rats. J. Exp. Med. 1924. 39: 457471.
  • 6
    Michie, H. R., Manogue, K. R., Spriggs, D. R., Revhaug, A., O'Dwyer, S., Dinarello, C. A., Cerami, A. et al., Detection of circulating tumor necrosis factor after endotoxin administration. N. Engl. J. Med. 1988. 318: 14811486.
  • 7
    Rothwell, P. M., Udwadia, Z. F. and Lawler, P. G., Cortisol response to corticotropin and survival in septic shock. Lancet 1991. 337: 582583.
  • 8
    Annane, D., Sebille, V., Charpentier, C., Bollaert, P. E., Francois, B., Korach, J. M., Capellier, G. et al., Effect of treatment with low doses of hydrocortisone and fludrocortisone on mortality in patients with septic shock. Jama 2002. 288: 862871.
  • 9
    Bernhagen, J., Calandra, T., Mitchell, R. A., Martin, S. B., Tracey, K. J., Voelter, W., Manogue, K. R. et al., MIF is a pituitary-derived cytokine that potentiates lethal endotoxaemia. Nature 1993. 365: 756759.
  • 10
    Calandra, T., Bernhagen, J., Metz, C. N., Spiegel, L. A., Bacher, M., Donnelly, T., Cerami, A. and Bucala, R., MIF as a glucocorticoid-induced modulator of cytokine production. Nature 1995. 377: 6871.
  • 11
    Calandra, T. and Roger, T., Macrophage migration inhibitory factor: a regulator of innate immunity. Nat. Rev. Immunol. 2003. 3: 791800.
  • 12
    Bacher, M., Meinhardt, A., Lan, H. Y., Mu, W., Metz, C. N., Chesney, J. A., Calandra, T. et al., Migration inhibitory factor expression in experimentally induced endotoxemia. Am. J. Pathol. 1997. 150: 235246.
  • 13
    Nishino, T., Bernhagen, J., Shiiki, H., Calandra, T., Dohi, K. and Bucala, R., Localization of macrophage migration inhibitory factor (MIF) to secretory granules within the corticotrophic and thyrotrophic cells of the pituitary gland. Mol. Med. 1995. 1: 781788.
  • 14
    Calandra, T., Bernhagen, J., Mitchell, R. A. and Bucala, R., The macrophage is an important and previously unrecognized source of macrophage migration inhibitory factor. J. Exp. Med. 1994. 179: 18951902.
  • 15
    Calandra, T., Spiegel, L. A., Metz, C. N. and Bucala, R., Macrophage migration inhibitory factor is a critical mediator of the activation of immune cells by exotoxins of Gram-positive bacteria. Proc. Natl. Acad. Sci. USA 1998. 95: 1138311388.
  • 16
    Roger, T., David, J., Glauser, M. P. and Calandra, T., MIF regulates innate immune responses through modulation of Toll-like receptor 4. Nature 2001. 414: 920924.
  • 17
    Mitchell, R. A., Liao, H., Chesney, J., Fingerle-Rowson, G., Baugh, J., David, J. and Bucala, R., Macrophage migration inhibitory factor (MIF) sustains macrophage proinflammatory function by inhibiting p53: regulatory role in the innate immune response. Proc. Natl. Acad. Sci. USA 2002. 99: 345350.
  • 18
    Mitchell, R. A., Metz, C. N., Peng, T. and Bucala, R., Sustained mitogen-activated protein kinase (MAPK) and cytoplasmic phospholipase A2 activation by macrophage migration inhibitory factor (MIF). Regulatory role in cell proliferation and glucocorticoid action. J. Biol. Chem. 1999. 274: 1810018106.
  • 19
    Kleemann, R., Hausser, A., Geiger, G., Mischke, R., Burger-Kentischer, A., Flieger, O., Johannes, F. J. et al., Intracellular action of the cytokine MIF to modulate AP-1 activity and the cell cycle through Jab1. Nature 2000. 408: 211216.
  • 20
    Camps, M., Nichols, A. and Arkinstall, S., Dual specificity phosphatases: a gene family for control of MAP kinase function. FASEB J. 2000. 14: 616.
  • 21
    Karin, M., Mitogen activated protein kinases as targets for development of novel anti-inflammatory drugs. Ann. Rheum. Dis. 2004. 63 Suppl 2: ii62ii64.
  • 22
    Theodosiou, A. and Ashworth, A., MAP kinase phosphatases. Genome Biol. 2002. 3: REVIEWS3009.
  • 23
    Charles, C. H., Abler, A. S. and Lau, L. F., cDNA sequence of a growth factor-inducible immediate early gene and characterization of its encoded protein. Oncogene 1992. 7: 187190.
  • 24
    Charles, C. H., Sun, H., Lau, L. F. and Tonks, N. K., The growth factor-inducible immediate-early gene 3CH134 encodes a protein-tyrosine-phosphatase. Proc. Natl. Acad. Sci. USA 1993. 90: 52925296.
  • 25
    Sun, H., Charles, C. H., Lau, L. F. and Tonks, N. K., MKP-1 (3CH134), an immediate early gene product, is a dual specificity phosphatase that dephosphorylates MAP kinase in vivo. Cell 1993. 75: 487493.
  • 26
    Chen, P., Li, J., Barnes, J., Kokkonen, G. C., Lee, J. C. and Liu, Y., Restraint of proinflammatory cytokine biosynthesis by mitogen-activated protein kinase phosphatase-1 in lipopolysaccharide-stimulated macrophages. J. Immunol. 2002. 169: 64086416.
  • 27
    Engelbrecht, Y., de Wet, H., Horsch, K., Langeveldt, C. R., Hough, F. S. and Hulley, P. A., Glucocorticoids induce rapid up-regulation of mitogen-activated protein kinase phosphatase-1 and dephosphorylation of extracellular signal-regulated kinase and impair proliferation in human and mouse osteoblast cell lines. Endocrinology 2003. 144: 412422.
  • 28
    Kassel, O., Sancono, A., Kratzschmar, J., Kreft, B., Stassen, M. and Cato, A. C., Glucocorticoids inhibit MAP kinase via increased expression and decreased degradation of MKP-1. EMBO J. 2001. 20: 71087116.
  • 29
    Lasa, M., Abraham, S. M., Boucheron, C., Saklatvala, J. and Clark, A. R., Dexamethasone causes sustained expression of mitogen-activated protein kinase (MAPK) phosphatase 1 and phosphatase-mediated inhibition of MAPK p38. Mol. Cell Biol. 2002. 22: 78027811.
  • 30
    Beishuizen, A., Thijs, L. G., Haanen, C. and Vermes, I., Macrophage migration inhibitory factor and hypothalamo-pituitary-adrenal function during critical illness. J. Clin. Endocrinol. Metab. 2001. 86: 28112816.
  • 31
    Calandra, T., Echtenacher, B., Roy, D. L., Pugin, J., Metz, C. N., Hultner, L., Heumann, D. et al., Protection from septic shock by neutralization of macrophage migration inhibitory factor. Nat. Med. 2000. 6: 164170.
  • 32
    Akira, S. and Takeda, K., Toll-like receptor signaling. Nat. Rev. Immunol. 2004. 4: 499511.
  • 33
    Beutler, B., Inferences, questions and possibilities in Toll-like receptor signaling. Nature 2004. 430: 257263.
  • 34
    Poltorak, A., He, X., Smirnova, I., Liu, M. Y., Van Huffel, C., Du, X., Birdwell, D. et al., Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 1998. 282: 20852088.
  • 35
    Hermoso, M. A., Matsuguchi, T., Smoak, K. and Cidlowski, J. A., Glucocorticoids and tumor necrosis factor alpha cooperatively regulate toll-like receptor 2 gene expression. Mol. Cell Biol. 2004. 24: 47434756.
  • 36
    Li, Q. and Verma, I. M., NF-kappaB regulation in the immune system. Nat. Rev. Immuno.l 2002. 2: 725734.
  • 37
    Schaaf, M. J. and Cidlowski, J. A., Molecular mechanisms of glucocorticoid action and resistance. J. Steroid Biochem. Mo. Biol. 2002. 83: 3748.
  • 38
    Zhang, T., Kruys, V., Huez, G. and Gueydan, C., AU-rich element-mediated translational control: complexity and multiple activities of trans-activating factors. Biochem. Soc. Trans. 2002. 30: 952958.
  • 39
    Bevilacqua, A., Ceriani, M. C., Capaccioli, S. and Nicolin, A., Post-transcriptional regulation of gene expression by degradation of messenger RNAs. J. Cell Physiol. 2003. 195: 356372.
  • 40
    Auphan, N., DiDonato, J. A., Rosette, C., Helmberg, A. and Karin, M., Immunosuppression by glucocorticoids: inhibition of NF-kappa B activity through induction of I kappa B synthesis. Science 1995. 270: 286290.
  • 41
    Scheinman, R. I., Cogswell, P. C., Lofquist, A. K. and Baldwin, A. S., Jr., Role of transcriptional activation of I kappa B alpha in mediation of immunosuppression by glucocorticoids. Science 1995. 270: 283286.
  • 42
    Daun, J. M. and Cannon, J. G., Macrophage migration inhibitory factor antagonizes hydrocortisone-induced increases in cytosolic IkappaBalpha. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2000. 279: R10431049.
  • 43
    Shepherd, E. G., Zhao, Q., Welty, S. E., Hansen, T. N., Smith, C. V. and Liu, Y., The function of mitogen-activated protein kinase phosphatase-1 in peptidoglycan-stimulated macrophages. J. Biol. Chem. 2004. 279: 5402354031.
  • 44
    Zhao, Q., Shepherd, E. G., Manson, M. E., Nelin, L. D., Sorokin, A. and Liu, Y., The role of mitogen-activated protein kinase phosphatase-1 in the response of alveolar macrophages to lipopolysaccharide: attenuation of proinflammatory cytokine biosynthesis via feedback control of p38. J. Biol. Chem. 2005. 280: 81018108.
  • 45
    Lasa, M., Mahtani, K. R., Finch, A., Brewer, G., Saklatvala, J. and Clark, A. R., Regulation of cyclooxygenase 2 mRNA stability by the mitogen-activated protein kinase p38 signaling cascade. Mol. Cell Biol. 2000. 20: 42654274.
  • 46
    Bernhagen, J., Mitchell, R. A., Calandra, T., Voelter, W., Cerami, A. and Bucala, R., Purification, bioactivity, and secondary structure analysis of mouse and human macrophage migration inhibitory factor (MIF). Biochemistry 1994. 33: 1414414155.
  • 47
    Roger, T., Miconnet, I., Schiesser, A. L., Kai, H., Miyake, K. and Calandra, T., Critical role for Ets, AP-1 and GATA-like transcription factors in regulating mouse Toll-like receptor 4 (Tlr4) gene expression. Biochem. J. 2005. 387: 355365.