SEARCH

SEARCH BY CITATION

Keywords:

  • Dendritic cell;
  • Monocytes;
  • K562;
  • Yersinia pestis;
  • YopJ

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Yersinia pestis evades immune responses in part by injecting into host immune cells several effector proteins called Yersinia outer proteins (Yops) that impair cellular function. This has been best characterized in the innate effector cells, but much less so for cells involved in adaptive immune responses. Dendritic cells (DC) sit at the crossroads between innate and adaptive immunity, and can function to initiate or inhibit adaptive immune responses. Although Y. pestis can target and inactivate DC, the mechanism responsible for this remains unclear. We have found that injection of Y. pestis YopJ into DC progenitors disrupts key signal transduction pathways and interferes with DC differentiation and subsequent function. YopJ injection prevents up-regulation of the NF-κB transcription factor Rel B and inhibits MAPK/ERK activation – both having key roles in DC differentiation. Furthermore, YopJ injection prevents costimulatory ligand up-regulation, LPS-induced cytokine expression, and yields differentiated DC with diminished capability to induce T cell proliferation and IFN-γ induction. By modulating DC function through YopJ-mediated disruption of signaling pathways during progenitor to DC differentiation, Yersinia may interfere with the adaptive responses necessary to clear the infection as well as establish a tolerant immune environment that leads to chronic infection/carrier state in the surviving host.

Abbreviations:
moDC:

monocyte-derived DC

Yops:

Yersinia outer proteins

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Yersinia pestis is a gram-negative bacterium and the etiological agent of plague 1. Despite being an extracellular bacterium, Y. pestis employs a rather remarkable system to target/suppress the host immune system through direct injection of several effector proteins, collectively called the Yersinia outer proteins (Yops), into the cytoplasm of immune cells 13. Secretion of Yops across the bacterial membranes and injection of Yops into the cytoplasm of eukaryotic cells is mediated by a plasmid pCD1-encoded type III secretion system (T3SS) 4. Injection of effector Yops (YopE, YopH, YopJ, YopM, YopT and YpkA) into the effector cells of the innate immune system (polymorphonuclear leukocytes and macrophages) by Y. pestis and other pathogenic yersiniae (Y. enterocolitica and Y. pseudotuberculosis) results in the disruption of the host cell cytoskeleton, inhibition of inflammatory responses and prevention of bacterial phagocytosis 49.

Although its modulation of innate immunity has been best characterized, Yersinia also target cells of the adaptive immune response. T cells mediate protection against Y. enterocolitica10, and immunity to plague is principally mediated by antibodies that require an intact CD4+ T helper response 11, 12. Conversely, yersiniae directly interfere with B and T cell activation 13 and disrupts the function of antigen-presenting cells (APC) 14. Of the professional APC, dendritic cells (DC) play the predominate role in activating and regulating T cell responses 15. Thus, disabling DC function may benefit the survival of a pathogen. Consistent with this, Marketon et al.3 have found that DC (and macrophages) are the early and predominant targets for Y. pestis Yop injection in vivo. Myeloid DC progenitors (e.g. monocytes, macrophages) in the blood or lymph nodes are also targets for the pathogen and serve as reservoirs of infection 3, 16. Other pathogenic Yersinia spp. (e.g. Y. enterocolitica) also can impair DC function and induce DC apoptosis (in mice) 14, 17, 18, and it has been recently shown that Y. pestis inhibits cellular migration in fully differentiated murine DC 19.

A more insidious effect of Yersinia infection on DC function is suggested by the following observations: (i) inhibition of the NF-κB (especially the NF-κB family member Rel B) and the MAPK (ERK) signaling pathways during progenitor to DC differentiation cripples the function of the resulting DC 20, 21, and in fact NF-κB inhibition yields regulatory DC 22, (ii) Yersinia effectively injects Yops into myeloid DC progenitors that are abundant at the site of infection (and the infected draining lymph nodes, bubos) and may be triggered to undergo DC differentiation by the inflammatory cytokine microenvironment, and (iii) YopJ has a ubiquitin-like cysteine protease and acetyltransferase activity that inhibits activation of MAP kinase kinases (MKKs) and NF-κB signaling in vitro and in macrophages 23, 24. Together these findings suggest that Yersinia may not only disable existing DC, but also cripple the function of new DC being produced to replace the existing DC. In this report we have examined whether YopJ of Y. pestis can disrupt key signaling pathways in DC progenitors, resulting in the differentiation into DC that have impaired immunostimulatory capability.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Effect of injection competent vs. incompetent strains of Y. pestis on DC differentiation

We have previously shown that the multipotent human myeloid leukemia cell line K562 can be induced to undergo differentiation to DC-like APC when stimulated with the phorbol ester PMA 25. K562 exhibit a less robust up-regulation of certain DC markers (MHC class I, II and CD83) compared to primary human DC precursors (monocytes, CD34+ hematopoietic stem cells), but develop equipotent ability to activate T cells. Because the same intracellular signaling pathways appear to be activated in K562 and primary precursors during DC differentiation, and because K562 are a homogenous population, this cell line is a readily accessible model to study YopJ's effects on DC signal transduction. We first examined the effect of YopJ on DC differentiation by infecting K562 with injection competent (Y. pestis KIM5–3001.48; YopB+YopJ+) and injection defective (Y. pestis KIM5–3001.49; YopBYopJ+) poly-yop-deleted strains expressing a functional plasmid-expressed GSK epitope-tagged YopJ protein 26, 27. Both strains carry deletions in pCD1 genes encoding the six effector Yops; therefore, YopJ-GSK is the only effector Yop injected. YopB is an essential component of the T3SS injection machinery 28, 29, and thus the YopB strains cannot inject YopJ-GSK into eukaryotic cells. We utilized the GSK-tag reporter system to identify injected YopJ 26, 27. The GSK tag is only phosphorylated within eukaryotic cells 30, 31, and can be detected using phospho GSK-specific antibodies. While both strains expressed the YopJ-GSK fusion protein (Fig. 1A, bottom panel), only the YopB+ strain was able to inject YopJ-GSK into the K562 cells as detected by the phospho-GSK tag (top panel).

thumbnail image

Figure 1. Infection of K562 with YopB+YopJ+ or YopBYopJ+ strains. (A) Injection of YopJ-GSK fusion protein into K562. K562 were infected with either YopB+YopJ+ (B+J+) or YopBYopJ+ (BJ+) strains. Injected YopJ-GSK was assayed by immunoblotting with anti-GSK (bottom panel) and anti-phospho GSK (top panel) antibody. (B) Down-regulation of Rel B expression. K562 were left uninfected, or infected with either B+J+ or BJ+ strains and were left undifferentiated or differentiated in PMA. Western blot for Rel B or β-actin are shown. One of two experiments is shown. (C) YopJ-GSK inhibits CD40 up-regulation. K562 were left uninfected or infected with B+J+ or BJ+ strains and left undifferentiated or differentiated. Isotype control (top) or CD40 expression (bottom) was analyzed by flow cytometry: undifferentiated (open histogram) and differentiated (filled). One of two representative experiments is shown. (D) YopJ-GSK suppresses allo-stimulatory capacity. K562 were left untreated (UT) or differentiated (PMA) (left panel). Alternatively K562 were infected with B+J+ or BJ+ strains and left undifferentiated or differentiated (right panel). The stimulators were then cocultured with allogeneic T cells at the stimulator: T cell ratio indicated. Proliferation was measured by [3H]thymidine incorporation. T cells stimulated with PMA and ionomycin alone (P + I) were used as a positive control. Comparison between PMA-treated B+J+- and BJ+-infected K562 at 1:10 and 1:2 ratios, p<0.001, p<0.05, respectively. One of two representative experiments is shown.

Download figure to PowerPoint

We next examined if YopJ-GSK affected NF-κB signaling during DC differentiation. Induction of Rel B gene expression is a critical event in DC differentiation, and this up-regulation is itself mediated by NF-κB signaling 3235. As shown in Fig. 1B, Rel B is strongly up-regulated by PMA-induced differentiation of K562. Undifferentiated K562 infected with the YopBYopJ+ strain expressed a low level of Rel B that was also greatly increased by PMA. In contrast, injection of YopJ-GSK by the YopB+YopJ+ strain substantially inhibited Rel B up-regulation in differentiating K562. NF-κB signaling/Rel B upregulation have been implicated in up-regulating CD40 expression during DC differentiation 22, which correlates with the observation that PMA induced significant CD40 expression in uninfected K562 and YopBYopJ+-infected K562, with much lower expression in the YopB+YopJ+-infected K562 (Fig. 1C). Infection alone in the absence of PMA did not up-regulate CD40 (not shown).

The functional hallmark of DC is their potent ability to activate T cells. In our system, undifferentiated K562 do not stimulate T cells, while PMA-differentiated K562 induce robust allo-T cell proliferation (Fig. 1D, left). Undifferentiated K562 infected with either Y. pestis strain also did not stimulate T cell proliferation, while PMA-differentiated cells derived from YopBYopJ+-infected K562 induced allo-T cell proliferation to levels similar to uninfected K562-derived DC-like cells or the positive control (T cells alone stimulated PMA + ionomycin) (Fig. 1D, right). The decrease in T cell proliferation from the 1:10 to 1:2 APC–T cell ratio is due to media exhaustion in the rapidly proliferating cultures, which is not seen with less immunostimulatory DC-like cells. In contrast to the YopBJ+ infection, YopB+YopJ+ infected K562-DC-like cells were significantly impaired in their ability activate T cells. This latter result also demonstrates that PMA carryover from the differentiation cultures is not inducing significant T cell proliferation.

Effect of injection competent YopJ+vs. YopJstrains

In the preceding studies the strains compared differed in expression of YopB, and not YopJ. It is, therefore, possible that the differences seen above are due to YopB and not YopJ, as YopB can also affect eukaryotic signal transduction 36. To assess this, we examined the effects of Y. pestis KIM5–3001.48 (YopB+YopJ), a injection competent poly-yop deletion mutant either carrying (YopB+YopJ+) or not carrying (YopB+YopJ) the pYopJ-GSK plasmid. The strains did not differ in their ability to induce K562 cell death immediately after infection (Table 1).

Table 1. Cell number (×106) of K562 before and after infection and differentiationa)
 Before infection (day 0)After infection (day 0)After infection (PMA day 5)
  1. a) K562 (10 × 106) were left uninfected or 15 × 106 were infected with YopB+YopJ+ (B+J+) or YopB+YopJ(B+J). Cell numbers were enumerated to prior and after differentiation with PMA. Results are presented as mean of three experiments ± 1 SD.

Uninfected10NA4.3 ± 1.1
B+J+1512.5 ± 2.210 ± 0.9
B+J1511.8 ± 1.46.7 ± 1.2

The effect of YopJ-GSK on the downstream MAPK/ERK and NF-κB signaling induced by PMA differentiation is shown in Fig. 2A. Rapid signaling through the MAPK pathway (ERK 1 and 2 phosphorylation) is seen within 45 min, while up-regulation of Rel B expression (as an indicator of NF-κB signaling) is seen by 24 h (left). This signaling in YopB+YopJ-infected K562 differentiated with PMA was similar to uninfected cells. In contrast, YopB+YopJ+-infected K562 had significantly reduced MAPK/ERK and NF-κB signaling (densitometry, right). Interestingly, injected YopJ-GSK was still detected 24 h post infection, suggesting that YopJ is not rapidly degraded. Rel B expression was also examined in undifferentiated K562 infected with the YopB+YopJ+ or YopB+YopJ strains to determine if infection alone induced Rel B up-regulation (Fig. 2B), and neither strain could induce Rel B without the differentiation stimulus.

thumbnail image

Figure 2. Infection of K562 with injection competent YopB+YopJ+ or YopB+YopJ strains. (A) YopJ-GSK inhibits up-regulation of Rel B and phospho-ERK1/2. K562 were left uninfected, or infected with B+J+ or B+J strains, and then cultured for 45 min or 24 h with or without PMA. Total proteins were immunoblotted for Rel B, phospo-ERK1/2, phospho-GSK or β-actin (left). Densitometry was done using Scion Image software (right). The expression levels of indicated proteins are normalized to the β-actin expression of that sample. The average expression of two independent experiments is shown. (B) Infection alone does not induce Rel B up-regulation. K562 were left uninfected or infected with B+J+ or B+J strains, and were left untreated or differentiated with PMA for 24 h. Total proteins were immunoblotted for Rel B and β-actin. (C) YopJ-GSK inhibits CD40 up-regulation. K562 were left uninfected or infected, and left untreated (UT) or differentiated with PMA (PMA). CD40 expression was analyzed by flow cytometry - isotype controls (open histograms), CD40 (filled histograms). One of two representative experiments is shown. (D) YopJ-GSK suppresses allo-stimulatory capacity. K562 were left uninfected or infected, and cultured with or without PMA. The cells were then cocultured with allogeneic T cells at the ratios indicated, and proliferation was measured by [3H]thymidine incorporation. Comparison between PMA-differentiated B+J+- and B+J-infected cells, p<0.001. One of three representative experiments is shown.

Download figure to PowerPoint

Consistent with the preceding experiments, CD40 up-regulation was unaffected by infection with the YopB+YopJ strain, but inhibited by YopB+YopJ+ (Fig. 2C). Similarly, uninfected and YopB+YopJ-infected K562 differentiated with PMA readily induced T cell proliferation, while YopB+YopJ+-infected K562 DC-like cells were significantly impaired (Fig. 2D). Across all experiments with different T cell donors, infection with the YopJ+ strain significantly (three- to sevenfold) inhibited the ability of the resulting DC-like cells to drive T cell proliferation.

YopJ-GSK effect on cytokine-induced primary monocyte to DC differentiation

While the homogeneity of the K562 model allows for a more precise delineation of the effects of YopJ-GSK on signal transduction and DC phenotype/function, transformed cell lines may not accurately reflect what happens in primary cells (for example, K562 DC-like cells express low levels of MHC class II and CD86). We therefore examined the effect of YopJ-GSK on in vitro human monocyte to DC differentiation 37. Since monocytes are known targets for Yersinia3, 38, we first characterized what Y. pestis infection did to the APC function of unmanipulated monocytes. While infection with either strain induced some cell death (Table 2, consistent with 9, 39), there was no difference between the strains, indicating that YopJ-GSK itself does not increase cell death in our experimental system.

Table 2. Cell number (×106) of monocytes before and after infectiona)
 Before infection (day 0)After infection (day 0)After infection (day 1)
  1. a) Monocytes (4.5 × 106) were left uninfected or 7 × 106 were infected with B+J+ or B+J as above. Monocytes were counted immediately after infection (day 0) and at day 1 after infection. Results are presented as mean of two experiments ± 1 SD.

Uninfected4.5NA3.1 ± 0.8
B+J+74.8 ± 0.53.3 ± 0.5
B+J74.9 ± 0.73.2 ± 1.5

YopB+YopJ+-infected monocytes induced less T cell proliferation compared with uninfected or YopB+YopJ-infected monocytes (Fig. 3A), suggesting that YopJ-GSK interferes with the APC function even prior to differentiation. Comparatively, however, monocyte activation of T cells is much less potent than that by DC, allowing examination of the effect of YopJ-GSK on the acquisition of enhanced immunogenicity during DC differentiation.

thumbnail image

Figure 3. YopJ-GSK inhibits costimulatory ligand expression and LPS-induced DC cytokine induction. (A) Infection of undifferentiated monocytes. Monocytes were left uninfected or infected with B+J+ or B+J strains, irradiated and cocultured with allogeneic T cells at the ratios indicated, and proliferation measured by [3H]thymidine incorporation. Comparison between B+J+- and B+J-infected monocytes at 1:2 ratio, p=0.01. One of four representative experiments is shown. (B) YopJ-GSK and development of moDC morphology. Monocytes were differentiated as described in the Materials and methods and either left uninfected or infected with B+J+ or B+J strains. Cellular morphology 3–5 days after infection is shown by light microscopy (100×). (C) Surface antigen phenotype. Monocytes were differentiated in GM-CSF + IL-4 (GM/4) and were left uninfected or infected, matured with TNF-α (GM/4/TNF), and analyzed by FACS (open histograms, isotype control; closed histograms, specific antibody). One of two representative experiments is shown. (D) LPS. FACS analysis of moDC differentiation cultures left untreated or treated with LPS alone on day 3 for 1 h. (E) DC cytokine induction by LPS stimulation. Monocytes were differentiated and either left uninfected or infected with B+J+ or B+J strains. Differentiated DC were then left untreated or treated with LPS. Real-time PCR was used to assay the fold induction (normalized to the housekeeping gene GAPDH) of the indicated cytokine/chemokines. One of two representative experiments is shown.

Download figure to PowerPoint

High levels of LPS can block the initiation of DC differentiation in monocytes 40, 41. To bypass this potentially confounding variable, monocytes were first induced to differentiate with GM-CSF + IL-4, and infection carried out shortly afterwards (Fig. 3B, top). Similar to that described above, Yersinia infection of monocytes decreased the yield of differentiated DC (vs. uninfected monocytes) but there was little difference between the two strains (Table 3), indicating cell death is not a major contributor to the differences seen below.

Table 3. Cell number (×106) of monocytes before and after infection and differentiationa)
 Before infection (day 0)After infection (day 0)After infection (GM/4/TNF day 7)
  1. a) Monocytes were differentiated in the presence of GM-CSF and IL-4, left uninfected (2 × 106 cells) or infected (3 × 106 cells) with the indicated strains, and differentiated for 3 days with TNF-α added on the last day. Viable cell numbers were determined immediately after infection (day 0) and after the differentiation (day 7). Results are presented as mean of five experiments (for B+J+ and B+J) and two experiments (for wild type and ΔJ) ± 1 SD.

GM/4/TNF2NA1.2 ± 0.25
B+J+ GM/4/TNF31.5 ± 0.30.5 ± 0.3
B+J GM/4/TNF31.4 ± 0.40.4 ± 0.2
Parent GM/4/TNF31.0 ± 0.50.6 ± 0.1
ΔJ GM/4/TNF30.75 ± 0.30.5 ± 0.2

The extended dendrite morphology of DC plays an essential role in their ability to activate T cells 42. Both uninfected and YopB+YopJ-infected monocytes differentiate into adherent cells with long dendrites (Fig. 3B, lower), while YopB+YopJ+-infected monocytes remained round cells.

In addition to CD40, DC differentiation is characterized by up-regulation of MHC class I and class II, CD80, CD86 and CD83 expression, with loss of the monocyte marker CD14 (Fig. 3C). We have found that, while infection with YopJ+ or J strains equivalently down-regulated MHC class I and II expression compared to mock-infected monocyte-derived DC (moDC) (which would not be consistent with a differential effect on DC maturation/activation), the YopJ+-infected moDC had markedly lower expression of the costimulatory ligands CD40, CD80 and CD86. There is a small subpopulation of cells that maintain higher levels of costimulatory ligand expression for unclear reasons – one possibility is that they were injected with less YopJ. The monocyte/macrophage marker CD14 is lost in all the conditions, suggesting that YopJ was not completely blocking differentiation. To assess the extent that LPS plays in the phenotypic changes seen, moDC were generated under the same cytokine conditions as above, but treated on day 3 with LPS alone (5 μg/mL per h) and then washed out – to mimic the conditions of infection with the Yersinia strains. In contrast to infection with the YopJ+ strains, LPS exposure alone resulted in a more mature/activated phenotype compared to cytokine alone, as indicated by higher expression of MHC class I, MHC class II, CD80, CD86 and CD83 (Fig. 3D).

We next examined if the phenotypic differences seen above were simply reflective of differences in DC activation/maturity, or whether they reflected a more fixed change set during differentiation. It has been well established that bacterial products potently drive DC maturation/activation (via the TLR), resulting in induction of DC cytokine/chemokine expression that subsequently plays a central role in activation of specific T cell responses. To assess this, DC differentiated from uninfected, YopB+YopJ- or YopB+YopJ+-infected monocytes were treated with LPS and assayed for induction of IP-10, RANTES, IL-12p40, TGF-β and IL-10 by quantitative real-time PCR. As seen in Fig. 3D, infection with the YopJ strain moderately inhibited LPS-mediated induction of IP-10, RANTES and IL-12p40 (and to a lesser extent IL-10) expression compared to the uninfected DC, and up-regulated IFN-β expression. However, DC differentiated from YopB+YopJ+-infected monocytes are nearly completely unresponsive to LPS stimulation as measured by cytokine induction. These results indicate that YopJ's effects during DC differentiation do not simply result in less mature (but still responsive) DC, but generate DC that are no longer responsive to TLR 4-mediated activation.

Induction of T cell responses

Inhibition of costimulatory ligand and cytokine expression predicts that the DC differentiated from YopB+YopJ+-infected monocytes will be less immunostimulatory. Consistent with this, DC differentiated from uninfected and YopB+YopJ-infected monocytes elicited significantly greater T cell proliferation than moDC derived from YopB+YopJ+-infected monocytes (Fig. 4A). To examine whether a longer period of differentiation would diminish the negative effects of YopJ-GSK (suggesting a direct effect of residual YopJ-GSK protein from the original infection), monocytes were differentiated for 2 additional days (Fig. 4A right). However, the differences between the two strains were even more pronounced, consistent with the likelihood that YopJ-GSK is indirectly modulating DC function by affecting differentiation.

thumbnail image

Figure 4. moDC injected with YopJ-GSK have reduced allostimulatory capacity and suppress T cell IFN-γ expression. (A) Allostimulation. Monocytes were differentiated and infected as described in the Materials and methods. DC were differentiated for a total of 6 (left panel) or 8 (right panel) days before the T cell assay was performed. moDC were then cocultured with allogeneic T cells (DC: T cell ratio 1:10). Uninfected, undifferentiated monocytes were used as a negative control. Proliferation was measured by [3H]thymidine incorporation. Comparison between B+J+- and B+J-infected moDC, p<0.005 (both panels). (B) T cell cytokine expression. Purified resting T cells were cocultured with the uninfected or infected DC (with the indicated strains) as described in the Materials and methods. After 96 h, the cultures were stained with anti-CD3 FITC (to identify the T cell population) and the indicated intracellular cytokine, and analyzed by FACS using a viable cell FSC/SSC gate. One of two representative experiments is shown.

Download figure to PowerPoint

In addition to proliferation, up-regulation of cytokine production is a hallmark of T cell activation and is significantly influenced by the interacting DC. Recent studies have demonstrated an important role for IFN-γ in protective immunity against pulmonary Y. pestis infection 43. As seen in Fig. 4B, all three infection conditions (mock, YopB+YopJ, YopB+YopJ+) yielded DC that elicited relatively similar frequencies of IL-4-expressing T cells (somewhat more for the J strains and less for the J+ strains). In contrast, the marked increase in the percentage of IFN-γ-positive T cells elicited by the YopJ DC (46%) is completely absent with YopJ+ DC (3.5%). This may be the result of the loss of IL-12 expression by YopJ+-infected DC (Fig. 3E), as DC production of IL-12 is an important factor in driving differentiation of IFN-γ-expressing Th1 T cells.

Infection with wild-type vs. ΔJ Y. pestis

As the preceding strains lack the other five effector Yops, it is possible that the effect of YopJ-GSK would be different if all the Yops were present. We therefore compared monocyte infection with the wild-type parental Y. pestis strain (expressing all six effector Yops) vs. a yopJ deletion mutant (ΔJ) expressing the other five Yops. An additional aspect of these studies is that YopJ is the native protein produced at normal amounts and without a GSK tag. As seen previously, there was no difference in cell death induced by either strain (Fig. 5A and Table 3). Interestingly, while DC differentiated from ΔJ-infected monocytes had a similar surface antigen phenotype to those from uninfected monocytes, WT-infected monocytes gave rise to a distinct subpopulation of cells that have decreased CD40, CD80 and CD86 expression (Fig. 5B), and to a lesser extent MHC class I, CD86 and CD83. This is similar to the staining pattern seen for the YopB+J+-infected monocytes (Fig. 3C), although the “high” staining DC subpopulation is larger when the parental WT strain is used. The reasons for these distinct subpopulations and the difference between the YopB+J+ and WT strains are unclear – possible explanations include the amount of YopJ injected (which may be less in the WT vs. YopB+J+ strains) and the effect of the other Yops injected by the parental strain that are not injected by the YopB+J+ strains. Also, similar to that seen with YopB+J+vs. YopB+J strains, the allostimulatory ability of moDC from WT-infected monocytes was impaired compared to moDC differentiated from uninfected or ΔJ-infected monocytes (Fig. 5C).

thumbnail image

Figure 5. Infection of monocytes with wild type Yersinia impairs their DC differentiation relative to the ΔJ-infected monocytes. (A) Infection with wild-type or with ΔJ strains cause similar levels of apoptosis. Monocytes were differentiated and infected with wild-type (WT) or ΔJ strains as described in the Materials and methods (without the addition of TNF-α on day 7). After an additional 3 days in GM-CSF + IL-4 (GM/4) monocytes were analyzed for viability by annexin V/PI staining. The percentage of cells in each quadrant is indicated below the dot plots. One representative experiment of two is shown. (B) Surface antigen phenotype. Monocytes were left uninfected or infected with WT or ΔJ strains and differentiated as described in the Materials and methods. Surface antigen expression was analyzed by flow cytometry (open histograms, isotype control; closed histograms, specific antibody). One representative experiment of two is shown. (C) Allo-stimulatory capacity. Monocytes were differentiated and infected as described in the Materials and methods and cocultured with allogeneic T cells (DC: T cell ratio 1:10). Uninfected, undifferentiated monocytes were used as a negative control. Proliferation was measured by [3H]thymidine incorporation. Comparison between wild type and ΔJ-infected cells, p<0.001. One of three representative experiments is shown.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Immune evasion by bacterial pathogens plays an important role in acute infection, and likely is even more important in chronic persistent infections. Although Y. pestis is characteristically an acute lethal infection in humans, it also causes a more persistent infection in more resistant hosts, maintaining its presence between the more dramatic outbreaks in susceptible populations 44. Other pathogenic Yersinia (Y. enterocolitica, Y. pseudotuberculosis) can clearly cause chronic disease in humans. How Yersinia avoids sterilizing immunity is poorly characterized; however, these three Yersinia species encode Yops with similar properties that play a critical role in evading components of the initial innate immune response 4548, and are well positioned to impair the adaptive immune response necessary to clear the infection. Of these, YopJ (YopP in Y. enterocolitica) is a ubiquitin-like cysteine protease with promiscuous deubiquitinating 49 and acetyltransferase activity 24. This is not an essential virulence factor, but inhibits inflammatory responses and induces apoptosis in macrophages 9, 39, 50via inhibition of multiple signaling pathways (including MAPK and NF-κB) 23, 51. Although best characterized in the effector cells of the innate immune system (macrophages, monocytes), it has become evident that Yersinia can also inject Yops into professional APC like DC 3, potentially altering both the adaptive cellular and humoral immune responses that DC play an essential role in initiating. While less is known about YopJ's effect on DC, YopP in Y. enterocolitica infection of fully differentiated DC has been implicated in mediating apoptosis (in murine DC), suppressing cytokine production, antigen presentation and immunostimulatory capacity 14, 17, 18. In Y. pestis, YopJ appears to have less of a negative effect on the survival and immune function of differentiated murine DC, but rather has a marked effect on DC migration 19.

Our findings suggest that YopJ can also inhibit DC immunogenicity upstream of the mature DC, namely by disrupting signaling pathways during progenitor to DC differentiation. Accumulating evidence suggests that there are subsets of DC with defined function (not unlike T cells) that include regulation and inhibition of T cell responses (either directly or through generation of regulatory immune cells). How these regulatory DC subsets arise in vivo is not well defined , but we and others have found that pharmacological (or gene knockout) inhibition of the MAPK/ERK pathway during DC differentiation inhibits T cell stimulatory capability, while blocking NF-κB signaling (in particular Rel B) suppresses CD40 plus other costimulatory ligand expression, and results in DC that are tolerogenic (Lindner et al., manuscript submitted, 2022, 52) or generate regulatory T cells 22. Our current findings suggest that a bacterial effector protein, YopJ, can also do this. We postulate that YopJ-GSK blocks NF-κB and MAPK signaling triggered by DC-differentiating agents, and results in disruption of the development of characteristic dendrite morphology, decreased costimulatory ligand expression (in particular CD40), loss of LPS responsiveness as measured by cytokine induction, and diminished capability to induce allo-T cell proliferation and IFN-γ production. The finding that infection with YopJ+ strains yields DC that are unresponsive to LPS (at least as measured by cytokine induction) indicates that YopJ is not simply generating immature but responsive DC, but a cell that is more functionally fixed. While an effect on TLR4-mediated responses by Yersinia virulence factors has not been reported, Yersinia V-antigen has been found to modulate TLR2 responses in macrophages to induce immunosuppressive IL-10 secretion 53. Although it is possible that YopJ is mediating these effects through pathways other than NF-κB and MAPK, many of our current findings are consistent with the previous studies using pharmacological inhibitors or gene knockout.

In contrast to these effects, we did not find an obvious role for YopJ in Yersinia-mediated cell death in our experimental system as has been reported for macrophages and murine DC. An important caveat is that our studies were not designed to rigorously characterize YopJ-mediated apoptosis. Interestingly, however, it has been recently suggested that YopJ-mediated killing of DC is a much less prominent feature of Y. pestis than seen for Y. enterocolitica19 or Y. pseudotuberculosis9.

The fact that YopJ-GSK is still present at significant levels 24 h after a 1-h infection suggests that YopJ is very stable within the eukaryotic cell. Previous studies have shown that the activities of injected bacterial effector proteins can be temporally regulated within the host cell by differential protein degradation 54. For example, the Salmonella enterica GEF SopE, which activates Rho-GTPase family members required for bacterial entry, has an extremely short half-life (t1/2 <30 min), whereas, SptP, an injected effector with GAP activity has a relatively long half-life (t1/2 >1 h), which allows this effector to reverse the cellular changes initiated by SopE following bacterial entry. In a similar manner, YopJ may be designed to function after the more cytotoxic anti-phagocytic Yops. Thus, injected YopE functions immediately to block bacterial phagocytosis and, if enough is injected, may kill the cell; however, if an injected monocyte/DC escapes YopE-mediated cell death (and migrates away from the site of active infection), YopJ may persist and function to prevent DC function and differentiation or lead to the generation of tolerance.

Our study contrasts with those of Saikh et al.55, who found that Y. pestis infection of human monocytes facilitates their differentiation to DC. This difference may be due to the different Yersinia strains used. We have used Pla+ strains, whereas Saikh et al.56 used Pla strains. The Pla protease appears to be an essential virulence factor, and it is possible that the less virulent Pla strains allow for better monocyte survival and activation/differentiation. Also, Pla functions in eukaryotic cell attachment, and thus may be required for efficient Yop injection. Thus, the Yop inhibitory effects on monocytes may be lessened in Pla strains.

Despite the importance of T lymphocytes in protection against Yersinia spp., it has been shown that this response does not always protect the host infected with Y. pseudotuberculosis or Y. enterocolitica against persistent infections 5760. These findings and our study suggests that Yersinia may cripple DC function to durably inactivate these responses. Thus, YopJ may not only participate in overcoming innate immunity in the acute setting, but may also modulate the immunological environment through its effects on DC to generate a setting conducive for chronic infections/carrier states.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

Cell culture and bacterial strains

K562 were obtained from American Type Culture Collection (Manassas, VA) and cultured as previously described 25 with 20 μg/mL chloramphenicol (Sigma-Aldrich, St. Louis, MO). DC differentiation was induced by 5-day culture with PMA as previously described 25.

PBMC were obtained from healthy donors, and monocytes isolated as previously described 37 or by plastic adherence followed by immunomagnetic-negative selection of CD3+ cell (Miltenyi Biotec). Typically, the monocytes purity ranged from 40% to 60%. For the experiments examining monocyte/DC surface phenotype and cytokine expression, monocytes were immunomagnetically purified by positive selection using CD14 microbeads (Miltenyi-Biotec), yielding monocyte purities >85%. Phenotypic and functional analysis of undifferentiated monocytes were done with fresh monocytes (within 24 h of isolation). To generate DC, monocytes were cultured with GM-CSF (1000 U/mL) and IL-4 (1000 U/mL) for 7 days, with TNF-α (10 ng/mL) added for the last day. Cell counts/viability were assessed by trypan blue.

Bacterial strains: Y. pestis KIM5 (parent) and derivatives of this strain used in this study are Pgm61. Y. pestis KIM5–3173 is YopJ (ΔJ) due to a bacteriophage Mu dI1734 insertion in yopJ of pCD1 62. The secretion- and injection-competent poly-yop deletion mutant Y. pestis KIM5–3001.48 (sycE yopE::km yopJ yopT yopM yopH ypkA lcrQ) and the injection-defective poly-yop deletion mutant KIM5–3001.49 (sycE yopE::km yopJ yopT yopM yopH ypkA lcrQ yopB) have been previously described 26. Plasmids pYopJ-GSK encodes full-length YopJ carrying a phosphorylatable C-terminal 13 residue GSK-tag that can be detected by phospho-specific anti-GSK antibodies (Cell Signaling, Beverly, MA). Y. pestis cultures were grown overnight at 27°C in heart infusion broth (HIB) and 100 μg/mL (ampicillin or streptomycin) or 25 μg/mL kanamycin. Overnight cultures were supplemented with 2.5 mM CaCl2, and grown at 27°C for 1 h, and 37°C for 2 h in the presence of 0.5% arabinose to induce YopJ-GSK expression. Bacteria were harvested by centrifugation and resuspended in IMDM containing 0.2% arabinose (no antibiotics) for infection experiments.

Infection of K562 and monocytes

Cells (5 × 106/mL) were serum starved for 30 min, and infected at an MOI of 30 (K562) or 10 (monocytes) at 37°C for 1 h. After infection cells were either lysed immediately or treated with 2 μg/mL gentamicin sulfate (BioWhittaker, Walkersville, ME) for 1 hour at 37°C to kill extracellular and intracellular bacteria, then used further for differentiation. Cells were placed back into media containing penicillin/streptomycin and chloramphenicol, and there was no bacterial outgrowth contamination over the next 10 days of cell culture.

Flow cytometry

Cells were stained as previously reported 63 using the following mAb: MHC class I and class II (VMRD Inc., Pullman, WA), CD14, CD80, CD86 (BD Pharmingen, San Diego, CA), CD40 and CD83 (both from Immunotech, Westbrook, ME). Appropriate isotype-matched Ab were used as controls and 10 000 live cells were analyzed on a Coulter XL flow cytometer (Coulter, Hialeah, FL). Staining with 2 μg/mL propidium iodine (PI) (Molecular Probes), and 1 μL/test Annexin-V (Biovision, Freiburg, Germany) was used for cell viability. For intracellular cytokine staining, purified allogeneic T cells were cocultured with the indicated DC for 3 days at a DC:T cell ratio of 1:10. Golgi Stop (BD PharMingen) was added for the last 5 h of culture. Cells were harvested, washed, stained with anti-CD3 FITC (BD Pharmingen, San Diego, CA) fixed and permeabilized, using Cytofix/Cytoperm kit (BD PharMingen) according to the manufacturer's instructions. Cells were then stained with 0.5 μg/test anti-IFN-γ-PE or anti-IL-4-PE and analyzed using CellQuest software (Becton Dickinson).

T cell proliferation assays

The DC generated were γ-irradiated (12 000 R 60Co for K562, 2000 R 60Co for monocytes) and cocultured with 1 × 105 cells/well purified allogeneic T cells. [Methyl-3H]thymidine (1 μCi/well) was added for the final 18 h of culture, and incorporation measured using the Beta Plate scintillation counting system (Wallac Inc., Gaithersburg, MD). All conditions were performed in triplicates, and data are represented as the mean counts of stimulators plus T cells minus counts of stimulators alone ± 1 SD.

Western blot

Western blot for Rel B, phospho-ERK1/2, GSKβ, phospho-GSKβ, and actin were performed as previously described 63 using antibodies against Rel B (c-19) (Santa Cruz Biotechnology, Santa Cruz, CA), phospho-ERK1/2 (Cell Signaling), phospho-GSKβ (Cell Signaling) or β-actin (Sigma-Aldrich) (all at 1:500).

LPS-induced DC cytokine quantitation

DC were differentiated from purified monocytes as above, and then treated with LPS (5 μg/mL, InVivogen, San Diego, CA) for 6 h, or left untreated. RNA was isolated using RNeasy Mini Kits (Qiagen), cDNA was synthesized using a mix of oligo dT, random hexamer (Ambion) and SuperScript RT-III reverse transcriptase (Invitrogen Corp.) following manufacturer's protocol. Quantitative real-time PCR was performed on an iCycler (Bio-Rad Laboratories Inc.) using the following set of primers, designed to span introns: IP-10 forward: AGTGGCATTCAAGGAGTACCTC, reverse: GGACAAAATTGGCTTGCAGG; RANTES forward: ATCTGCCTCCCCATATTCCT, reverse: GTGACAAAGACGACTGCTGG; IL-12 p40 forward: GAGTACCCTGACACCTGGAGTAC, reverse: GCTGAGGTCTTGTCCGTGAAG; IFN-β forward: AGTGTCTCCTCCAAATTGCTCTCC, reverse: CCACAGGAGCTTCTGACACTGAAA; IL-10 forward: GGAGAACCTGAAGACCCTCA, reverse: GCCTTTCTCTTGGAGCTTAT; and GAPDH forward 5′-CGGAGTCAACGGATTTGGTCGTA-3′, reverse 5′-AGCCTTCATGGTGGTGAAGAC-3′. In each assay, the mRNA under study was normalized to an internal house-keeping gene (GAPDH) and expressed as fold induction. PCR reactions were run in triplicates of 30-µL reactions that contained Quanti-Tect Probe PCR Master Mix (QIAGEN), 4 pmol of each forward and reverse primer, and cDNA. Aliquots of first-strand cDNA were amplified using the QuantiTect SYBR Green PCR Kit (QIAGEN) under the following conditions: initial denaturation for 15 min at 94°C followed by 40 cycles consisting of 15 s at 94°C, 30 s at 60°C and 30 s at 72°C. Cycle numbers were obtained in the log-linear phase of the reaction and plotted against a standard curve generated for each set of primers. Results were analyzed in the linear part of the reactions using iCycler analysis software. The melting curve for each primer pair was used to monitor the purity of each quantified amplicon.

Statistical analysis

Statistical analysis was done using Student's unpaired t-test.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements

This work was supported by PHS/NIH grants CA85208, CA95829 and AI 39575.

  • 1

    WILEY-VCH

  • 2

    WILEY-VCH

  • 3

    WILEY-VCH

  • 4

    WILEY-VCH

  • 5

    WILEY-VCH

  • 1
    Perry, R. D. and Fetherston, J. D., Yersinia pestis–etiologic agent of plague. Clin. Microbiol. Rev. 1997. 10: 3566.
  • 2
    Juris, S. J., Shao, F. and Dixon, J. E., Yersinia effectors target mammalian signalling pathways. Cell Microbiol. 2002. 4: 201211.
  • 3
    Marketon, M. M., Depaolo, R. W., Debord, K. L., Jabri, B. and Schneewind, O., Plague bacteria target immune cells during infection. Science 2005. 309:17391741.
  • 4
    Cornelis, G. R., Boland, A., Boyd, A. P., Geuijen, C., Iriarte, M., Neyt, C., Sory, M. P. and Stainier, I., The virulence plasmid of Yersinia, an antihost genome. Microbiol. Mol. Biol. Rev. 1998. 62: 13151352.
  • 5
    Iriarte, M. and Cornelis, G. R., YopT, a new Yersinia Yop effector protein, affects the cytoskeleton of host cells. Mol. Microbiol. 1998. 29: 915929.
  • 6
    Rosqvist, R., Forsberg, A. and Wolf-Watz, H., Intracellular targeting of the Yersinia YopE cytotoxin in mammalian cells induces actin microfilament disruption. Infect. Immun. 1991. 59: 45624569.
  • 7
    Schesser, K., Spiik, A. K., Dukuzumuremyi, J. M., Neurath, M. F., Pettersson, S. and Wolf-Watz, H., The yopJ locus is required for Yersinia-mediated inhibition of NF-kappaB activation and cytokine expression: YopJ contains a eukaryotic SH2-like domain that is essential for its repressive activity. Mol. Microbiol. 1998. 28: 10671079.
  • 8
    Lian, C. J., Hwang, W. S. and Pai, C. H., Plasmid-mediated resistance to phagocytosis in Yersinia enterocolitica. Infect. Immun. 1987. 55: 11761183.
  • 9
    Monack, D. M., Mecsas, J., Ghori, N. and Falkow, S., Yersinia signals macrophages to undergo apoptosis and YopJ is necessary for this cell death. Proc. Natl. Acad. Sci. USA 1997. 94: 1038510390.
  • 10
    Autenrieth, I. B., Tingle, A., Reske-Kunz, A. and Heesemann, J., T lymphocytes mediate protection against Yersinia enterocolitica in mice: characterization of murine T-cell clones specific for Y. enterocolitica. Infect. Immun. 1992. 60: 11401149.
  • 11
    Green, M., Rogers, D., Russell, P., Stagg, A. J., Bell, D. L., Eley, S. M., Titball, R. W. and Williamson, E. D., The SCID/Beige mouse as a model to investigate protection against Yersinia pestis. FEMS Immunol. Med. Microbiol. 1999. 23: 107113.
  • 12
    Parent, M. A., Berggren, K. N., Mullarky, I. K., Szaba, F. M., Kummer, L. W., Adamovicz, J. J. and Smiley, S. T., Yersinia pestis V protein epitopes recognized by CD4 T cells. Infect. Immun. 2005. 73: 21972204.
  • 13
    Yao, T., Mecsas, J., Healy, J. I., Falkow, S. and Chien, Y., Suppression of T and B lymphocyte activation by a Yersinia pseudotuberculosis virulence factor, yopH. J. Exp. Med. 1999. 190: 13431350.
  • 14
    Trulzsch, K., Geginat, G., Sporleder, T., Ruckdeschel, K., Hoffmann, R., Heesemann, J. and Russmann, H., Yersinia outer protein P inhibits CD8 T cell priming in the mouse infection model. J. Immunol. 2005. 174: 42444251.
  • 15
    Banchereau, J. and Steinman, R. M., Dendritic cells and the control of immunity. Nature 1998. 392: 245252.
  • 16
    Guarner, J., Shieh, W. J., Greer, P. W., Gabastou, J. M., Chu, M., Hayes, E., Nolte, K. B. and Zaki, S. R., Immunohistochemical detection of Yersinia pestis in formalin-fixed, paraffin-embedded tissue. Am. J. Clin. Pathol. 2002. 117: 205209.
  • 17
    Erfurth, S. E., Grobner, S., Kramer, U., Gunst, D. S., Soldanova, I., Schaller, M., Autenrieth, I. B. and Borgmann, S., Yersinia enterocolitica induces apoptosis and inhibits surface molecule expression and cytokine production in murine dendritic cells. Infect. Immun. 2004. 72: 70457054.
  • 18
    Schoppet, M., Bubert, A. and Huppertz, H. I., Dendritic cell function is perturbed by Yersinia enterocolitica infection in vitro. Clin. Exp. Immunol. 2000. 122: 316323.
  • 19
    Velan, B., Bar-Haim, E., Zauberman, A., Mamroud, E., Shafferman, A. and Cohen, S., Discordance in the effects of Yersinia pestis on dendritic cell functions: Induction of maturation and paralysis of migration. Infect. Immun. 2006. 74: 63656376.
  • 20
    Xie, J., Wang, Y., Freeman, M. E., 3rd, Barlogie, B. and Yi, Q., Beta 2-microglobulin as a negative regulator of the immune system: high concentrations of the protein inhibit in vitro generation of functional dendritic cells. Blood 2003. 101: 40054012.
  • 21
    Wu, L., D'Amico, A., Winkel, K. D., Suter, M., Lo, D. and Shortman, K., RelB is essential for the development of myeloid-related CD8alpha dendritic cells but not of lymphoid-related CD8alpha+ dendritic cells. Immunity 1998. 9: 839847.
  • 22
    Martin, E., O'Sullivan, B., Low, P. and Thomas, R., Antigen-specific suppression of a primed immune response by dendritic cells mediated by regulatory T cells secreting interleukin-10. Immunity 2003. 18: 155167.
  • 23
    Orth, K., Xu, Z., Mudgett, M. B., Bao, Z. Q., Palmer, L. E., Bliska, J. B., Mangel, W. F. et al., Disruption of signaling by Yersinia effector YopJ, a ubiquitin-like protein protease. Science 2000. 290: 15941597.
  • 24
    Mukherjee, S., Keitany, G., Li, Y., Wang, Y., Ball, H. L., Goldsmith, E. J. and Orth, K., Yersinia YopJ acetylates and inhibits kinase activation by blocking phosphorylation. Science 2006. 312: 12111214.
  • 25
    Lindner, I., Kharfan-Dabaja, M. A., Ayala, E., Kolonias, D., Carlson, L. M., Beazer-Barclay, Y., Scherf, U. et al., Induced dendritic cell differentiation of chronic myeloid leukemia blasts is associated with down-regulation of BCR-ABL. J. Immunol. 2003. 171: 17801791.
  • 26
    Day, J. B., Ferracci, F. and Plano, G. V., Translocation of YopE and YopN into eukaryotic cells by Yersinia pestis yopN, tyeA, sycN, yscB and lcrG deletion mutants measured using a phosphorylatable peptide tag and phosphospecific antibodies. Mol. Microbiol. 2003. 47: 807823.
  • 27
    Garcia, J. T., Ferracci, F., Jackson, M. W., Joseph, S. S., Pattis, I., Plano, L. R., Fischer, W. and Plano, G. V., Measurement of effector protein injection by type III and type IV secretion systems by using a 13-residue phosphorylatable glycogen synthase kinase tag. Infect. Immun. 2006. 74: 56455657.
  • 28
    Cornelis, G. R., Molecular and cell biology aspects of plague. Proc. Natl. Acad. Sci. USA 2000. 97: 87788783.
  • 29
    Tardy, F., Homble, F., Neyt, C., Wattiez, R., Cornelis, G. R., Ruysschaert, J. M. and Cabiaux, V., Yersinia enterocolitica type III secretion-translocation system: channel formation by secreted Yops. EMBO J. 1999. 18: 67936799.
  • 30
    Cross, D. A., Alessi, D. R., Cohen, P., Andjelkovich, M. and Hemmings, B. A., Inhibition of glycogen synthase kinase-3 by insulin mediated by protein kinase B. Nature 1995. 378: 785789.
  • 31
    Delcommenne, M., Tan, C., Gray, V., Rue, L., Woodgett, J. and Dedhar, S., Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc. Natl. Acad. Sci. USA 1998. 95: 1121111216.
  • 32
    St Louis, D. C., Woodcock, J. B., Fransozo, G., Blair, P. J., Carlson, L. M., Murillo, M., Wells, M. R. et al., Evidence for distinct intracellular signaling pathways in CD34+ progenitor to dendritic cell differentiation from a human cell line model. J. Immunol. 1999. 162: 32373248.
  • 33
    Platzer, B., Jorgl, A., Taschner, S., Hocher, B. and Strobl, H., RelB regulates human dendritic cell subset development by promoting monocyte intermediates. Blood 2004. 104: 36553663.
  • 34
    Pettit, A. R., Quinn, C., MacDonald, K. P., Cavanagh, L. L., Thomas, G., Townsend, W., Handel, M. and Thomas, R., Nuclear localization of RelB is associated with effective antigen-presenting cell function. J. Immunol. 1997. 159: 36813691.
  • 35
    O'Sullivan, B. J. and Thomas, R., CD40 ligation conditions dendritic cell antigen-presenting function through sustained activation of NF-kappaB. J. Immunol. 2002. 168: 54915498.
  • 36
    Viboud, G. I., So, S. S., Ryndak, M. B. and Bliska, J. B., Proinflammatory signalling stimulated by the type III translocation factor YopB is counteracted by multiple effectors in epithelial cells infected with Yersinia pseudotuberculosis. Mol. Microbiol. 2003. 47: 13051315.
  • 37
    Zhou, L. J. and Tedder, T. F., CD14+ blood monocytes can differentiate into functionally mature CD83+ dendritic cells. Proc. Natl. Acad. Sci. USA 1996. 93: 25882592.
  • 38
    Chromy, B. A., Perkins, J., Heidbrink, J. L., Gonzales, A. D., Murphy, G. A., Fitch, J. P. and McCutchen-Maloney, S. L., Proteomic characterization of host response to Yersinia pestis and near neighbors. Biochem. Biophys. Res. Commun. 2004. 320: 474479.
  • 39
    Mills, S. D., Boland, A., Sory, M. P., van der Smissen, P., Kerbourch, C., Finlay, B. B. and Cornelis, G. R., Yersinia enterocolitica induces apoptosis in macrophages by a process requiring functional type III secretion and translocation mechanisms and involving YopP, presumably acting as an effector protein. Proc. Natl. Acad. Sci. USA 1997. 94: 1263812643.
  • 40
    Rotta, G., Edwards, E. W., Sangaletti, S., Bennett, C., Ronzoni, S., Colombo, M. P., Steinman, R. M. et al., Lipopolysaccharide or whole bacteria block the conversion of inflammatory monocytes into dendritic cells in vivo. J. Exp. Med. 2003. 198: 12531263.
  • 41
    Xie, J., Qian, J., Wang, S., Freeman, M. E. 3rd, Epstein, J. and Yi, Q., Novel and detrimental effects of lipopolysaccharide on in vitro generation of immature dendritic cells: involvement of mitogen-activated protein kinase p38. J. Immunol. 2003. 171: 47924800.
  • 42
    Benvenuti, F., Hugues, S., Walmsley, M., Ruf, S., Fetler, L., Popoff, M., Tybulewicz, V. L. and Amigorena, S., Requirement of Rac1 and Rac2 expression by mature dendritic cells for T cell priming. Science 2004. 305: 11501153.
  • 43
    Parent, M. A., Wilhelm, L. B., Kummer, L. W., Szaba, F. M., Mullarky, I. K. and Smiley, S. T., Gamma interferon, tumor necrosis factor alpha, and nitric oxide synthase 2, key elements of cellular immunity, perform critical protective functions during humoral defense against lethal pulmonary Yersinia pestis infection. Infect. Immun. 2006. 74: 33813386.
  • 44
    Christie, A. B., Plague: review of ecology. Ecol. Dis. 1982. 1: 111115.
  • 45
    Hitchen, P. G., Prior, J. L., Oyston, P. C., Panico, M., Wren, B. W., Titball, R. W., Morris, H. R. and Dell, A., Structural characterization of lipo-oligosaccharide (LOS) from Yersinia pestis: regulation of LOS structure by the PhoPQ system. Mol. Microbiol. 2002. 44: 16371650.
  • 46
    Cornelis, G., Laroche, Y., Balligand, G., Sory, M. P. and Wauters, G., Yersinia enterocolitica, a primary model for bacterial invasiveness. Rev. Infect. Dis. 1987. 9: 6487.
  • 47
    Straley, S. C., Skrzypek, E., Plano, G. V. and Bliska, J. B., Yops of Yersinia spp. pathogenic for humans. Infect. Immun. 1993. 61: 31053110.
  • 48
    Cornelis, G. R., Biot, T., Lambert de Rouvroit, C., Michiels, T., Mulder, B., Sluiters, C., Sory, M. P. et al., The Yersinia yop regulon. Mol. Microbiol. 1989. 3: 14551459.
  • 49
    Zhou, H., Monack, D. M., Kayagaki, N., Wertz, I., Yin, J., Wolf, B. and Dixit, V. M., Yersinia virulence factor YopJ acts as a deubiquitinase to inhibit NF-kappa B activation. J. Exp. Med. 2005. 202: 13271332.
  • 50
    Denecker, G., Declercq, W., Geuijen, C. A., Boland, A., Benabdillah, R., van Gurp, M., Sory, M. P. et al., Yersinia enterocolitica YopP-induced apoptosis of macrophages involves the apoptotic signaling cascade upstream of bid. J. Biol. Chem. 2001. 276: 1970619714.
  • 51
    Orth, K., Palmer, L. E., Bao, Z. Q., Stewart, S., Rudolph, A. E., Bliska, J. B. and Dixon, J. E., Inhibition of the mitogen-activated protein kinase kinase superfamily by a Yersinia effector. Science 1999. 285: 19201923.
  • 52
    Luo, X., Liu, L., Tang, N., Lu, K. Q., McCormick, T. S., Kang, K. and Cooper, K. D., Inhibition of monocyte-derived dendritic cell differentiation and interleukin-12 production by complement iC3b via a mitogen-activated protein kinase signalling pathway. Exp. Dermatol. 2005. 14: 303310.
  • 53
    Sing, A., Rost, D., Tvardovskaia, N., Roggenkamp, A., Wiedemann, A., Kirschning, C. J., Aepfelbacher, M. and Heesemann, J., Yersinia V-antigen exploits toll-like receptor 2 and CD14 for interleukin 10-mediated immunosuppression. J. Exp. Med. 2002. 196: 10171024.
  • 54
    Kubori, T. and Galan, J. E., Temporal regulation of salmonella virulence effector function by proteasome-dependent protein degradation. Cell 2003. 115: 333342.
  • 55
    Saikh, K. U., Kissner, T. L., Sultana, A., Ruthel, G. and Ulrich, R. G., Human monocytes infected with Yersinia pestis express cell surface TLR9 and differentiate into dendritic cells. J. Immunol. 2004. 173: 74267434.
  • 56
    Sodeinde, O. A., Subrahmanyam, Y. V., Stark, K., Quan, T., Bao, Y. and Goguen, J. D., A surface protease and the invasive character of plague. Science 1992. 258: 10041007.
  • 57
    Gaston, J. S., Cox, C. and Granfors, K., Clinical and experimental evidence for persistent Yersinia infection in reactive arthritis. Arthritis Rheum. 1999. 42: 22392242.
  • 58
    Georgescu, C., Dan, E., Cojocaru, M. and Plosceanu, L., The role of infections with Yersinia pseudotuberculosis and Yersinia enterocolitica in the pathogenesis of chronic inflammatory, rheumatic and collagen diseases. Med. Interne 1986. 24: 217220.
  • 59
    Saebo, A. and Lassen, J., Acute and chronic liver disease associated with Yersinia enterocolitica infection: a Norwegian 10-year follow-up study of 458 hospitalized patients. J. Intern. Med. 1992. 231: 531535.
  • 60
    Hoogkamp-Korstanje, J. A., de Koning, J. and Heesemann, J., Persistence of Yersinia enterocolitica in man. Infection 1988. 16: 8185.
  • 61
    Une, T. and Brubaker, R. R., In vivo comparison of avirulent Vwa- and Pgm- or Pstr phenotypes of yersiniae. Infect. Immun. 1984. 43: 895900.
  • 62
    Price, S. B. and Straley, S. C., lcrH, a gene necessary for virulence of Yersinia pestis and for the normal response of Y. pestis to ATP and calcium. Infect. Immun. 1989. 57: 14911498.
  • 63
    Davis, T. A., Saini, A. A., Blair, P. J., Levine, B. L., Craighead, N., Harlan, D. M., June, C. H. and Lee, K. P., Phorbol esters induce differentiation of human CD34+ hemopoietic progenitors to dendritic cells: evidence for protein kinase C-mediated signaling. J. Immunol. 1998. 160: 36893697.