SEARCH

SEARCH BY CITATION

Keywords:

  • Natural killer cells;
  • Sp1;
  • T-bet;
  • Transcriptional control

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Supporting Information

Murine T-bet (T-box expressed in T cells) is a master regulator of IFN-γ gene expression in NK and T cells. T-bet also plays a critical role in autoimmunity, asthma and other diseases. However, cis elements or trans factors responsible for regulating T-bet expression remain largely unknown. Here, we report on our discovery of six Sp1-binding sites within the proximal human T-BET promoter that are highly conserved among mammalian species. Electrophoretic mobility shift assays demonstrate a physical association between Sp1 and the proximal T-BET promoter with a direct dose response between Sp1 expression and T-BET promoter activity. Ectopic overexpression of Sp1 also enhanced T-BET expression and cytokine-induced IFN-γ secretion in NK cells and T cells. Mithramycin A, which blocks the binding of Sp1 to the T-BET promoter, diminished both T-BET expression and IFN-γ protein production in monokine-stimulated primary human NK cells. Collectively, our results suggest that Sp1 is a positive transcriptional regulator of T-BET. As T-BET and IFN-γ are critically important in inflammation, infection, and cancer, targeting Sp1, possibly with mithramycin A, may be useful for preventing and/or treating diseases associated with aberrant T-BET or IFN-γ expression.

Abbreviations:
Sp1:

specificity protein 1

T-bet:

T-box expressed in T cells

Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Supporting Information

T-bet T-box expressed in T cells is a member of the T-box transcription factor family and has been shown to be (i) a positive “master” transcriptional regulator of IFN-γ production in CD4+ T cells, NK cells, and effector CD8+ T cells 14 and, (ii) important for the commitment of CD4+ T cells to Th1 development 3, 57. T-bet has also recently been shown to regulate murine IFN-γ production by B effector 1 cells 8. In addition, T-bet is required by dendritic cells for the optimal production of IFN-γ and for full activation of antigen-specific Th1 cells 9. Experiments in T-bet–/– mice support its importance in control of Leishmania major infection, lymphocytic choriomeningitis virus infection, insulin dependent diabetes, inflammatory bowel disease, experimental allergic encephalomyelitis, asthma and other Th1-mediated diseases 3, 1014.

Given the role of T-bet, gaining a better understanding of the molecular mechanisms controlling its gene expression is important, yet poorly defined. Data from mice and humans suggest that monocyte-derived proinflammatory cytokines IL-12, IL-15 and IL-18 each activate various signal transducers and activators of transcription (STAT) and are also able to induce transcription of T-bet and its human homologue T-BET1, 3, 4, 14, 15. This suggests that STAT may play a role in the regulation of this gene; however, the regulation of T-bet has been reported as both STAT4 dependent and STAT4 independent 5, 7, 16. T-bet induces IFN-γ that in turn positively regulates T-bet expression 17, but there is no consistent conclusion on whether the regulation is or is not mediated by STAT1 5, 8, 16, 18, 19. The anti-inflammatory cytokine TGF-β1 has previously been shown to down-regulate T-bet 14, 15, 20, and in some but not all instances this is mediated by SMAD proteins 21. Minter et al.22 recently reported that murine T-bet could be regulated by the transcriptional activator Notch1 via complexes formed on its promoter. Nonetheless, neither cis nor trans regulatory elements have been clearly defined for T-BET in humans.

A GC box [5′-(G/A)(G/A)GGCG(G/T)(G/A)(G/A)(G/T)-3′] is one of the important cis-acting DNA regulatory elements required for the expression of many genes. The transcription factor specificity protein 1 (Sp1) binds and acts through GC boxes to regulate gene expression in trans23, 24. In this study, we identify six potential Sp1-binding sites located immediately 5′ of the putative TATA box on the promoter of the human T-BET gene. We demonstrate that Sp1 binds to the T-BET proximal promoter within this region, that Sp1 induces T-BET expression, that there is a direct relationship between Sp1 expression and monokine-activated T-BET and IFN-γ expression in NK cells, and that T-BET and IFN-γ expression can be diminished by mithramycin A, a drug that interferes with the binding of Sp1 to its target gene promoters.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Supporting Information

Association of Sp1 with proximal T-BET promoter

Our examination of the 100-bp proximal human T-BET promoter sequence revealed six GC-rich putative Sp1-binding sites located from –101 to –44 (Fig. 1A). We also found that the sequence of the 100-bp proximal T-BET promoter region is highly homologous among different mammalian species with conservation of at least four Sp1-binding sites (Fig. 1B and not shown), suggesting that this 5′ region could be important for gene regulation. We first used recombinant Sp1 proteins and performed EMSA to determine if there was evidence for its binding to the T-BET promoter, and found that the proximal (–101 to –44) T-BET promoter formed complexes with recombinant Sp1 proteins in a dose-dependent manner (Fig. 2A, lanes 1–4). In addition, these DNA-protein complexes were further retarded when the binding reaction was supplemented with anti-Sp1 antibodies (Fig. 2A, lane 5).

thumbnail image

Figure 1. Gene regulatory elements located at the 100-bp proximal T-BET promoter. (A) The sequences of the 100-bp human T-BET promoter region (-101 to +13). Number +1 and an arrow denote the transcription start site; negative numbers represent the position of nucleotides upstream of the transcription start site; boxed TCATAAA sequence located at –39 to –33 is referred to as a potential TATA-like box. Sequences were analyzed with the computer programs, AliBaba2.1 and PATCH 46, 47, which identify transcription factor-binding sites for both coding and non-coding strands. Potential Sp1-binding sites are underlined. (B) Conservation of the proximal T-BET promoter region in mammals. Multiple sequence alignment of T-BET promoters was performed using CLUSTALW and presented with BOXSHADE access through the "Biology Workbench" internet site (http://workbench.sdsc.edu). Background color scheme: grey, completely conserved residues; dark grey, identical residues; light grey, similar residues; and white, different residues.

Download figure to PowerPoint

thumbnail image

Figure 2. The proximal promoter region of T-BET is bound by Sp1. (A) EMSA of 32P-T-BET promoter DNA and increasing amounts of recombinant human Sp1 (rhSp1) (lanes 1–4). The DNA-protein complexes formed a further retarded complex with Sp1 antibodies (α-Sp1) (lane 5). (B) EMSA of 32P-T-BET promoter DNA and total or nuclear extracts from primary T cells or NK cell lines: NK-92, uninfected NKL, PINCO-infected NKL (NKL/PINCO), and PINCO-Sp1-infected NKL (NKL/Sp1). (C) DNA competition assays. Unlabeled competitor DNA as indicated was added to the 32P-T-BET promoter DNA probe before adding NK-92 nuclear extracts. (D) Antibody gel supershift assays. Complexes formed between T-BET promoter DNA and NK-92 total extracts (lane 1) supershift with Sp1 antibody (α-Sp1) (lane 2). (E) EMSA, Western blotting, and Southwestern blotting of total or subcellular extracts of NK-92 cells. Upper panel, EMSA showing 32P-T-BET promoter DNA-protein complexes formed by total extracts (T, lane 1) and nuclear extracts (N, lane 2), but not cytoplasmic extracts (C, lane 3); Middle panel, Western blotting of the above extracts using α-Sp1; lower panel, the protein filter from Western blotting above was subjected to Southwestern blotting using 32P-T-BET DNA. Signals of ∼95 kDa were seen in both Western and Southwestern blotting (solid arrows). In EMSA from (A) to (D), solid arrows: T-BET DNA-Sp1 protein complexes; open arrows: α-Sp1 supershifted complexes.

Download figure to PowerPoint

We next performed EMSA using T-BET DNA and total cellular or nuclear extracts prepared from NKL (uninfected or infected with a mock PINCO virus or a PINCO-Sp1 virus) and NK-92 cell lines, as well as primary human T cells. At least one slower migrating DNA-protein complex was observed for each sample (Fig. 2B, arrows). DNA-binding specificity was demonstrated by DNA competition assays, in which excess unlabeled T-BET DNA abolished the formation of all DNA-protein complexes, whereas an irrelevant AP1 DNA did not (Fig. 2C, lanes 2 and 4). In addition, excess unlabeled DNA containing the Sp1 consensus sequence abolished the formation of the slowest migrating complex but not the faster migrating complex, suggesting that the former rather than the latter complex contained Sp1 (Fig. 2C, lane 3). Subsequently, using nuclear extracts from NK-92 cells, we further demonstrated by antibody-supershift assays that the slowest migrating DNA-protein complexes contained Sp1 (Fig. 2D).

To further characterize those DNA-binding proteins that interact with T-BET promoter DNA, EMSA, Western blots and Southwestern blots were performed with sub-cellular protein fractions. In EMSA, total and nuclear extracts, but not cytoplasmic extracts, yielded protein-DNA complexes with the T-BET promoter DNA (Fig. 2E, top). Western blotting using Sp1 antibodies showed signals of ∼95 kDa from total and nuclear extracts, but not from cytoplasmic extracts, in agreement with the fact that Sp1 is a nuclear protein (Fig. 2E, middle). Southwestern blotting analysis of the protein filters yielded signals at the Sp1 protein position (Fig. 2E, bottom). Taken together, the above data suggest that Sp1 proteins bind to the proximal human T-BET promoter.

Sp1 induces promoter activity of T-BET

To test whether the binding of Sp1 to the T-BET promoter functionally regulates its gene expression, we performed a luciferase reporter assay. We transiently cotransfected increasing amounts of PINCO-Sp1 into 293T cells with either a 100-bp or 43-bp human T-BET promoter upstream of luciferase in a pGL3 vector. As shown in Fig. 3A, overexpression of Sp1 in 293T cells enhanced the 100-bp T-BET promoter activity in a dose-dependent fashion. Transfection of 5 μg of PINCO-Sp1 enhanced promoter activity fourfold over baseline (p <0.01, n = 3). In contrast, overexpression of PINCO-Sp1 did not stimulate the activity of the 43-bp promoter (Fig. 3A), which lacks the Sp1-binding sites (Fig. 1A). We then used a 1-kb T-BET promoter with or without the deletion of the six Sp1-binding sites (–101 to –44). Again, we found that the transfection of PINCO-Sp1 resulted in an increase in the activity of the 1-kb promoter, but not the deletion construct, in a dose-dependent fashion, compared to the transfection of the PINCO vector alone (Fig. 3B). The experiment was also performed in HeLa cells and similar results were obtained (Fig. 3C).

thumbnail image

Figure 3. Increase of the T-BET proximal promoter activity by Sp1 protein. (A) 293T cells were co-transfected with the 100- or 43-bp T-BET-Luc reporter construct and various amounts of PINCO-Sp1. Transfection of ⩾0.5 μg of the PINCO-Sp1 expression plasmid resulted in statistically significant higher expression of luciferase from the 100-bp promoter in a dose-dependent fashion but not from the 43-bp promoter, compared to the PINCO control plasmid transfection alone (p <0.01, n = 3). (B, C) Luciferase assays in 293T cells or HeLa cells using a 1-kb T-BET promoter with or without six Sp1-binding sites. Experiments shown here are representative of at least two performed with similar results. Error bars indicate standard deviations for triplicates in one experiment.

Download figure to PowerPoint

Sp1 overexpression in cell lines enhances T-BET and IFN-γ gene expression

The above reporter gene assays suggested that Sp1 was able to trans-activate T-BET gene expression. We further tested this by stably overexpressing Sp1 in 293T cells followed by an assay of endogenous T-BET expression. We infected 293T cells with PINCO-Sp1 or the empty vector retrovirus, and purified infected cells by FACS using GFP as a marker. By Western blotting, we confirmed the overexpression of Sp1 (Fig. 4A, left). By real-time RT-PCR, we demonstrated that 293T cells overexpressing Sp1 produce significantly more T-BET transcript than did those cells infected with the vector-GFP control (Fig. 4B, left). Since IFN-γ production by B cells is regulated by a T-bet-dependent mechanism 8, we next stably overexpressed Sp1 in the RPMI 8866 B cell line by utilizing the same PINCO-Sp1 vector. Similar to 293T cells, Sp1 was ectopically overexpressed in the sorted GFP+ RPMI 8866 cells (Fig. 4A, right). Again, by real-time RT-PCR, we demonstrated that RPMI 8866 cells overexpressing Sp1 expressed significantly more T-BET transcript than the cells infected with the vector-GFP control (Fig. 4B, right). These experiments supported the notion that Sp1 positively regulates T-BET gene expression in 293T cells and B lymphocytes.

thumbnail image

Figure 4. Overexpression of Sp1 in 293T, RPMI 8866, and NKL cell lines increases T-BET gene expression and, in the latter, IFN-γ secretion. (A) 293T and RPMI 8866 cells transduced with MYC-tagged Sp1 (PINCO-Sp1) were highly enriched by FACS (purity ⩾99%, data not shown). Overexpression of Sp1 in FACS-enriched cells was revealed by immunoblotting using anti-Sp1 antibody. Vector-only (PINCO) infected cell lysates are depicted for comparison. (B) Real-time RT-PCR demonstrates that overexpression of Sp1 resulted in a statistically significant induction of T-BET mRNA in both 293T and RPMI 8866 cells (p <0.05, n = 3 and p <0.01, n = 4, respectively). (C) Western blotting with α-Sp1 or α-T-BET antibodies using lysates from FACS-enriched NKL cells transduced by PINCO or PINCO-Sp1. (D) ELISA results indicate that over-expression of Sp1 leads to an increase of IFN-α-stimulated IFN-γ protein secretion by NKL cells (p <0.05, n = 3). Experiments shown in (A)–(D) are representative of at least three performed with similar results. The numbers beneath the α-Sp1 blot or the α-T-BET blot in (A) and (C) indicate quantification of Sp1 or T-BET by densitometry, normalized with β-actin. Error bars in (B) and (D) indicate standard errors for three independent experiments.

Download figure to PowerPoint

Despite the increase in T-BET mRNA, we could barely detect T-BET protein expression in either the 293T or RPMI 8866 cell lines, likely due to their much lower T-BET gene expression compared with the NK-92 and NKL NK cell lines (Supporting Information Fig. 1). To determine if Sp1 overexpression could lead to an increase of T-BET protein expression, we performed the above infection and sorting experiments in the human NKL NK cell line and confirmed Sp1 protein overexpression (Fig. 4C, top and data not shown). This time, we were able to easily detect significant T-BET transcript (not shown) and a protein (Fig. 4C, top) increase in NKL cells overexpressing Sp1, compared to the cells expressing the PINCO vector. Of note, even in untransfected NKL cells, we found that IFN-α, but not IL-12, –15 or –18, induced T-BET expression (Fig. 4C, bottom and data not shown). We next found that the increase in T-BET as the result of overexpressed Sp1 also occurred in NKL cells stimulated by IFN-α (Fig. 4C, bottom). Since T-BET positively regulates IFN-γ expression in NK cells 4, 21, we hypothesized that Sp1-induced T-BET expression would in turn raise IFN-γ gene expression. Indeed, our ELISA data showed that, following IFN-α stimulation, NKL cells overexpressing Sp1 secreted a significantly higher level of IFN-γ than NKL cells infected with the mock vector control (Fig. 4D). The increase of IFN-γ gene expression in NKL cells overexpressing Sp1 also occurred at the mRNA level (data not shown).

Mithramycin A inhibits while monokines increase Sp1 binding to T-BET promoter

Mithramycin A is an anti-cancer drug that targets G/C-rich DNA. To determine if mithramycin A inhibits the binding of Sp1 to the T-BET G/C-rich promoter region containing the Sp1-binding sites, we incubated 20 or 200 ng/mL mithramycin A with the T-BET promoter DNA prior to adding recombinant Sp1 protein or nuclear extracts from the NK-92 human NK cell line. Preincubation of the T-BET promoter DNA with 200 ng/mL mithramycin A abolished the ability of recombinant human Sp1 to form DNA-protein complexes with the T-BET promoter, whereas a lower dose of 20 ng/mL was ineffective (Fig. 5A, left). Similarly, preincubation of the T-BET promoter DNA with mithramycin A (200 ng/mL) abolished the formation of the slowest migrating complex formed with NK-92 nuclear extracts (Fig. 5A, right, lane 4). However, the addition of mithramycin A (200 ng/mL) after T-BET promoter DNA had incubated with NK-92 nuclear extract for 20 min did not abolish the formation of the slowest migrating complex (Fig. 5A, right, lane 1), suggesting that mithramycin A could not interfere with the pre-formed Sp1-T-BET promoter complex.

thumbnail image

Figure 5. The binding of Sp1 to the T-BET promoter is blocked by mithramycin A but induced by monokines. (A) EMSA shows that pre-incubation of 32P-T-BET promoter DNA with 200 ng/mL, but not 20 ng/mL, mithramycin A blocks the association of the T-BET promoter with recombinant Sp1 protein (rhSp1) (left) and NK-92 nuclear extract (NE) (right). Left panel: 32P-T-BET promoter DNA was pre-incubated with 20 (lane 1), 200 (lane 2), or 0 (lane 3) ng/mL mithramycin A for 30 min before incubating with rhSp1 (1 μg) for 20 min. Right panel: The order of addition of each component (left margin) is shown in boxes. Step 3 is highlighted in grey. In the absence of mithramycin A, 32P-T-BET promoter DNA formed complexes with NK-92 NE (lane 2). When added prior to NE, mithramycin A could partially or completely prevent formation of 32P-T-BET promoter DNA-Sp1 complexes (lanes 3 and 4), but mithramycin A was not effective when added after NE (lane1). (B) EMSA of total or nuclear extracts from resting or monokine-activated NK-92 cells cultured with or without 500 ng/mL mithramycin A (M). Solid arrows in (A) and (B): 32P-T-BET promoter DNA-Sp1 protein complexes.

Download figure to PowerPoint

We next performed EMSA with both total and nuclear extracts prepared from NK-92 cells incubated with mithramycin A and with or without IL-12 and IL-15. We found that the treatment of mithramycin A decreased the binding of Sp1 to the T-BET promoter, although the decrease is not as obvious when nuclear extracts were used (Fig. 5B, lanes 2 and 5, and 6 and 9). Incubation of NK-92 cells with IL-12 plus IL-15 increased the binding of Sp1 to the T-BET promoter (Fig. 5B, lanes 2 and 3, and 6 and 7), and this was reduced by co-treatment with mithramycin A (Fig. 5B, lanes 3 and 4, and 7 and 8). These observations corroborate with the fact that mithramycin A modifies specific G/C-rich DNA target sequences, which interferes with Sp1 protein binding 2527.

Mithramycin A inhibits T-BET and IFN-γ expression in human NK cells

We next hypothesized that if mithramycin A was inhibiting Sp1 binding to the proximal T-BET promoter, it should also inhibit T-BET gene expression and subsequent IFN-γ secretion. Before testing our hypothesis, we treated resting and monokine-activated NK-92 and primary NK cells with concentrations of mithramycin A to be used in our subsequent assays, and we demonstrated by trypan blue and MTT assays that viability and proliferation of these cells was not affected, regardless of the incubation time of 6, 12, or 24 h (Supporting Information Fig. 2 and data not shown). Further, we found that mithramycin A had no effects on Sp1 protein levels in NK-92 cells (data not shown), which is consistent with the most recently reported data for HCT 116 cells 28.

Mithramycin A inhibited T-BET protein expression in resting NK-92 cells in a dose-dependent fashion (Fig. 6A, top left). Mithramycin A also inhibited T-BET protein expression in resting and IFN-α-activated NKL cells (Fig. 6A, bottom left), the induction of T-BET by IL-12 and IL-15 or by IL-12 and IL-18 in NK-92 cells (Fig. 6A, top right), and in monokine-activated primary NK cells (Fig. 6A, bottom right). Treatment of resting primary NK cells with 200 ng/mL of mithramycin A, however, did not decrease T-BET protein expression (Fig. 6A, bottom right), whereas a higher dose 500 ng/mL of mithramycin A did (data not shown). Similar results were also found at the mRNA level as determined by real-time RT-PCR (data not shown). Mithramycin A also significantly decreased IFN-γ production in monokine-activated NK-92 cells and primary human NK cells, and did so in a dose-dependent fashion (Fig. 6B). IL-12Rβ has also been reported as a target gene of T-BET 16. In agreement with this, we showed that mithramycin A inhibited IL-12Rβ expression in both resting and monokine-activated primary NK cells (Supporting Information Fig. 3). Collectively, these results support the hypothesis that mithramycin A inhibits T-BET-regulated gene expression by interfering with the binding of Sp1 to the T-BET promoter.

thumbnail image

Figure 6. Mithramycin A inhibits T-BET and IFN-γ expression in human NK cells. (A) Western blotting shows inhibition of T-BET expression by mithramycin A. Top, left panel: Resting NK-92 cells were cultured without or with different concentrations of mithramycin A as indicated. Top, right panel: NK-92 cells were cultured with 0, 200, or 500 ng/mL mithramycin A and with or without indicated monokines. Bottom, left panel: Mithramycin A inhibited T-BET expression in resting and IFN-α-activated NKL cells. Bottom, right panel: Primary human NK cells were incubated with or without 200 ng/mL mithramycin A and with or without indicated monokines. While 200 ng/mL mithramycin A did not decrease T-BET protein expression in resting NK cells, 500 ng/mL mithramycin A did (not shown). Numbers beneath each T-BET Western blot represent quantification of T-BET protein expression by densitometry, normalized with β-actin. (B) Mithramycin A inhibits IFN-γ expression in monokine-stimulated NK-92 and primary NK cells. NK-92 cells (left and middle panels) or primary NK cells (right panel) were treated with mithramycin A or carrier in the presence of monokines as indicated. The treatment with ⩾200 ng/mL mithramycin A resulted in a significant decrease in IFN-γ production in both NK-92 and primary NK cells (p <0.05, n = 3, left, middle and right panels).

Download figure to PowerPoint

Sp1 overexpression in monokine-activated T cells enhances IFN-γ production and T-BET expression

In order to assess the significance of our findings in another relevant cell type, enriched and PHA-activated human T cells were infected with PINCO-Sp1 or PINCO (Fig. 7A, left and data not shown). After purifying infected cells by cell sorting (Fig. 7A, right), Western blotting demonstrated exclusive overexpression of the ∼105-kDa Sp1 isoform rather than the endogenous ∼95-kDa isoform in the Sp1-infected T cells, while only the endogenous Sp1 was seen in the control-infected T cells (Fig. 7B, left). Real-time RT PCR further confirmed the overexpression of Sp1 transcripts (Fig. 7B, right). The sorted Sp1-infected cells produced significantly more IFN-γ than the control-infected cells following costimulation with IL-12 and IL-18 (Fig. 7C, left, p <0.05, n = 3), which correlated with a moderate increase of T-BET expression in the Sp1-infected cells (Fig. 7C, right). Complete correlation was also found when assessing for IFN-γ transcript (Supporting Information Fig. 4). A relatively smaller degree of an increase in T-BET transcript compared to an increase in IFN-γ secretion in Sp1-transfected T cells suggests that Sp1-induced IFN-γ expression can also be through a T-BET-independent pathway.

thumbnail image

Figure 7. Sp1 over-expression in monokine-activated primary human T cells increases IFN-γ production and T-BET gene expression. (A) Highly enriched CD3+ T cells were infected with PINCO-Sp1 (left) or the empty PINCO vector (not shown). The majority of infected cells were T cells (left) and were highly enriched by FACS using GFP as a marker (right). (B) Overexpression of Sp1 was demonstrated by Western blotting (left) and real-time RT PCR (right). Numbers above and below the upper α-Sp1 row represent quantification of 105- and 95-kDa Sp1 by densitometry, respectively, normalized with β-actin. (C) IFN-γ secretion of the GFP-enriched cells costimulated by IL-12 and IL-18 was determined by ELISA (left). The T-BET gene expression in the same cells was determined by real-time RT-PCR (right). Results are representative of three donors and show that overexpression of Sp1 results in a significant increase of IFN-γ secretion and T-BET gene expression in monokine-activated T cells (p <0.05, n = 3).

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Supporting Information

T-bet has been identified as a master regulatory gene responsible for Th1 T cell differentiation and for IFN-γ production in NK cells, CD4+ and CD8+ T cells, B cells, and dendritic cells 3, 59. Given its critical role, it is not surprising that abnormal T-bet expression can be associated with diseases characterized by imbalance between Th1-Th2 or aberrant IFN-γ gene expression. In fact, T-bet itself may be a target of Leishmania major infection, lymphocytic choriomeningitis virus infection, insulin-dependent diabetes, inflammatory bowel disease, experimental allergic encephalomyelitis, and asthma 3, 1014.

The characterization of T-bet thus far has been primarily focused on its functional role in normal lymphocytes and its etiological role in disease. Work regarding the regulation of the T-bet gene itself has been limited; we know it is positively regulated by the Notch1 transcription factor and by proinflammatory cytokines such as IL-12, IL-15 and IL-18 1, 3, 4, 14, 15 and IFN-γ 17, and negatively regulated by TGF-β 14, 15, 20. Studies of the transcription factors activated by these cytokines suggest that STAT4-, STAT1- and SMAD-dependent and -independent mechanisms are likely involved in the regulation of T-bet5, 8, 1416, 1821, but definitive characterizations of these and other potential regulatory pathways have not been reported.

Sp1 was the first transcription factor identified, and it has been shown to regulate a broad and diverse spectrum of mammalian and viral genes 29. Sp1 and its other family members are adjacent to a cluster of HOX genes on chromosome 12. Sp1 recognizes GC boxes and interacts with DNA through three zinc fingers located at the C-terminal domain of the Sp1 protein. It is widely expressed in many cell or tissue types and plays critical roles in normal tissue and organ development. Evidence that abnormal expression of Sp1 is associated with tumor development, growth and metastasis is accumulating 29. Sp1 also plays an important role(s) in the immune response, as evidenced by its regulation of CD11b and the NKG2D ligand, ULBP1 30, 31.

In the current study, we found that Sp1 positively regulates T-BET gene expression via an association with the T-BET promoter. This was demonstrated by EMSA, Southwestern blotting, reporter gene assays, and by our stable ectopic overexpression of Sp1 that induced an increase of T-BET gene expression at both the mRNA and protein levels. For the first time, we found that mithramycin A, an anti-cancer drug, interferes with the binding of Sp1 to the T-BET promoter, leading to inhibition of T-BET expression and a consequent decrease in IFN-γ secretion. Since mithramycin A is approved by the U.S. Food and Drug Administration, the use of mithramycin A for the treatment of inflammatory conditions associated with T-BET and/or IFN-γ overexpression could be considered. Our EMSA data indicated that mithramycin A is more effective when added prior to Sp1-T-BET promoter complex formation, suggesting that it is likely more appropriate to consider the use of mithramycin A in remission and/or prevention stages in treating inflammatory diseases. Moreover, the potential of mithramycin A to cause hypocalcaemia would need to be considered 32.

Sp1 is abundantly expressed in a variety of human tissues and is likely involved in the transcriptional control of many genes under a multitude of circumstances. In most instances reported to date, Sp1 has been shown to be an activator of transcription, a notion also supported by data presented in this report. Since Sp1 interacts with many other proteins 29, it is reasonable to speculate that its specificity may be brought about by the recruitment of other nuclear factors onto the T-BET promoter. For example, it is well-documented that both in vivo and in vitro, SMAD proteins associate with Sp1 3336. Specifically, Sp1 physically interacts with SMAD2 and SMAD4 , and indirectly with SMAD3 through SMAD3′s association with SMAD2 and/or SMAD4 33. We previously reported that TGF-β-mediated activation of SMAD3 and SMAD4 resulted in the inhibition of proximal T-BET promoter activity, although no SMAD-binding sites were found in this promoter region 21. It is therefore possible, if not likely, that Sp1 works as an adapter molecule in this and other situations, and that the accessory molecules associating with Sp1 may very well depend on the nature of the cytokine signal received by the cell, the tissues in which it is expressed, and ultimately the balance of activators and suppressors involved in the Sp1 complex.

We demonstrate that Sp1 activates T-BET gene expression by its binding to the T-BET promoter. Others and we previously demonstrated that proinflammatory monokines such as IL-12 and IL-15 can induce T-BET expression in primary NK cells and the NK-92 cell line 4, 21. We therefore investigated the possibility that T-BET regulation by these proinflammatory cytokines is mediated through induction of Sp1. We found that the costimulation of IL-12 and IL-15 only moderately increases Sp1 gene expression in NK-92 cells (data not shown), while the costimulation substantially increases the binding of Sp1 to the T-BET promoter. Further experiments are needed to determine whether the induction of Sp1 binding to the T-BET promoter by monokines is due to the moderate increase of Sp1 expression, a structural/functional modification of Sp1, or both. In agreement with this notion and our data, IL-2, which with IL-15 utilizes the same β and γc receptor chains for signaling 37, has been reported to modulate Sp1 activity in T lymphocytes 38, 39.

It is now abundantly clear from humans and experimental animal systems that IFN-γ is critical for effective control of certain infections 40 and certain tumors 41. In addition to the data presented here that show a role for Sp1 in the regulation of T-BET, Sp1 has recently been shown to regulate the expression of the NKG2D ligand ULBP131, which can be expressed on infected or malignant cells, thereby triggering their elimination by NKG2D+ NK or T cells 31, 42. Collectively, these data suggest that Sp1 may normally play an important role in regulating effective immune surveillance against infection and/or malignant transformation 31.

Like the identification of trans-acting factors, the characterization of cis-elements is also critical for the understanding the transcriptional regulation of a gene. Prior to our report, we were unaware of any study identifying and characterizing the cis-elements for T-BET regulation in humans, as studies are primarily performed in the mouse. Our current analysis of the human T-BET promoter suggests that six Sp1-binding sites are located from –101 to –44, just upstream of the putative TATA box. We found a very high degree of conservation of the human 100-bp T-BET proximal promoter among corresponding regions of rat, mouse, chimp and cow. These data imply that similar mechanisms of transcriptional control might be in operation for T-BET expression in both human and other mammalian species.

In summary, in this report we demonstrate that Sp1 positively regulates human T-BET expression by interacting with the T-BET promoter, and that this interaction is associated with the production of IFN-γ in both NK cells and T cells. Insomuch as IFN-γ production by one or both of these cell types is important in mediating inflammation as well as resistance to the development of infection and cancer, Sp1 is likely a critical player in disease pathogenesis and disease prevention. Targeting the physical interaction between Sp1 and T-BET with mithramycin A or other analogs may open up a way to prevent or control diseases associated with excessive IFN-γ gene expression.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Supporting Information

Cell lines, cell culture and isolation of primary NK cells

The human IL-2-dependent NK cell lines, NK-92 (a generous gift of Dr. Hans G. Klingemann, Rush University Medical Center, Chicago, IL) and NKL (a generous gift of Dr. Michael Robertson, Indiana University Cancer Center, Indianapolis, IN), were maintained in culture in RPMI-1640 medium (Invitrogen, Carlsbad, CA) containing Glutamax, supplemented with 20% heat-inactivated FBS (Invitrogen), and 150 (for NK-92) or 450 (for NKL) IU/mL recombinant human IL-2 (rhIL-2, Hoffman-LaRoche, Nutley, NJ) at 37°C. The 293T cell line was cultured in DMEM (Invitrogen) containing 10% FBS. Isolation of fresh human primary NK cells from peripheral blood (American Red Cross, Columbus, OH), in accordance with The Ohio State University Institutional Review Board, has been previously described 21, 43. The amphotropic-packaging cell line Phoenix (a generous gift of Dr. G. P. Nolan, Stanford University, Stanford, CA) was maintained in culture in DMEM (Invitrogen) medium containing 10% FBS and grown for 16–18 h to 80% confluency prior to transfection by calcium phosphate-DNA precipitation methods (Promega, Madison, WI).

EMSA and antibody-supershift assays

Total protein extracts were isolated using M-PER Mammalian Protein Extraction Reagent and cytoplasmic and nuclear extracts were prepared using NE-PER Nuclear and Cytoplasmic Extraction Reagent (Pierce, Rockford, IL). A T-BET promoter region from nucleotides –101 to –44 and its complementary DNA were synthesized and annealed to form double stranded DNA. EMSA with 32P-labeled T-BET promoter DNA (∼2 × 104 cpm and 2 ng) and excess poly[dI-dC] were performed as previously described 44. For DNA-competition experiments, a 100-fold excess of unlabeled T-BET promoter DNA, or oligonucleotides containing binding sites of Sp1 (5′-GGGCGATCGGGGCGGGGCGAGC-3′, or AP1 (5′-CGCTTGATGAGTCAGCCGGAA-3′) were added to the binding mixtures before the addition of NK-92 nuclear extracts. For antibody gel supershift assays, Sp1 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) were preincubated with recombinant Sp1 protein for 30 min or total protein extracts overnight at 4°C before adding to 32P-T-BET DNA probes. To examine the effect of mithramycin A (Sigma-Aldrich, St. Louis, MO) on protein binding of Sp1 to the T-BET promoter, mithramycin A (0, 20, or 200 ng/mL) was incubated with 32P-T-BET promoter DNA in binding buffer for 30 min before the addition of either recombinant human Sp1 protein or nuclear extracts from NK-92 cells, or mithramycin A was supplemented 20 min after the addition of nuclear extracts to 32P-T-BET DNA reactions and incubated for another 20 min. EMSA were also performed using total extracts or nuclear extracts isolated from NK-92 cells treated with or without rhIL-12 (10 ng/mL) plus rhIL-15 (100 ng/mL) in the presence or absence of mithramycin A (500 ng/mL). The rhIL-12 was kindly provided by the Genetics Institute (Cambridge, MA) and rhIL-15 was kindly provided by Amgen (Thousand Oaks, CA).

Plasmid construction

The construction of the 100-bp promoter (–100 to –1), the 43-bp promoter (–43 to –1), and the 1-kb promoter (–1000 to –1) of T-BET gene was previously described 21. The 1-kb promoter with the deletion of the six Sp1-binding sites was generated by PCR using the 1-kb promoter as a template. The primers for the PCR application were: T-BET-1.0KbXho, 5′-ACTCGAGATCTCCGAGGCAGCCCTTCA-3′ and T-BET-SP1-deletion-HindIII, 5′- TAAAGCTTCTGTCACTAGAGTCGCAGCGCTTTGCTGTGGCTTTATGAAGCTTCTCGTGGCTAATACTAGGCAAATT-3′. The amplified promoter fragments were cloned into a PCR2.1 vector (Invitrogen), and the sequences were confirmed by DNA sequencing. The sequenced fragments then were excised from the PCR2.1 vector by XhoI and HindIII digestions and cloned into the corresponding restriction enzyme sites of a pGL3 luciferase basic reporter vector (Promega) to generate the 1-kb promoter reporter construct with the deletion of the six Sp1-binding sites.

Creation of the human Sp1 construct with a MYC epitope tag added to the C-terminal was accomplished via RT-PCR amplification of human peripheral blood mononuclear cell cDNA by primers: hSp1-Start-BamH1, 5′-AGGATCCATGAGCGACCAAGATCACTCCATGGA-3′ and hSp1-stopEcoR-MYC, 5′-TTGAATTCCTACAGGTCCTCCTCTGAGATCAGCTTCTGCTCGAAGCCATTGCCACTGATATT-3′. The amplified 2.3-kb fragment with a BamH1 restriction site before the start codon and an EcoR1 restriction site after the stop codon was cloned into the PCR2.1 vector (Invitrogen). Site-directed mutagenesis was applied to make a silent mutation of the BamH1 restriction site in the middle of Sp1 coding sequence. These mutated Sp1 cDNA sequences were confirmed by DNA sequencing and were subcloned into the BamHI-EcoRI sites of an EBV/retroviral hybrid PINCO vector to create PINCO-Sp1. The PINCO vector was kindly provided by Dr. Martin Sattler (Dana-Farber Cancer Institute, Harvard University).

Transient transfection and luciferase assays

The 293T cells (2.5 × 105) or HeLa cells (8 × 104) resuspended in 500 μL 10% DMEM media were each seeded into a single well of a 24-well plate and incubated overnight at 37°C. The T-BET-Luc promoter construct (1 μg) and PINCO-Sp1 expression plasmid or the empty vector PINCO (varied amount) were co-transfected into 293T cells by Lipofectamine 2000 with Plus Reagent (Invitrogen) according to the manufacturer's protocol. The pGL3 basic reporter vector was used as a control for basal promoter activity. A renilla-luciferase vector (5 ng), pRL-TK (Promega), was co-transfected to serve as an internal control for transfection efficiency. Cells were harvested after 48 h of transfection and assessed for luciferase activity by using the dual luciferase reporter assay system (Promega). Total amounts of transfected DNA were equalized using the empty vector in all assays of each experiment. All assays were done in triplicate, and all values were normalized for transfection efficiency against renilla-luciferase expression directed from the co-transfected pRL-TK plasmid. The activity of the pGL3 basic reporter vector alone was subtracted from that of the vector with a promoter, and the mean ± SD of the triplicate values of the difference is shown in the figures.

Retroviral infection of cell lines

Retroviral infections were performed following previously published methods 45. Briefly, infectious supernatants from PINCO and PINCO-Sp1 transiently transfected Phoenix cells were collected 48 h after transfection and used for three cycles of infections. The primary human T cells used for infection were highly enriched to ⩾90% CD3+, determined by flow cytometric analysis, from peripheral blood mononuclear cells cultured in phytohemagglutinin (PHA; 2 μg/mL; Sigma-Aldrich) for 1 week. The infected RPMI 8866, 293T, NKL cell lines, and primary T cells were sorted (FACS Vantage, BD Biosciences, San Jose, CA) for GFP expression with ⩾92% purity. Expression of ectopic Sp1 was confirmed in each cell line and in primary T cells by Western blotting and real-time RT-PCR.

Western blotting and Southwestern blotting

Western blotting was performed as previously described 21. Assessment of β-actin by Western was included to control for protein loading. Antibodies used were monoclonal mouse anti-human T-BET (Santa Cruz Biotechnology), polyclonal rabbit anti-human Sp1 (Santa Cruz Biotechnology), and polyclonal goat anti-human β-actin (Santa Cruz Biotechnology). Southwestern blot analysis was performed using the 32P-labeled T-BET promoter oligonucleotide and protein filters after a cycle of denaturation and renaturation as previously described 46.

Real-time RT-PCR

Total RNA from NK cells was isolated using RNeasy kit (Qiagen, Valencia, CA). cDNA was synthesized from 1–3 μg of total RNA according to the manufacturer's recommendations (Invitrogen). Real-time RT-PCR for the human Sp1 transcript was performed as a multiplex reaction with the primer/probe set specific for the Sp1 cDNA (5′-GGAGGAGGGCAGGAGTCC-3′; reverse, 5′-CAATTCTGCTGCAAGTTGCTG-3′; probe, 5′-FAM- AGCCATCCCCTTTGGCTCTGCTG-3′-TAMRA) and an internal control (18S rRNA, PE Applied Biosystems, Foster City, CA). Primers and probes for T-BET and IFNG Real-time RT-PCR were previously described 21. Conditions for real-time RT-PCR were stage 1, 50°C 2 min; stage 2, 95°C 10 min; stage 3, 95°C 15 s, 60°C 1 min with 40 cycles. Reactions were performed and data were analyzed as previously described 47. Results represent the n-fold difference of transcript levels compared to the control and are expressed as the mean ± SD of triplicate reaction wells.

NK cell stimulation and detection of IFN-γ protein by ELISA

IL-2-dependent NKL or NK-92 cells, starved without IL-2 for overnight, or freshly isolated and purified human primary NK cells were cultured in the presence or absence of varied cytokines (single or combination): rhIL-12 (10 ng/mL), rhIL-15 (100 ng/mL), rhIL-18 (100 ng/mL, R & D Systems, Minneapolis, MN), or rhIFN-α (100 U/mL, Schering Corporation, Kenilworth, NJ) with or without mithramycin A (200 ng/mL unless specified, Sigma-Aldrich) for ∼24 h. The viability of cells treated with or without mithramycin A was determined by both a trypan blue exclusion assay (Invitrogen) and the MTT method (Promega) according to the manufacturer's protocols. Cells were harvested to extract RNA for synthesizing cDNA or to process for proteins and Western blotting. Cell-free supernatants were collected after incubation at 37°C overnight for detection of IFN-γ protein by ELISA using commercially available mAb pairs (Endogen, Woburn, MA) according to the manufacturer's protocol. Results are shown as a mean of triplicate wells ± SD.

Statistics

Data were compared using Student's 2-tailed t-test. A p value less than 0.05 was considered statistically significant.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Supporting Information

The authors thank Tiffany Hughes, Il-Kyoo Park and Mette Prætorus-Ibba for useful discussion and the laboratory of Dr. Denis Guttridge for their technical assistance. This work was supported by The Analytical Flow Cytometry, Biostatistics, Real Time RT-PCR and The Nucleic Acid Shared Resources within The Ohio State University Comprehensive Cancer Center and by National Cancer Institute grants (CA95426 and CA68458 to M.A.C.). J.Y. was supported by the Up on the Roof Fellowship from The Ohio State University James Cancer Hospital.

  • 1

    WILEY-VCH

  • 2

    WILEY-VCH

  • 3

    WILEY-VCH

  • 4

    WILEY-VCH

  • 5

    WILEY-VCH

  • 6

    WILEY-VCH

  • 7

    WILEY-VCH

  • 1
    Strengell, M., Sareneva, T., Foster, D., Julkunen, I. and Matikainen, S., IL-21 up-regulates the expression of genes associated with innate immunity and Th1 response. J. Immunol. 2002. 169: 36003605.
  • 2
    Sullivan, B. M., Juedes, A., Szabo, S. J., von Herrath, M. and Glimcher, L. H., Antigen-driven effector CD8 T cell function regulated by T-bet. Proc. Natl. Acad. Sci. USA 2003. 100: 1581815823.
  • 3
    Szabo, S. J., Sullivan, B. M., Stemmann, C., Satoskar, A. R., Sleckman, B. P. and Glimcher, L. H., Distinct effects of T-bet in TH1 lineage commitment and IFN-gamma production in CD4 and CD8 T cells. Science 2002. 295: 338342.
  • 4
    Townsend, M. J., Weinmann, A. S., Matsuda, J. L., Salomon, R., Farnham, P. J., Biron, C. A., Gapin, L. and Glimcher, L. H., T-bet regulates the terminal maturation and homeostasis of NK and Valpha14i NKT cells. Immunity 2004. 20: 477494.
  • 5
    Mullen, A. C., High, F. A., Hutchins, A. S., Lee, H. W., Villarino, A. V., Livingston, D. M., Kung, A. L. et al., Role of T-bet in commitment of TH1 cells before IL-12-dependent selection. Science 2001. 292: 19071910.
  • 6
    Mullen, A. C., Hutchins, A. S., Villarino, A. V., Lee, H. W., High, F. A., Cereb, N., Yang, S. Y. et al., Cell cycle controlling the silencing and functioning of mammalian activators. Curr. Biol. 2001. 11: 16951699.
  • 7
    Szabo, S. J., Kim, S. T., Costa, G. L., Zhang, X., Fathman, C. G. and Glimcher, L. H., A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 2000. 100: 655669.
  • 8
    Harris, D. P., Goodrich, S., Gerth, A. J., Peng, S. L. and Lund, F. E., Regulation of IFN-gamma production by B effector 1 cells: essential roles for T-bet and the IFN-gamma receptor. J. Immunol. 2005. 174: 67816790.
  • 9
    Lugo-Villarino, G., Maldonado-Lopez, R., Possemato, R., Penaranda, C. and Glimcher, L. H., T-bet is required for optimal production of IFN-gamma and antigen-specific T cell activation by dendritic cells. Proc. Natl. Acad. Sci. USA 2003. 100: 77497754.
  • 10
    Bettelli, E., Sullivan, B., Szabo, S. J., Sobel, R. A., Glimcher, L. H. and Kuchroo, V. K., Loss of T-bet, but not STAT1, prevents the development of experimental autoimmune encephalomyelitis. J. Exp. Med. 2004. 200: 7987.
  • 11
    Finotto, S., Neurath, M. F., Glickman, J. N., Qin, S., Lehr, H. A., Green, F. H., Ackerman, K. et al., Development of spontaneous airway changes consistent with human asthma in mice lacking T-bet. Science 2002. 295: 336338.
  • 12
    Glimcher, L. H., Townsend, M. J., Sullivan, B. M. and Lord, G. M., Recent developments in the transcriptional regulation of cytolytic effector cells. Nat. Rev. Immunol. 2004. 4: 900911.
  • 13
    Juedes, A. E., Rodrigo, E., Togher, L., Glimcher, L. H. and von Herrath, M. G., T-bet controls autoaggressive CD8 lymphocyte responses in type 1 diabetes. J. Exp. Med. 2004. 199: 11531162.
  • 14
    Neurath, M. F., Weigmann, B., Finotto, S., Glickman, J., Nieuwenhuis, E., Iijima, H., Mizoguchi, A. et al., The transcription factor T-bet regulates mucosal T cell activation in experimental colitis and Crohn's disease. J. Exp. Med. 2002. 195: 11291143.
  • 15
    Gorelik, L., Constant, S. and Flavell, R. A., Mechanism of transforming growth factor beta-induced inhibition of T helper type 1 differentiation. J. Exp. Med. 2002. 195: 14991505.
  • 16
    Afkarian, M., Sedy, J. R., Yang, J., Jacobson, N. G., Cereb, N., Yang, S. Y., Murphy, T. L. and Murphy, K. M., T-bet is a STAT1-induced regulator of IL-12R expression in naive CD4+ T cells. Nat. Immunol. 2002. 3: 549557.
  • 17
    Lighvani, A. A., Frucht, D. M., Jankovic, D., Yamane, H., Aliberti, J., Hissong, B. D., Nguyen, B. V. et al., T-bet is rapidly induced by interferon-gamma in lymphoid and myeloid cells. Proc. Natl. Acad. Sci. USA 2001. 98: 1513715142.
  • 18
    Gavrilescu, L. C., Butcher, B. A., Del Rio, L., Taylor, G. A. and Denkers, E. Y., STAT1 is essential for antimicrobial effector function but dispensable for gamma interferon production during Toxoplasma gondii infection. Infect. Immun. 2004. 72: 12571264.
  • 19
    Maekawa, Y., Tsukumo, S., Chiba, S., Hirai, H., Hayashi, Y., Okada, H., Kishihara, K. and Yasutomo, K., Delta1-Notch3 interactions bias the functional differentiation of activated CD4+ T cells. Immunity 2003. 19: 549559.
  • 20
    Lin, J. T., Martin, S. L., Xia, L. and Gorham, J. D., TGF-beta 1 uses distinct mechanisms to inhibit IFN-gamma expression in CD4+ T cells at priming and at recall: differential involvement of Stat4 and T-bet. J. Immunol. 2005. 174: 59505958.
  • 21
    Yu, J., Wei, M., Becknell, B., Trotta, R., Liu, S., Boyd, Z., Jaung, M. S. et al., Pro- and antiinflammatory cytokine signaling: reciprocal antagonism regulates interferon-gamma production by human natural killer cells. Immunity 2006. 24: 575590.
  • 22
    Minter, L. M., Turley, D. M., Das, P., Shin, H. M., Joshi, I., Lawlor, R. G., Cho, O. H. et al., Inhibitors of gamma-secretase block in vivo and in vitro T helper type 1 polarization by preventing Notch upregulation of Tbx21. Nat. Immunol. 2005. 6: 680688.
  • 23
    Kadonaga, J. T., Carner, K. R., Masiarz, F. R. and Tjian, R., Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain. Cell 1987. 51: 10791090.
  • 24
    Li, L., He, S., Sun, J. M. and Davie, J. R., Gene regulation by Sp1 and Sp3. Biochem. Cell. Biol. 2004. 82: 460471.
  • 25
    Blume, S. W., Snyder, R. C., Ray, R., Thomas, S., Koller, C. A. and Miller, D. M., Mithramycin inhibits SP1 binding and selectively inhibits transcriptional activity of the dihydrofolate reductase gene in vitro and in vivo. J. Clin. Invest. 1991. 88: 16131621.
  • 26
    Koga, T., Suico, M. A., Nakamura, H., Taura, M., Lu, Z., Shuto, T., Okiyoneda, T. and Kai, H., Sp1-dependent regulation of myeloid Elf-1 like factor in human epithelial cells. FEBS Lett. 2005. 579: 28112816.
  • 27
    Koutsodontis, G. and Kardassis, D., Inhibition of p53-mediated transcriptional responses by mithramycin A. Oncogene 2004. 23: 91909200.
  • 28
    Esteve, P. O., Chin, H. G. and Pradhan, S., Molecular mechanisms of transactivation and doxorubicin-mediated repression of survivin gene in cancer cells. J. Biol. Chem. 2007. 282: 26152625.
  • 29
    Safe, S. and Abdelrahim, M., Sp transcription factor family and its role in cancer. Eur. J. Cancer 2005. 41: 24382448.
  • 30
    Chen, H. M., Pahl, H. L., Scheibe, R. J., Zhang, D. E. and Tenen, D. G., The Sp1 transcription factor binds the CD11b promoter specifically in myeloid cells invivo and is essential for myeloid-specific promoter activity. J. Biol. Chem. 1993. 268: 82308239.
  • 31
    Lopez-Soto, A., Quinones-Lombrana, A., Lopez-Arbesu, R., Lopez-Larrea, C. and Gonzalez, S., Transcriptional regulation of ULBP1, a human ligand of the NKG2D receptor. J. Biol. Chem. 2006. 281: 3041930430.
  • 32
    Ajlouni, K. and Theil, G. B., Mithramycin effects on calcium, phosphorus and parathyroid hormone in osseous Paget's disease. Am. J. Med. Sci. 1975. 269: 1318.
  • 33
    Feng, X. H., Lin, X. and Derynck, R., Smad2, Smad3 and Smad4 cooperate with Sp1 to induce p15(Ink4B) transcription in response to TGF-beta. EMBO J. 2000. 19: 51785193.
  • 34
    Poncelet, A. C. and Schnaper, H. W., Sp1 and Smad proteins cooperate to mediate transforming growth factor-beta 1-induced alpha 2(I) collagen expression in human glomerular mesangial cells. J. Biol. Chem. 2001. 276: 69836992.
  • 35
    Datta, P. K., Blake, M. C. and Moses, H. L., Regulation of plasminogen activator inhibitor-1 expression by transforming growth factor-beta -induced physical and functional interactions between smads and Sp1. J. Biol. Chem. 2000. 275: 4001440019.
  • 36
    Zhang, X., Yang, J., Li, Y. and Liu, Y., Both Sp1 and Smad participate in mediating TGF-β1-induced HGF receptor expression in renal epithelial cells. Am. J. Physiol. Renal Physiol. 2005. 288: F16-F26.
  • 37
    Waldmann, T., Tagaya, Y. and Bamford, R., Interleukin-2, interleukin-15, and their receptors. Int. Rev. Immunol. 1998. 16: 205226.
  • 38
    Lacroix, I., Lipcey, C., Imbert, J. and Kahn-Perles, B., Sp1 transcriptional activity is up-regulated by phosphatase 2A in dividing T lymphocytes. J. Biol. Chem. 2002. 277: 95989605.
  • 39
    Too, C. K., Induction of Sp1 activity by prolactin and interleukin-2 in Nb2 T-cells: differential association of Sp1-DNA complexes with Stats. Mol. Cell. Endocrinol. 1997. 129: 716.
  • 40
    Schroder, K., Hertzog, P. J., Ravasi, T. and Hume, D. A., Interferon-gamma: an overview of signals, mechanisms and functions. J. Leukoc. Biol. 2004. 75: 163189.
  • 41
    Dunn, G. P., Ikeda, H., Bruce, A. T., Koebel, C., Uppaluri, R., Bui, J., Chan, R. et al., Interferon-gamma and cancer immunoediting. Immunol. Res. 2005. 32: 231245.
  • 42
    Sutherland, C. L., Rabinovich, B., Chalupny, N. J., Brawand, P., Miller, R. and Cosman, D., ULBPs, human ligands of the NKG2D receptor, stimulate tumor immunity with enhancement by IL-15. Blood 2006. 108: 13131319.
  • 43
    Trotta, R., Parihar, R., Yu, J., Becknell, B., Allard, J., 2nd, Wen, J., Ding, W. et al., Differential expression of SHIP1 in CD56bright and CD56dim NK cells provides a molecular basis for distinct functional responses to monokine costimulation. Blood 2005. 105: 30113018.
  • 44
    Hong, J. W., Allen, C. E. and Wu, L. C., Inhibition of NF-kappaB by ZAS3, a zinc-finger protein that also binds to the kappaB motif. Proc. Natl. Acad. Sci. USA 2003. 100: 1230112306.
  • 45
    Becknell, B., Trotta, R., Yu, J., Ding, W., Mao, H. C., Hughes, T., Marburger, T. and Caligiuri, M. A., Efficient infection of human natural killer cells with an EBV/retroviral hybrid vector. J. Immunol. Methods 2005. 296: 115123.
  • 46
    Wu, L. C., Mak, C. H., Dear, N., Boehm, T., Foroni, L. and Rabbitts, T. H., Molecular cloning of a zinc finger protein which binds to the heptamer of the signal sequence for V(D)J recombination. Nucleic Acids Res. 1993. 21: 50675073.
  • 47
    Fehniger, T. A., Shah, M. H., Turner, M. J., VanDeusen, J. B., Whitman, S. P., Cooper, M. A., Suzuki, K. et al., Differential cytokine and chemokine gene expression by human NK cells following activation with IL-18 or IL-15 in combination with IL-12: implications for the innate immune response. J. Immunol. 1999. 162: 45114520.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Supporting Information

Supporting information for this article is available on the WWW under http://www.wiley-vch.de/contents/jc_2040/2007/37088_s.pdf or from the author.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.