SEARCH

SEARCH BY CITATION

Keywords:

  • E2-2/TCF4;
  • E-proteins;
  • Human development;
  • Plasmacytoid dendritic cell;
  • Spi-B

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Plasmacytoid dendritic cells (pDC) are central players in the innate and adaptive immune response against viral infections. The molecular mechanism that underlies pDC development from progenitor cells is only beginning to be elucidated. Previously, we reported that the Ets factor Spi-B and the inhibitors of DNA binding protein 2 (Id2) or Id3, which antagonize E-protein activity, are crucially involved in promoting or impairing pDC development, respectively. Here we show that the basic helix-loop-helix protein E2-2 is predominantly expressed in pDC, but not in their progenitor cells or conventional DC. Forced expression of E2-2 in progenitor cells stimulated pDC development. Conversely, inhibition of E2-2 expression by RNA interference impaired the generation of pDC suggesting a key role of E2-2 in development of these cells. Notably, Spi-B was unable to overcome the Id2 enforced block in pDC development and moreover Spi-B transduced pDC expressed reduced Id2 levels. This might indicate that Spi-B contributes to pDC development by promoting E2-2 activity. Consistent with notion, simultaneous overexpression of E2-2 and Spi-B in progenitor cells further stimulated pDC development. Together our results provide additional insight into the transcriptional network controlling pDC development as evidenced by the joint venture of E2-2 and Spi-B.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

The ability of dendritic cells (DC) to capture and present antigenic peptides has established a function in both the adaptive and innate branches of the immune system. Extensive characterization of DC has revealed the existence of many different DC subsets with distinct cell surface phenotype, cytokine expression profile, and anatomical localization 1. One member of the DC family is the plasmacytoid DC (pDC), which is hallmarked by their capacity to produce high levels of type I interferons and hence are also known as natural type I interferons producing cells 2.

pDC are detected in blood and most tissues, including spleen, lymph nodes, and thymus 2, 3. Previously, we described that at least two developmental pathways exist for pDC, an extrathymic and an intrathymic pathway 4. The requirements for the development of DC subsets are not fully understood. In mice it has been shown that conventional DC (cDC) and pDC can develop from minor Flt3+ subpopulations within the common myeloid and the common lymphoid progenitor pools 5–7. Recently, this pool was narrowed down to a DC committed precursor (pro-DC) that can only develop into cells of the DC lineages 8, 9. It is not clear yet at what point in DC development the commitment to a subpopulation is accomplished. Also, human pDC can be derived from both myeloid and lymphoid progenitor cells 10, 11. A better understanding of the molecular mechanisms that control pDC development may contribute to the elucidation whether one or more developmental pathways of pDC exist.

Studies with gene targeted mice have revealed several transcription factors implicated in pDC development, including STAT3, which is involved in FMS-like tryrosine kinase 3 ligand (Flt3L)-dependent DC differentiation 12, Ikaros 13, interferon regulatory factor (IRF)-4 and IRF-8 14–16, Gfi1 17, and XBP1 18. Interestingly, deficiency in some of these factors results in specific ablation of just the pDC subset, whereas others additionally affect the development of other lymphoid-tissue resident or skin DC. In addition to these transcription factors our laboratory has implicated a crucial role for the Ets transcription factor Spi-B in human pDC development 19, 20. Forced expression of Spi-B in CD34+ progenitor cells favored pDC development but impaired the development of B, T, and natural killer cells 19. More importantly, reducing expression of Spi-B by means of RNA interference (RNA-i) 20 or triggering of the Notch1 pathway 21 strongly inhibited the development of pDC both in vitro and in vivo. Furthermore, we have provided evidence for the role of E-proteins in pDC development.

E-proteins are a class of four proteins (TCF12/HEB, TCF4/E2-2, and the E2A splice-variants E12 and E47), which are members of the basic helix-loop-helix (bHLH) superfamily of transcription factors. The involvement of E-proteins in pDC development was deduced from experiments with inhibitors of DNA binding proteins (Id) 22. Like E-proteins the Id-factors also harbor a helix-loop-helix domain for protein–protein interactions but lack the basic DNA binding domain, thereby restraining E-protein activity upon complex formation 23, 24. Inhibition of E-protein activity by forced expression of Id2 or Id3 in CD34+ progenitor cells inhibited the development of pDC, but not that of cDC 22. Consistent with this, mice lacking Id2 have increased percentages of pDC 25. Together this suggests that one or more E-proteins are required for the development of pDC.

Here we identified E2-2 as a crucial factor in human pDC development. E2-2 is highly expressed in pDC, but not in their progenitor cells or in cDC. Overexpression of E2-2 stimulated the differentiation of thymic CD34+CD1a progenitor cells into pDC. Conversely, inhibition of E2-2 expression by RNA-i impaired pDC development. This identifies E2-2 as another key player in development of this cell lineage. Interestingly, Spi-B is unable to overcome the block in pDC development imposed by Id2. Furthermore, Spi-B transduced pDC express reduced levels of Id2. This together with the observation that E2-2 and Spi-B, when overexpressed, simultaneously further enhanced pDC development suggests that the concurrent action of Spi-B and E2-2 controls the development of progenitor cells into the pDC lineage.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

The bHLH factor E2-2 is highly expressed in pDC

Mice lacking expression of the Id2 have increased percentages of pDC 25. In line with this, forced expression of Id2 and Id3 in human progenitor cells specifically inhibits pDC differentiation, while leaving the development of cDC unaffected 22. Id factors are known for their ability to directly restrain the transcriptional activity of E-proteins (HEB, E2-2, and the E2A splice-variants E12 and E47) by protein–protein interaction 26. Consequently, this suggests the involvement of one or more E-proteins in pDC development. We set out to reveal the E-protein(s) involved in human pDC development.

To determine the E-proteins expressed in pDC, CD123hiCD45RA+ cells were sorted from human postnatal thymus tissue (Supporting Information Fig. 1A). CD34+CD1a thymic progenitors, known to have pDC potential 19–22, 27 and T-cell committed CD34+CD1a+28 progenitors were sorted concomitantly for comparison (Supporting Information Fig. 1B). At the mRNA level the E2A splice-variants E12 and E47 were detected in all subsets, the CD34+CD1a and CD34+CD1a+ progenitor cells and pDC (Fig. 1A). However, while E12 and E47 protein was detected in the Jurkat T-cell line, these were absent from the sorted thymocyte subsets (Fig. 1B). In line with its role in human T-cell development (R. Schotte and B. Blom, unpublished data), HEB was expressed at higher mRNA and protein levels in the CD34+CD1a+ than in the CD34+CD1a thymic progenitor population. However, HEB levels were reduced in pDC (Fig. 1A and B). In sharp contrast, E2-2 was highly expressed in pDC both at the transcriptional and protein level, while only low levels were present in CD34+CD1a or CD34+CD1a+ thymic progenitors (Fig. 1A and B).

thumbnail image

Figure 1. Ex vivo isolated and in vitro generated pDC, but not cDC, express high E2-2 levels. Freshly isolated CD34+CD1a and CD34+CD1a+ progenitor cells and CD123+CD45RA+ pDC from human postnatal thymus were analyzed for the expression of E-proteins by (A) real-time RT-PCR and (B) immunoblotting. Lysates from Jurkat cells were analyzed as positive control for E12 and E47 protein detection. Actin levels were determined as loading control. (C) E2-2 expression was determined in ex vivo (from postnatal thymocytes and peripheral blood) and in vitro generated pDC and cDC by real-time RT-PCR. The error bars represent SD of triplicate samples. All experiments shown are one representative of three.

Download figure to PowerPoint

E2-2 expression is not limited to pDC in the thymus, since also pDC isolated from peripheral blood expressed E2-2 (Fig. 1C). In CD11c+HLA-DR+ cDC either isolated from the thymus or peripheral blood E2-2 was not detectable. PDC and CD11c+HLA-DR+ cDC can also be generated in vitro from progenitor cells after culture on OP9 cells in the presence of Flt3L (21 and H. Schmidlin, unpublished observations). In line with expression in the ex vivo DC subsets from thymus and peripheral blood, we observed that the in vitro generated pDC, but not cDC, expressed E2-2 (Fig. 1C). Expression levels of the other E-proteins, E12, E47, and HEB, in cDC were even lower compared with pDC (data not shown).

In summary, E2-2, but not any of the other E-proteins, is highly expressed in pDC as compared with their progenitor cells. Notably, E2-2 expression is restricted to pDC as it is not expressed in cDC. Furthermore, E2-2 expression is independent of the pDC localization (thymus or periphery).

E2-2 is required for the development of pDC

The high expression of E2-2 in pDC relative to their progenitor cells prompted us to address whether E2-2 has a role in the development of these cells. To investigate this we generated a retroviral construct to overexpress the E2-2 cDNA together with green fluorescent protein (GFP) as a marker gene. E2-2 overexpression was confirmed by immunoblotting on a total lysate of 293T cells that were transfected with the E2-2 construct (Fig. 2A). To establish the role of E2-2 in pDC development E2-2 was forced in CD34+CD1a thymic progenitor cells by retroviral transduction. Both transduced and non-transduced CD34+CD1a postnatal thymocytes were co-cultured with the murine stromal cell line OP9 and the cytokines IL-7 and Flt3L, a condition regiment known to support the development of pDC in vitro21. After 7 days the cultures were analyzed by flow cytometry for the presence of transduced BDCA2+CD123hi pDC. The percentages of transduced cells in this representative experiment were 4 and 3%, while the total cell numbers were 1.6×106 and 2.3×106 for control and E2-2 transduced cultures, respectively. Increased E2-2 expression significantly enhanced the development of pDC from progenitors, as demonstrated in both percentages and absolute cell numbers (Fig. 2B–D), indicating that E2-2 promotes pDC differentiation.

thumbnail image

Figure 2. E2-2 stimulates pDC development in vitro. (A) E2-2 protein levels in 293T cells transfected with the LZRS E2-2 IRES GFP or empty control vector. Total cell lysates were analyzed by immunoblotting. Actin staining was used as loading control. (B–D) CD34+CD1a thymic progenitor cells were retrovirally transduced with the LZRS E2-2 IRES GFP or control LZRS IRES GFP vector. After 7 days of co-culture with OP9 cells and IL-7 plus Flt3L, the cultures were analyzed by flow cytometry using antibodies directed against the pDC markers CD123 and BDCA2. (B) Percentages of E2-2 and control transduced pDC obtained in a representative experiment are shown after electronic gating on GFP+ cells. (C) Normalized percentages of GFP+ pDC obtained after E2-2 or control transductions. The percentage of pDC in the control cultures is set to 100%. (D) Normalized absolute numbers of GFP+ pDC calculated based on the input of progenitor cells and expansion rate of GFP+ pDC. Values are normalized to control transduced pDC, which is set as 1. Averages±SD of nine experiments are shown. *p<0.01; *p<0.05.

Download figure to PowerPoint

Knockdown of E2-2 expression by RNA-i impairs pDC development

To more firmly establish the role of E2-2 in pDC development we employed an RNA-i approach to knockdown E2-2 expression. Retroviral pRETROSUPER vectors 29 were constructed to express the E2-2 or Renilla control RNA-i sequences together with the marker gene yellow fluorescent protein (YFP) driven by an independent PGK promoter. One of the three probes that we designed to target the E2-2 mRNA (E2-2-i ♯3) for degradation resulted in an almost 60% inhibition of E2-2 protein expression in the 293T cells in comparison to control Renilla RNA-i transfected 293T cells (Fig. 3A). Then, to determine whether pDC development is dependent on E2-2 expression, CD34+CD1a thymic progenitor cells were transduced with either the E2-2 RNA-i (E2-2-i)/pgk YFP or Renilla RNA-i (Renilla-i)/pgk YFP 20 knockdown constructs and cultured under pDC promoting conditions on OP9 cells with IL-7 and Flt3L 21. After 7 days of co-culture, the percentages of transduced cells in this representative experiment were 10 and 9%, while the total cell numbers were 1.6×106 and 1.2×106 for Renilla-i and E2-2-i transduced cultures, respectively. We observed a reduction in the percentage as well as in the absolute cell number of pDC when E2-2 levels were decreased by means of RNA-i (Fig. 3B–D). This, together with the enhanced development when E2-2 expression is increased, argues for an important role of E2-2 in human pDC development.

thumbnail image

Figure 3. pDC development is impaired by knocking down E2-2 expression. (A) E2-2 protein levels in 293T cells transfected with either E2-2 RNA-i probes or as control Renilla RNA-i probe as determined by immunoblot analysis. Actin was used as a loading control. Ratios (E2-2:Actin) are normalized to control Renilla-i, which is set as 1. (B–D) CD34+CD1a thymic progenitor cells were retrovirally transduced with pRETROSUPER E2-2 RNA-i/pgk YFP (E2-2-i ♯3) or pRETROSUPER Renilla RNA-i/pgk YFP (Renilla-i) vectors and co-cultured with OP9 cells plus IL-7 and Flt3L. After 7 days the cultures were analyzed by flow cytometry using antibodies directed against the pDC markers CD123 and BDCA2. (B) A representative experiment showing percentages of E2-2 RNA-i (E2-2-i ♯3) and control Renilla RNA-i (Renilla-i) transduced pDC after electronic gating on YFP+ cells. (C) Normalized percentages of YFP+ pDC obtained after E2-2-i or control Renilla-i transductions. The percentage of pDC in the control cultures is set to 100%. (D) Normalized absolute numbers of YFP+ pDC calculated based on the input of progenitor cells and expansion rate of YFP+ pDC. Values are normalized to control transduced pDC, which are set as 1. Averages±SD of six experiments are shown. **p<0.01; *p<0.05.

Download figure to PowerPoint

Spi-B cannot stimulate pDC development in absence of E2-2 activity

Forced expression of Id2 and Id3 in human progenitor cells inhibits pDC differentiation 22. Blocking pDC development by forced expression of Id2 could be relieved to control transduced levels by concomitant expression of E2-2 (Supporting Information Fig. 2), confirming the reciprocal functions of these factors in our system. Previously, we have reported that the Ets transcription factor Spi-B is crucial for the development of pDC from progenitor cells 19, 20. We aimed to determine the relative contribution of E2-2 and Spi-B in progenitor cells developing into the pDC lineage. To this end we assessed the effect of overexpressing Spi-B while concomitantly knocking down E2-2 expression in thymic progenitor cells and observed that the enhanced pDC development induced by Spi-B was diminished when also E2-2-i ♯3 was overexpressed (data not shown). This reduction was comparable to the condition where we only knocked down E2-2 expression. Since it was difficult to correctly interpret these data, due to the fact that knocking down E2-2 expression by RNA-i is incomplete, we decided to inhibit E-protein activity by expression of Id2 in conjunction with Spi-B. Progenitor cells were double transduced with Id2/GFP and Spi-B/YFP constructs and co-cultured with OP9 cells. After 1 wk of culture, the GFP+YFP+ double transduced cells were analyzed for the presence of BDCA2+CD123hi pDC (Fig. 4). As expected, when only Spi-B was overexpressed in the progenitor cells we observed an increase in both the percentage and absolute cell number of pDC (Fig. 4A–C). Conversely, Id2 overexpression significantly inhibited pDC development as compared with control transduced cells. Notably, when both Spi-B and Id2 were overexpressed simultaneously neither the percentage nor the absolute pDC numbers increased compared with the Id2 only transduced cultures (Fig. 4A–C). Taken together this indicates that Spi-B is unable to direct progenitor cells into the pDC lineage in the presence of the E-protein inhibitor Id2. The functional activity of bHLH factors, most likely E2-2, is an absolute requirement for development of pDC. This further emphasizes the importance of E2-2 in pDC development.

thumbnail image

Figure 4. Spi-B does not overcome the block in pDC development induced by Id2. CD34+CD1a thymic progenitor cells were retrovirally transduced with LZRS Id2 IRES GFP (Id2), LZRS Spi-B IRES YFP (Spi-B), empty vector LZRS IRES GFP (control), or empty vector LZRS IRES YFP (control). After 7 days of co-culture with OP9 cells in the presence of IL-7 and Flt3L, the cultures were analyzed by flow cytometry using antibodies directed against the pDC markers BDCA2 and CD123. (A) Shown are the percentages of pDC after electronic gating on double transduced GFP+YFP+ cells from a representative experiment. The percentages of double transduced cells in this experiment were as follows: 0.13% control-GFP/control-YFP, 0.24% control-GFP/Spi-B YFP, 0.65% Id2 GFP/control YFP, 0.92% Id2 GFP/Spi-B YFP. (B) Normalized percentages of GFP+YFP+ pDC in the OP9 cultures. The percentage of pDC in the control cultures is set to 100%. (C) Normalized absolute numbers of GFP+YFP+ pDC calculated based on the number of GFP+YFP+ transduced input progenitor cells and the number of GFP+YFP+ BDCA2+CD123hi pDC after 7 days of co-culture. Values are normalized to control transduced pDC, which is set as 1. Averages±SD of three experiments are shown. **p<0.01; *p<0.05. ns: not significant.

Download figure to PowerPoint

E2-2 cannot stimulate pDC development in absence of Spi-B activity

To further establish the notion that both E2-2 and Spi-B are required for pDC development, we assessed the effect of E2-2 overexpression in progenitor cells in which Spi-B levels were reduced. Previously, we have reported that pDC development is inhibited when expression of Spi-B is abrogated by RNA-i in progenitor cells 20. We employed the knockdown construct to impair Spi-B expression simultaneously with E2-2 overexpression in thymic progenitor cells and analyzed the effect on pDC development after co-culture with OP9 cells. As expected, after 1 wk we observed that E2-2 overexpression increased pDC development, while knocking down Spi-B expression reduced both the percentage and absolute pDC numbers (Fig. 5A–C). Notably, in the condition that E2-2 was overexpressed but Spi-B expression was reduced we observed that pDC development was impaired compared with E2-2 overexpression only. The reverse experiment was also performed i.e. Spi-B was overexpressed and E2-2 reduced. The percentages and absolute cell numbers, respectively, of pDC in this experiment were as follows: control/GFP+Renilla-i/YFP (24%, 2738 pDC), Spi-B/GFP+Renilla-i/YFP (56%, 3796 pDC), control/GFP+E2-2-i/YFP (15%, 1006 pDC), and Spi-B/GFP+E2-2-i/YFP (34%, 2924 pDC). Together these data suggest that E2-2 is unable to stimulate pDC development in the absence of Spi-B and confirms that both proteins are required for proper pDC differentiation.

thumbnail image

Figure 5. Reducing Spi-B levels impairs E2-2 induced pDC development. CD34+CD1a thymic progenitor cells were retrovirally transduced with Spi-B RNA-i/GFP (Spi-B-i), E2-2 IRES YFP (E2-2), and/or the appropriate control vectors, including Renilla RNA-i/GFP (Renilla-i) or empty vector IRES YFP (control). After 7 days co-culture with OP9 cells in the presence of IL-7 and Flt3L, cultures were analyzed by flow cytometry by using antibodies directed against the pDC markers BDCA2 and CD123. (A) Shown are the percentages of pDC after electronic gating on double transduced GFP+YFP+ cells from a representative experiment. The percentages of double transduced cells in this representative experiment were as follows: 1% control-GFP/control-YFP, 0.6% Spi-Bi GFP/control-YFP, 0.2% control GFP/E2-2 YFP, 0.2% Spi-Bi GFP/E2-2 YFP. (B) Normalized percentages of GFP+YFP+ pDC in the OP9 cultures. The percentage of pDC in the control cultures is set to 100%. (C) Normalized absolute numbers of GFP+YFP+ pDC calculated based on the number of GFP+YFP+ transduced input progenitor cells and the number of GFP+YFP+ BDCA2+CD123hi pDC after 7 days of co-culture. Values are normalized to control transduced pDC, which is set as 1. Averages±SD of four experiments are shown. **p<0.01; *p<0.05.

Download figure to PowerPoint

Spi-B regulates the expression of Id2

The finding that Spi-B overexpression did not overcome the Id2 enforced block in pDC development (Fig. 4) let us speculate that the regulation of Id proteins may be a mechanism of Spi-B in promoting pDC lineage development. This notion would be in line with the data presented in Fig. 5 that show requirement for adequate Spi-B protein levels in the cells to allow for E2-2-mediated pDC development. To investigate whether Spi-B may be involved in regulating the expression of Id2, pDC were generated in vitro from Spi-B transduced CD34+CD1a precursors and Id2 levels were assessed (Fig. 6). We observed that Spi-B transduced pDC expressed twofold lower levels of Id2 as compared with control transduced pDC. An effect on E2-2 expression by Spi-B was not observed (data not shown).

thumbnail image

Figure 6. Expression of Id2 is reduced when Spi-B is overexpressed. Expression levels of Id2 were assessed by real-time RT-PCR in sorted GFP+ pDC derived in vitro from CD34+CD1a progenitors transduced with Spi-B or control vectors. Values are normalized to expression in control transduced cells, which is set as 1. Averages±SD of PCR duplicates are shown. One representative experiment out of two is shown.

Download figure to PowerPoint

These data may suggest that Spi-B is involved in the regulation of Id transcription and thereby may indirectly enhance E2-2 activity and promote pDC development.

Co-expression of E2-2 and Spi-B stimulates pDC development

If Spi-B controls pDC development by downregulating the expression of Id factors and thereby releases the antagonistic effect on E2-2 activity we might expect that overexpression of both Spi-B and E2-2 will further enhance the pDC differentiation compared with cells overexpressing either one of the two transcription factors individually. To test this hypothesis CD34+CD1a progenitor cells were double transduced with constructs expressing Spi-B and E2-2 and co-cultured with OP9 cells. As shown in Fig. 7, after 1 wk of culture a significantly higher percentage and absolute number of E2-2/Spi-B double transduced cells had developed into pDC compared with control transduced or E2-2 only transduced cultures. From this we conclude that E2-2 and Spi-B act in a cooperative manner to stimulate the development of human pDC.

thumbnail image

Figure 7. Co-expression of E2-2 and Spi-B stimulates pDC development. CD34+CD1a thymic progenitor cells were retrovirally transduced with E2-2/YFP (E2-2) and/or Spi-B/GFP (Spi-B) and/or the appropriate control vectors, including empty vector IRES GFP (control) and empty vector IRES YFP (control). After 7 days co-culturing with OP9 in the presence of IL-7 and Flt3L, the cells were analyzed by flow cytometry by using antibodies directed against the pDC markers CD123 and BDCA2. (A) Shown are the percentages of pDC after electronic gating on double transduced GFP+YFP+ cells from a representative experiment. The percentages of double transduced cells were as follows: 1.8% control-GFP/control-YFP, 0.6% Spi-B GFP/control YFP, 0.4% control GFP/E2-2 YFP, 0.2% Spi-B GFP/E2-2 YFP. (B) Normalized percentages of GFP+YFP+ pDC in the OP9 cultures. The percentage of pDC in the control cultures is set to 100%. (C) Normalized absolute numbers of GFP+YFP+ pDC calculated based on the number of GFP+YFP+ transduced input progenitor cells and the number of GFP+YFP+ BDCA2+CD123hi pDC after 7 days of co-culture. Values are normalized to control transduced pDC, which is set as 1. Averages±SD of four experiments are shown. **p<0.01; *p<0.05.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

In this report we identify the E-protein E2-2 as a crucial regulator of human pDC development. By real-time RT-PCR and immunoblotting high levels of E2-2 were detected in ex vivo isolated pDC when compared with progenitor cells or cDC from human blood or thymus. Overexpression of E2-2 in CD34+CD1a progenitor cells strongly promoted pDC development in Flt3L supplemented cell cultures whereas its knockdown effectively reduced the ability of human progenitors to develop into pDC. An important result emanating from our studies is the observation that Spi-B, an Ets factor that we previously identified as the key factor required in pDC development 19, 20, is incapable of overcoming the Id2 enforced block in pDC development. This together with the finding that Id2 expression levels were reduced in Spi-B transduced pDC, may suggest that Spi-B acts to promote E2-2 activity. In line with this, we observed that E2-2 and Spi-B when co-expressed further enhanced the development of pDC.

E-proteins are essential factors in lymphocyte development and function. In particular, E-proteins are crucial for development of lymphoid progenitors to the B- and T-cell lineages 26. In the development of T cells, both E2A and HEB have been implicated 30–32. E12 and E47 are essential for B-cell development by controlling either directly or indirectly the expression of Pax-5, a factor essential for B-cell lineage fate decision and securing of the B-cell identity until the mature stages of development 33–37. In contrast, HEB is dispensable for B-cell development 38. E2-2–/– mice die around birth, precluding the analysis of loss-of-function effects at later stages of postnatal life. In conditional E2-2-deficient mice 39, E2-2 deficiency leads to a partial block in both B- and T-lymphocyte development 38, 40, 41. The development of DC subsets was not assessed in these mice. The findings described in this manuscript reveal a crucial role of E2-2 in human pDC development. Together with the observations that E-proteins are important regulators of lymphoid development suggest a close lineage relationship of pDC with the T- and B-cell lineages.

Overexpression of the dominant negative transcription factor Id2 or Id3 blocked development of pDC, but not of cDC 22. In line with this, pDC development is enhanced in Id2 deficient mice 25. Recently, a GeneChip analysis on mouse and human leukocytes showed that E2-2 is expressed at high levels in pDC, while Id2 was high in cDC 42. Here we not only confirmed prominent mRNA and protein expression of E2-2 in pDC, but, in addition, provide evidence to suggest that Id factors when overexpressed most likely antagonize E2-2 activity in progenitor cells, thereby blocking development into the pDC lineage. Of notice, we and others 42 did not detect high expression of the other E-proteins HEB, E12, or E47 in pDC. To our surprise we observed, however, that overexpression of the other E-proteins in human progenitor cells promoted in vitro pDC development to some extent (data not shown). While we cannot exclude the role of the other E-proteins in pDC development, our findings may also be attributed to the fact that high levels of HEB, E12, or E47 bind to endogenously expressed Id proteins. This then may relieve the negative regulation on E2-2, thereby indirectly promoting pDC development. A similar model was proposed for B-cell lineage commitment and expansion, where E2A is the central player and E2-2 and HEB could modulate the pool size of E2A homodimers through a competitive dimerization with Id factors 38.

Currently, the target genes that are regulated by E2-2 and account for the effect on pDC development are elusive. Transcription factors often exert their function by forming protein complexes for enhanced DNA binding. E-proteins bind to E-box DNA elements as either homodimers or heterodimers with other bHLH proteins 26. The consensus E-box sequence (CANNTG) has been identified in a number of regulatory elements of lymphoid lineage specific genes, including the T-cell receptor α and β enhancers, the CD4 silencer and enhancer, and the promoters of mb-1, λ5, and pTα, which are involved in either B- or T-cell development 26, 43–48. Furthermore, it is possible that complexes consisting of Ets factors and IRF bind to ETS–IRF composite DNA elements (EICE) 49. In addition, it has been reported that a ternary complex of PU.1, IRF-4, and E47, by binding to an E-box and EICE, transactivated expression of the CIITA gene, which was required for expression of MHC class II on B cells 50. Here we describe that E2-2 and Spi-B cooperate in pDC development. Of notice, both IRF-4 and IRF-8 are highly expressed in human pDC (42, 51, 52, and H. Schmidlin and B. Blom, unpublished results) and crucially involved in murine pDC development 14, 16. It is therefore tempting to speculate that Spi-B, in addition to contributing to the downregulation of Id2 expression, may in complex with E2-2 and IRF-4 and/or IRF-8 bind to a juxtaposed E-box and EICE to promote pDC development. In the in vitro assay that we employed here we did not observe further stimulation of pDC development when IRF-8, E2-2, and Spi-B were co-expressed compared with E2-2 and Spi-B overexpression. Also, we observed a reduction in pDC development when knocking down IRF-8 expression by RNA-i (H. Schmidlin and B. Blom, unpublished observation). This, however, does not exclude the role of IRF-8 in human pDC development as the protein may already be present at high level, whereas Spi-B and E2-2 may be the limiting factors in commitment to the pDC lineage. Alternatively, IRF-4, which is highly expressed in pDC 42, may exhibit a redundant role. This notion is supported by the fact that IRF4/IRF8 double deficient mice have even less pDCa compared with the single knockout mice 53.

In conclusion, our study provides important insight into the complex network of transcription factors that controls progenitor cell differentiation and furthers our understanding on the regulation of human pDC development.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Monoclonal antibodies

Monoclonal antibodies to CD3, CD4, CD34, CD45RA, CD56, CD123, and HLA-DR conjugated to PE, PerCP, PeCy7, APC, or APCCy7 were purchased from Becton Dickinson (BD, San Jose, CA, USA), CD1a-PE from Beckman Coulter (Fullerton, CA, USA), BDCA2-APC from Miltenyi Biotech (Bergisch Gladbach, Germany), and CD56-APC from Beckman Coulter (BC, Marseille, France).

Constructs, cell lines, and retrovirus production

The retroviral constructs, LZRS Spi-B IRES GFP 19 and LZRS Id2 IRES GFP 22 were described previously. Spi-B and Id2 were subcloned into LZRS IRES YFP by using restriction enzymes XhoI-NotI and NotI (Roche, Germany), respectively. PCR was performed to obtain human E2-2 cDNA from thymic pDC by using two primer sets (set1: 5′-GTGTCTGCGGATCTGTAGTGG-3′ and 5′-CAGGAGGCGTACAGGAAGAG-3′, set2: 5′-CTTGCGTCTGCGATTCATAAC-3′ and 5′-GCCTGGCTATGCAGGAATGT-3′). TOPO TA Cloning kit (Invitrogen, CA, USA) was used to ligate the PCR products into pCR2.1-TOPO vector. The inserts were then liberated by EcoRI and BstXI and subcloned into the EcoRI site of LZRS ires GFP. Control and Spi-B RNA-i constructs were described previously 20. The RNA-i sequence (5′-TCGCAGACGCAAGAGGTTT-3′) specifically targeting human E2-2 mRNA was designed using Ambion's siRNA Target Finder (http://www.ambion.com). Using those constructs, GALV-pseudo-typed retroviruses were produced using the Phoenix packaging cell line.

Isolation of CD34+ cells, pDC, and cDC from postnatal thymus and buffy coat

Buffy coats for isolation of pDC and cDC were obtained from Sanquin Bloodbank, Amsterdam, The Netherlands. Thymocytes were obtained from surgical specimens removed from children up to 3 years of age undergoing open heart surgery, with informed consent from patients in accordance with the Declaration of Helsinki and approved by the Medical Ethical Committee of the Academic Medical Center. Thymocytes and peripheral blood lymphocytes were isolated from a Ficoll-Hypaque density gradient (Lymphoprep; Nycomed Pharma, Oslo, Norway). Subsequently, CD34+ cells were enriched by immunomagnetic cell sorting, using a CD34 cell separation kit (Miltenyi Biotec, Bergisch Gladbach, Germany). CD34+CD1aCD56BDCA2 cells, further referred to CD34+CD1a, were sorted to purity on an FACSAria (BD), purity of the sorted cells in all experiments was>97%. Thymic and peripheral blood BDCA4+ and HLA-DR+cells were isolated by MACS cell separation. CD123+CD45RA+ pDC and CD3CD56CD19HLA-DR+CD11c+ cDC were further separated by cell sorting.

Retroviral transduction and differentiation assays

For transduction experiments CD34+CD1a postnatal thymocytes were cultured overnight with 20 ng/mL SCF (R&D Systems) and 10 ng/mL IL-7 (PeproTech), and subsequently incubated for 6 h with virus supernatant in retronectin coated plates (30 μm/mL; Takara Biomedicals, Otsu, Shiga, Japan). CD34+CD1a (1×105) progenitor cells were co-cultured with 5 × 104 OP9 cells in MEMα (Invitrogen) with 20% FBS (Hyclone), 5 ng/mL IL-7 and 5 ng/mL Flt3L (PeproTech). Differentiation assays were analyzed after 1 wk of co-culture. Flow cytometric analysis was performed on an LSRII FACS analyzer (BD). To obtain in vitro generated pDC and cDC, CD123hiBDCA2+ pDC and CD3CD56CD19 HLA-DRhiCD123+CD11c+ cDC were isolated from co-culture after 10 days by FACS sorting.

Quantitative real-time PCR

Quantitative real-time PCR was performed with an iCycler (Bio-Rad, Hercules, CA, USA), using specific primers. Actin, forward 5′-ATGGAGTTGAAGGTAGTTTCG; Actin, reverse 5′-CAAGAGATGGCCACGGCTGCTTCAGC; E12, forward 5′-ACAGCGAGAAGCCCCAGA; E12, reverse 5′-CTGCTTTGGGATTCAGGTTC; E47, forward 5′-GTCGGACAAAGCGCAGAC; E47, reverse 5′-ACAGGCTGCTTTGGGATTC; HEB, forward 5′-CCGTGGCAGTCATCCTTAGT; HEB, reverse 5′-GCCGATACGGCAGAAACTT; E2-2, forward 5′- ATGGGAGAGAATCAAACTTA; E2-2, reverse 5′-CCTCCATGGCACTACTGTGA; Id2, forward 5′- CGGATATCAGCATCCTGTCC; Id2, reverse 5′- CTGAATAAGCGGTGTTCATGA. Expression levels relative to actin expression were calculated.

Immunoblotting

E-protein expression in human thymocytes was assessed by immunoblot analysis using mouse monoclonal E2-2 antibody (ab32873, Abcam, CA, USA), rabbit polyclonal HEB antibody (sc-357, Santa Cruz Biotechnology, CA, USA), and mouse monoclonal E2A antibody (sc-416, Santa Cruz Biotechnology, CA, USA), respectively.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

The authors thank Berend Hooibrink for cell sorting and maintaining the FACS facility. The staff of Dr. M. Hazekamp of the Leiden University Medical Hospital and Academic Medical Center are thanked for providing postnatal thymus tissue. R. Siamari for technical support. This work was supported by a ZonMW VIDI fellowship (♯917-66-310) to B. B. and a NIH-R01 grant (♯2301 G EP089) to B. B. and Dr. C. Uittenbogaart, UCLA, Los Angeles, CA, USA.

Conflict of interest: The authors declare no financial or commercial conflict of interest.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information
  • 1
    Shortman, K. and Naik, S. H., Steady-state and inflammatory dendritic-cell development. Nat. Rev. Immunol. 2007. 7: 1930.
  • 2
    Siegal, F. P., Kadowaki, N., Shodell, M., Fitzgerald-Bocarsly, P. A., Shah, K., Ho, S., Antonenko, S. et al., The nature of the principal type 1 interferon-producing cells in human blood. Science 1999. 284: 18351837.
  • 3
    Cella, M., Jarrossay, D., Facchetti, F., Alebardi, O., Nakajima, H., Lanzavecchia, A. and Colonna, M., Plasmacytoid monocytes migrate to inflamed lymph nodes and produce large amounts of type I interferon. Nat. Med. 1999. 5: 919923.
  • 4
    Weijer, K., Uittenbogaart, C. H., Voordouw, A., Couwenberg, F., Seppen, J., Blom, B., Vyth-Dreese, F. A. et al., Intrathymic and extrathymic development of human plasmacytoid dendritic cell precursors in vivo. Blood 2002. 99: 27522759.
  • 5
    D'Amico, A. and Wu, L., The early progenitors of mouse dendritic cells and plasmacytoid predendritic cells are within the bone marrow hemopoietic precursors expressing Flt3. J. Exp. Med. 2003. 198: 293303.
  • 6
    Karsunky, H., Merad, M., Cozzio, A., Weissman, I. L. and Manz, M. G., Flt3 ligand regulates dendritic cell development from Flt3+ lymphoid and myeloid-committed progenitors to Flt3+ dendritic cells in vivo. J. Exp. Med. 2003. 198: 305313.
  • 7
    Karsunky, H., Merad, M., Mende, I., Manz, M. G., Engleman, E. G. and Weissman, I. L., Developmental origin of interferon-alpha-producing dendritic cells from hematopoietic precursors. Exp. Hematol. 2005. 33: 173181.
  • 8
    Naik, S. H., Sathe, P., Park, H. Y., Metcalf, D., Proietto, A. I., Dakic, A., Carotta, S. et al., Development of plasmacytoid and conventional dendritic cell subtypes from single precursor cells derived in vitro and in vivo. Nat. Immunol. 2007. 8: 12171226.
  • 9
    Onai, N., Obata-Onai, A., Schmid, M. A., Ohteki, T., Jarrossay, D. and Manz, M. G., Identification of clonogenic common Flt3+M-CSFR+ plasmacytoid and conventional dendritic cell progenitors in mouse bone marrow. Nat. Immunol. 2007. 8: 12071216.
  • 10
    Chicha, L., Jarrossay, D. and Manz, M. G., Clonal type I interferon-producing and dendritic cell precursors are contained in both human lymphoid and myeloid progenitor populations. J. Exp. Med. 2004. 200: 15191524.
  • 11
    Ishikawa, F., Niiro, H., Iino, T., Yoshida, S., Saito, N., Onohara, S., Miyamoto, T. et al., The developmental program of human dendritic cells is operated independently of conventional myeloid and lymphoid pathways. Blood 2007. 110: 35913660.
  • 12
    Laouar, Y., Welte, T., Fu, X. Y. and Flavell, R. A., STAT3 is required for Flt3L-dependent dendritic cell differentiation. Immunity. 2003. 19: 903912.
  • 13
    Allman, D., Dalod, M., Asselin-Paturel, C., Delale, T., Robbins, S. H., Trinchieri, G., Biron, C. A. et al., Ikaros is required for plasmacytoid dendritic cell differentiation. Blood 2006. 108: 40254034.
  • 14
    Schiavoni, G., Mattei, F., Sestili, P., Borghi, P., Venditti, M., Morse III, H. C., Belardelli, F. et al., ICSBP is essential for the development of mouse type I interferon-producing cells and for the generation and activation of CD8alpha(+) dendritic cells. J. Exp. Med. 2002. 196: 14151425.
  • 15
    Suzuki, S., Honma, K., Matsuyama, T., Suzuki, K., Toriyama, K., Akitoyo, I., Yamamoto, K. et al., Critical roles of interferon regulatory factor 4 in CD11bhighCD8alpha-dendritic cell development. Proc. Natl. Acad. Sci. USA 2004. 101: 89818986.
  • 16
    Tsujimura, H., Tamura, T. and Ozato, K., Cutting edge: IFN consensus sequence binding protein/IFN regulatory factor 8 drives the development of type I IFN-producing plasmacytoid dendritic cells. J. Immunol. 2003. 170: 11311135.
  • 17
    Rathinam, C., Geffers, R., Yucel, R., Buer, J., Welte, K., Moroy, T.and Klein, C., The transcriptional repressor Gfi1 controls STAT3-dependent dendritic cell development and function. Immunity 2005. 22: 717728.
  • 18
    Iwakoshi, N. N., Pypaert, M. and Glimcher, L. H., The transcription factor XBP-1 is essential for the development and survival of dendritic cells. J. Exp. Med. 2007. 204: 22672275.
  • 19
    Schotte, R., Rissoan, M. C., Bendriss-Vermare, N., Bridon, J. M., Duhen, T., Weijer, K., Briere, F. et al., The transcription factor Spi-B is expressed in plasmacytoid DC precursors and inhibits T-, B-, and NK-cell development. Blood 2003. 101: 10151023.
  • 20
    Schotte, R., Nagasawa, M., Weijer, K., Spits, H. and Blom, B., The ETS transcription factor Spi-B is required for human plasmacytoid dendritic cell development. J. Exp. Med. 2004. 200: 15031509.
  • 21
    Dontje, W., Schotte, R., Cupedo, T., Nagasawa, M., Scheeren, F., Gimeno, R., Spits, H. et al., Delta-like1-induced Notch1 signaling regulates the human plasmacytoid dendritic cell versus T-cell lineage decision through control of GATA-3 and Spi-B. Blood 2006. 107: 24462452.
  • 22
    Spits, H., Couwenberg, F., Bakker, A. Q., Weijer, K. and Uittenbogaart, C. H., Id2 and Id3 inhibit development of CD34(+) stem cells into predendritic cell (pre-DC)2 but not into pre-DC1. Evidence for a lymphoid origin of pre-DC2. J. Exp. Med. 2000. 192: 17751784.
  • 23
    Benezra, R., Davis, R. L., Lockshon, D., Turner, D. L. and Weintraub, H., The protein Id: a negative regulator of helix-loop-helix DNA binding proteins. Cell 1990. 61: 4959.
  • 24
    Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y. and Honjo, T., Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 2000. 102: 553563.
  • 25
    Hacker, C., Kirsch, R. D., Ju, X. S., Hieronymus, T., Gust, T. C., Kuhl, C., Jorgas, T. et al., Transcriptional profiling identifies Id2 function in dendritic cell development. Nat. Immunol. 2003. 4: 380386.
  • 26
    Murre, C., Helix-loop-helix proteins and lymphocyte development. Nat. Immunol. 2005. 6: 10791086.
  • 27
    Schmidlin, H., Dontje, W., Groot, F., Ligthart, S. J., Colantonio, A. D., Oud, M. E., Schilder-Tol, E. J. et al., Stimulated plasmacytoid dendritic cells impair human T-cell development. Blood 2006. 108: 37923800.
  • 28
    Blom, B., Verschuren, M. C., Heemskerk, M. H., Bakker, A. Q., Gastel-Mol, E. J., Wolvers-Tettero, I. L., van Dongen, J. J. et al., TCR gene rearrangements and expression of the pre-T cell receptor complex during human T-cell differentiation. Blood 1999. 93: 30333043.
  • 29
    Brummelkamp, T. R., Bernards, R. and Agami, R., A system for stable expression of short interfering RNAs in mammalian cells. Science 2002. 296: 550553.
  • 30
    Bain, G., Gruenwald, S. and Murre, C., E2A and E2-2 are subunits of B-cell-specific E2-box DNA-binding proteins. Mol. Cell Biol. 1993. 13: 35223529.
  • 31
    Barndt, R., Dai, M. F. and Zhuang, Y., A novel role for HEB downstream or parallel to the pre-TCR signaling pathway during alpha beta thymopoiesis. J. Immunol. 1999. 163: 33313343.
  • 32
    Barndt, R. J., Dai, M. and Zhuang, Y., Functions of E2A-HEB heterodimers in T-cell development revealed by a dominant negative mutation of HEB. Mol. Cell Biol. 2000. 20: 66776685.
  • 33
    Bain, G., Maandag, E. C., Izon, D. J., Amsen, D., Kruisbeek, A. M., Weintraub, B. C., Krop, I. et al., E2A proteins are required for proper B cell development and initiation of immunoglobulin gene rearrangements. Cell 1994. 79: 885892.
  • 34
    Cobaleda, C., Jochum, W. and Busslinger, M., Conversion of mature B cells into T cells by dedifferentiation to uncommitted progenitors. Nature 2007. 449: 473477.
  • 35
    Nutt, S. L., Heavey, B., Rolink, A. G. and Busslinger, M., Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature 1999. 401: 556562.
  • 36
    Rolink, A. G., Nutt, S. L., Melchers, F. and Busslinger, M., Long-term in vivo reconstitution of T-cell development by Pax5-deficient B-cell progenitors. Nature 1999. 401: 603606.
  • 37
    Zhuang, Y., Soriano, P. and Weintraub, H., The helix-loop-helix gene E2A is required for B cell formation. Cell 1994. 79: 875884.
  • 38
    Zhuang, Y., Cheng, P. and Weintraub, H., B-lymphocyte development is regulated by the combined dosage of three basic helix-loop-helix genes, E2A, E2-2, and HEB. Mol. Cell Biol. 1996. 16: 28982905.
  • 39
    Bergqvist, I., Eriksson, M., Saarikettu, J., Eriksson, B., Corneliussen, B., Grundstrom, T. and Holmberg, D., The basic helix-loop-helix transcription factor E2-2 is involved in T lymphocyte development. Eur. J. Immunol. 2000. 30: 28572863.
  • 40
    Wikstrom, I., Forssell, J., Goncalves, M., Colucci, F. and Holmberg, D., E2-2 regulates the expansion of pro-B cells and follicular versus marginal zone decisions. J. Immunol. 2006. 177: 67236729.
  • 41
    Wikstrom, I., Forssell, J., Penha-Goncalves, M. N., Bergqvist, I. and Holmberg, D., A role for E2-2 at the DN3 stage of early thymopoiesis. Mol. Immunol. 2008. 45: 33023311.
  • 42
    Robbins, S. H., Walzer, T., Dembele, D., Thibault, C., Defays, A., Bessou, G., Xu, H. et al., Novel insights into the relationships between dendritic cell subsets in human and mouse revealed by genome-wide expression profiling. Genome Biol. 2008. 9: R17.
  • 43
    Ernst, P. and Smale, S. T., Combinatorial regulation of transcription. I: general aspects of transcriptional control. Immunity 1995. 2: 311319.
  • 44
    Ho, I. C., Yang, L. H., Morle, G. and Leiden, J. M., A T-cell-specific transcriptional enhancer element 3′ of C alpha in the human T-cell receptor alpha locus. Proc. Natl. Acad. Sci. USA 1989. 86: 67146718.
  • 45
    Kee, B. L., Quong, M. W. and Murre, C., E2A proteins: essential regulators at multiple stages of B-cell development. Immunol. Rev. 2000. 175: 138149.
  • 46
    Reizis, B. and Leder, P., Expression of the mouse pre-T cell receptor alpha gene is controlled by an upstream region containing a transcriptional enhancer. J. Exp. Med. 1999. 189: 16691678.
  • 47
    Sawada, S. and Littman, D. R., A heterodimer of HEB and an E12-related protein interacts with the CD4 enhancer and regulates its activity in T-cell lines. Mol. Cell Biol. 1993. 13: 56205628.
  • 48
    Staudt, L. M. and Lenardo, M. J., Immunoglobulin gene transcription. Annu. Rev. Immunol. 1991. 9: 373398.
  • 49
    Eisenbeis, C. F., Singh, H. and Storb, U., Pip, a novel IRF family member, is a lymphoid-specific, PU. 1-dependent transcriptional activator. Genes Dev. 1995. 9: 13771387.
  • 50
    van der, S. N., Quinten, E., Marcondes, R. M. and van den Elsen, P. J., E47, IRF-4, and PU. 1 synergize to induce B-cell-specific activation of the class II transactivator promoter III (CIITA-PIII). Blood 2004. 104: 28492857.
  • 51
    Ito, T., Kanzler, H., Duramad, O., Cao, W. and Liu, Y. J., Specialization, kinetics, and repertoire of type 1 interferon responses by human plasmacytoid predendritic cells. Blood 2006. 107: 24232431.
  • 52
    Izaguirre, A., Barnes, B. J., Amrute, S., Yeow, W. S., Megjugorac, N., Dai, J., Feng, D. et al., Comparative analysis of IRF and IFN-alpha expression in human plasmacytoid and monocyte-derived dendritic cells. J. Leukoc. Biol. 2003. 74: 11251138.
  • 53
    Tamura, T., Tailor, P., Yamaoka, K., Kong, H. J., Tsujimura, H., O'Shea, J. J., Singh, H. et al., IFN regulatory factor-4 and -8 govern dendritic cell subset development and their functional diversity. J. Immunol. 2005. 174: 25732581.

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. References
  9. Supporting Information

Supporting information for this article is available on the WWW under http://www.wiley-vch.de/contents/jc_2040/2008/200838470_s.pdf or from the author.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.