IL-17 neutralization significantly ameliorates hepatic granulomatous inflammation and liver damage in Schistosoma japonicum infected mice

Authors

  • Yuxia Zhang,

    1. Department of Immunology, Anhui Medical University, P.R. China
    2. Department of Pathophysiology, Anhui Medical University, P.R. China
    Search for more papers by this author
  • Liuxi Chen,

    1. Department of Microbiology and Parasitology, Anhui Medical University, P.R. China
    2. Anhui Provincial Laboratory of Microbiology & Parasitology, Anhui Medical University, P.R. China
    Search for more papers by this author
  • Wenda Gao,

    1. Antagen Institute for Biomedical Research, Boston, MA, USA
    Search for more papers by this author
  • Xin Hou,

    1. Department of Microbiology and Parasitology, Anhui Medical University, P.R. China
    2. Anhui Provincial Laboratory of Microbiology & Parasitology, Anhui Medical University, P.R. China
    Search for more papers by this author
  • Yuqing Gu,

    1. Department of Microbiology and Parasitology, Anhui Medical University, P.R. China
    2. Anhui Provincial Laboratory of Microbiology & Parasitology, Anhui Medical University, P.R. China
    Search for more papers by this author
  • Li Gui,

    1. Integrated laboratory of Anhui Medical University, P.R. China
    Search for more papers by this author
  • Dake Huang,

    1. Department of Microbiology and Parasitology, Anhui Medical University, P.R. China
    2. Integrated laboratory of Anhui Medical University, P.R. China
    Search for more papers by this author
  • Miao Liu,

    1. Department of Microbiology and Parasitology, Anhui Medical University, P.R. China
    2. Anhui Provincial Laboratory of Microbiology & Parasitology, Anhui Medical University, P.R. China
    Search for more papers by this author
  • Cuiping Ren,

    1. Department of Microbiology and Parasitology, Anhui Medical University, P.R. China
    2. Anhui Provincial Laboratory of Microbiology & Parasitology, Anhui Medical University, P.R. China
    Search for more papers by this author
  • Siying Wang,

    1. Department of Immunology, Anhui Medical University, P.R. China
    2. Department of Pathophysiology, Anhui Medical University, P.R. China
    Search for more papers by this author
  • Jijia Shen

    Corresponding author
    1. Department of Microbiology and Parasitology, Anhui Medical University, P.R. China
    2. Anhui Provincial Laboratory of Microbiology & Parasitology, Anhui Medical University, P.R. China
    • Department of Immunology, Anhui Medical University, P.R. China
    Search for more papers by this author

Correspondence: Prof. Jijia Shen, Department of Microbiology and Parasitology, Anhui Medical University, 81 Meishan Road, Hefei 230032, P.R. China

Fax: +86-551-5161126

e-mail:shenjijia@hotmail.com

Siying Wang, Department of Pathophysiology, Anhui Medical University, 81 Meishan Road, Hefei 230032, P.R. China

Fax: +86-551-5167706

e-mail:sywang@ahmu.edu.cn

Abstract

IL-17 is a signature cytokine of Th17 cells implicated in the induction and progression of chronic inflammatory diseases. Several studies in C57BL/6 mice, immunized with soluble schistosome egg Ags (SEA) in complete Freund's adjuvant (CFA), and subsequently infected with Schistosoma mansoni (S. mansoni) have shown that severe hepatic granulomatous inflammation is correlated with high levels of IL-17. Here, using a Schistosoma japonicum (S. japonicum) larvae infection model in C57BL/6 mice, we analyzed the dynamic expression of IL-17 in infected livers by RT-qPCR and ELISA. Our results showed that IL-17 expression was elevated during the course of infection. The temporal expression of IL-17 and cytokines/chemokines involved in the induction and effector function of Th17 cells was paralleled with hepatic granulomatous inflammation. Treatment of S. japonicum infected mice with IL-17-neutralizing mAb resulted in significant downmodulation of granulomatous inflammation and hepatocyte necrosis. The protection was associated with lower expression of proinflammatory cytokines/chemokines, such as IL-6, IL-1β, CXCL1, and CXCL2 and a reduced number of infiltrating neutrophils. Anti-IL-17 mAb significantly ameliorated hepatic granulomatous inflammation, partly through the downregulation of proinflammatory cytokines/chemokines and recruitment of neutrophils. Our data indicate a pathogenic role of Th17/IL-17 in hepatic immunopathology in S. japonicum infected mice.

Introduction

Schistosomiasis isa serious global helminth-induced disease, which affects more than 200 million people worldwide [[1]]. There are three major species that infect humans: Schistosoma japonicum (S. japonicum), Schistosoma mansoni, and Schistosoma haematobium. The common pathological changes, including those in schistosomiasis japonica [[2]], are granulomatous and fibrotic inflammation against parasite eggs deposited in the liver and intestines. Schistosoma japonicum is mainly distributed in Southeast Asia, is a major public health concern in China. About one million people, more than 1.7 million cattle and other mammals are currently infected [[3]]. It has long been recognized that granuloma formation is a CD4+ T-cell-dependent, cell-mediated process. After infection, immune responses to schistosoma antigens demonstrate a marked switch from a moderate proinflammatory Th1 response to a vigorous Th2-dominated response with the beginning of oviposition around 4 weeks postinfection (p.i.) [[4]]. Multiple studies on the pathogenesis of granuloma formation have investigated the cytokine patterns mediated by antigen-specific T cells in mice with schistosomiasis japonica. In particular, the roles of the so-called Th1 and Th2 cytokines have been elucidated.

The requirement for CD4+ T cells in granulomatous inflammation was verified in MHC class II-deficient mice, which demonstrated compromised granuloma formation [[5-7]]. Recent studies have discovered a new subset of CD4+ T cells, namely Th17 cells, characterized by the production of IL-17A, IL-17F, IL-6, TNF-α, and IL-21 [[8]]. IL-17A, also commonly called IL-17, is the signature cytokine of Th17 subset [[9]]. Increasing evidence shows that this cytokine plays an active role in cell-mediated autoimmune diseases [[10]]. IL-17 targets various cell types and induce additional cytokines (such as TNF-α, IL-1, IL-6, G-CSF, GM-CSF), and chemokines (including CXCL1, CXCL2, IL-8, CCL2, and CCL7) that are associated with inflammation [[11]]. The proinflammatory effects of IL-17 have been well documented in autoimmune diseases, including Crohn's disease [[12]], multiple sclerosis [[13-16]], and rheumatoid arthritis [[17, 18]].

Researchers found that both the Th1 cytokine IFN-γ and the Th2 cytokine IL-4 inhibit Th17 differentiation [[8, 19, 20]]. Thus, given the elevated levels of IFN-γ and IL-4 at different times during infection with S. japonicum, IL-17 production is likely under tight regulation. This could be the reason that the involvement of the Th17 subset during schistosoma infection was only recently uncovered [[21, 22]]. Rutitzky et al. immunized C57BL/6 mice, which show low pathology, with schistosome egg Ags (SEA) in complete Freund's adjuvant (CFA) following S. mansoni infection [[22]]. After challenge, the mice displayed a dramatic increase in hepatic granuloma size and exacerbation of inflammation, leading to early death [[22]]. Analysis of granuloma and mesenteric lymphocytes from the SEA/CFA-immunized mice revealed that larger granulomas, extensive pathology and accelerated mortality correlated with elevated IL-17 levels [[22]].

Although the pathogenic mechanisms of S. japonicum infection are generally considered to be similar to those of S. mansoni, there are marked variations in pathological intensity of the lesions in the same mouse strain. The eggs of S. japonicum usually produce more severe lesions than those of S. mansoni, partly because they are often deposited in large groups, and partly because each fertilized egg seems to exert a more acute toxic effect on the surrounding tissue [[23, 24]]. In the experimental C57BL/6 murine model of schistosomiasis, S. japonicum infected mice naturally develop vigorous hepatic granulomatous inflammation, whereas in S. mansoni infected mice the lesions are significantly smaller [[25-27]]. Thus, C57BL/6 mice infected with S. japonicum represent a more natural model in that the hosts develop a pronounced granulomatous reaction even without SEA immunization. Nonetheless, a possible function for Th17/IL-17 during schistosomiasis japonica has not been addressed. It is also unclear whether IL-17 has proinflammatory effects during the acute phase of hepatic granuloma response.

Here we demonstrated that IL-17 expression in the liver of C57BL/6 mice correlated with the severity of granuloma inflammation, with the highest levels being detected at the peak of inflammation during the natural course of S. japonicum infection. Infiltrating CD4+ T cells within granulomas were identified as the producers of IL-17. Administration of anti-IL-17 mAb profoundly inhibited hepatic granulomatous inflammation and hepatocyte necrosis. Our findings indicate that IL-17 may be another potential pathogenic cytokine in promoting egg-induced granulomatous inflammation.

Results

Enhanced expression of IL-17 paralleled with the development of granulomatous inflammation

To determine whether IL-17 is involved in the egg-induced granulomatous response, we initially investigated its expression in the liver of S. japonicum infected C57BL/6 mice. IL-17 mRNA was undetectable until 4 weeks p.i., peaked at 6 weeks p.i., maintained at relatively high levels from 8 to 10 weeks p.i., and subsequently declined and returned to baseline at 12 weeks p.i. (Fig. 1A). To confirm the expression of IL-17 mRNA, we also measured IL-17 protein in the liver homogenates by ELISA from the same mouse groups. Consistent with the mRNA levels, IL-17 protein levels in infected mice were significantly higher from 6 to 8 weeks p.i., compared with those in normal mice (Fig. 1B).

Figure 1.

IL-17 mRNA and protein expression in the liver after infection. (A) Intrahepatic IL-17 mRNA expression was measured by real-time PCR. Liver tissues were collected, and relative IL-17 expression was assessed in infected and uninfected (0 weeks after infection) mice following normalization against β-actin. Data are shown as mean ± SEM of six mice per time point. (B) IL-17 levels in the liver homogenates were determined by ELISA. The same liver samples used in quantitative PCR in (A) were used to make the homogenates at the indicated time points. The data are shown as mean ± SEM. *p < 0.05 versus 4 wk p.i., ANOVA.

We noted that prominent IL-17 production in the liver began at 4 weeks p.i., at the time of onset of egg deposition in the host after S. japonicum infection. The coincidence of IL-17 production and vigorous granuloma development (Fig. 2) during the infection may suggest a possible correlation between the two phenomena. Egg deposition may be a major triggering factor responsible for the increased IL-17 production.

Figure 2.

Liver granulomatous pathology of C57BL/6 mice during infection with S. japonicum. Mice were infected with 20 ± 2 cercariae and sacrificed at the indicated times after infection. Formalin-fixed liver sections were stained with H&E. Original magnification: 2–4 weeks ×200, 6–12 weeks ×100. Data representative of two separate experiments with 18 mice each are shown.

IL-17 production by CD4+T cells in granulomtous cells isolated from 6-week-infected mice

IL-17 predominantly expressed by Th17 has been suggested during acute S. mansoni infection and chronic inflammation of the central nervous system [[22, 28]]. Large numbers of CD4+ T cells infiltrate into granuloma in our system (Fig. 3A), so we first determine whether Th17 cells are potential source for IL-17A during S. japonicum infection. We isolated hepatic granuloma cells from infected mice at 6 weeks p.i., and cultured them in the presence of SEA for 48 h. After being stimulated with PMA and ionomycin for the last 4 h, the granuloma cells were stained for CD3, CD4, and intracellular IL-17A. IL-17 can be consistently detected from CD3+CD4+ T cells (Fig. 3B). A small percentage of CD3+CD4 T cells were also found to express IL-17 (Fig. 3C). Then we further investigated the markers of IL-17-producing CD3 cells. However, we could not detect IL-17 production in NK1.1+ or CD19+ cells (Fig. 3D), although NK cells have been reported to produce IL-17 in Toxoplasma gondii infected C57BL/6 mice [[10]].

Figure 3.

Identification of CD4+T cells as IL-17-producing cells in the granulomas of S. japonicum infected mice. Cells from liver granulomas were isolated 6 weeks after infection, and were cultured for 48 h as described in Materials and methods. Representative flow cytometry plots show (A) CD4+ cells infiltrated in hepatic granulomas (R1) and (B) IL-17 expression in the CD3+CD4+ population, (C) IL-17 expression in CD3+CD4 cells and (D) IL-17 expression in CD3 cells. (E) RORγt expression in CD3+CD4+ (middle) and IL-17 production in RORγt+ (top right) but not in RORγtT cells (bottom right) are shown. All plots show events from the lympholeukocyte gate. Numbers in quadrants or boxed areas represent the frequency of cells in each, and shown are the results from one of three independent experiments.

To confirm Th17 is induced, RORγt, a key transcriptional factor for Th17, was stained in the hepatic granuloma cells. We found that IL-17 expression was limited to CD3+CD4+RORγt+ T cells (Fig. 3E). These results indicate that Th17 cells are the major IL-17-producing cells in the hepatic granuloma.

Increased expression of cytokines/chemokines associated with the production of IL-17 in the liver

Factors that promote Th17 cell differentiation and/or expansion are transforming growth factor β (TGF-β), IL-6, and IL-23. IL-1β has also been identified as a critical factor in Th17 cell development [[29-31]]. In S. mansoni infected murine model, IL-23 and IL-1β play central roles in inducing Th17 cells and severe immunopathology [[32-35]]. We therefore investigated the hepatic mRNA levels of IL-6, TGF-β, IL-23p19, and IL-1β in S. japonicum infected C57BL/6 mice. Transcripts for IL-6 (Fig. 4A) and TGF-β (Fig. 4B) were elevated, respectively, from weeks 2 and 4, peaked at weeks 4–6 and week 8 p.i. IL-23p19 (Fig. 4C) and IL-1β (Fig. 4D) expression also increased from weeks 4 to 6, then declined to lower levels at weeks 8–10, and further returned to baseline by week 12 p.i.

Figure 4.

Real-time PCR detection of proinflammatory cytokines and chemokines associated with Th17/IL-17 in the livers from S. japonicum infected mice. Cytokine mRNA expression of (A) IL-6, (B) TGF-β, (C) IL-23P19, (D) IL-1β, (E) TNF-α and chemokine mRNA expression of (F) CXCL1, (G) CXCL2, and (H) MCP-1 in the livers was measured by real-time PCR. Data for all the transcripts were normalized to β-actin. Data are shown as mean ± SEM of six mice and are representative of two experiments. *p < 0.05 compared with expression at 4 weeks p.i. by ANOVA.

Prior studies confirmed that IL-17 amplifies inflammatory responses by eliciting various proinflammatory cytokines and chemokines, including TNF-α, IL-6, and CXC chemokine [[30, 36-42]]. Therefore, we measured the mRNA of inflammatory factors downstream of IL-17 signaling pathway: TNF-α, CXCL1, CXCL2, MCP-1, and G-CSF. Transcripts for TNF-α (Fig. 4E) were elevated from week 4, peaked at week 6 in the livers. The messages for CXCL1/KC (Fig. 4F), CXCL2/MIP2 (Fig. 4G), and MCP-1 (Fig. 4H), chemokines that mediate neutrophil and macrophage migration, were also upregulated from week 4, and were strongly expressed during weeks 6–8 p.i. CXCL2 remained at high levels at week 10, and was still detectable 12 weeks after infection. We could not detect increased expression of G-CSF during the course of S. japonicum infection (data not shown). These results showed that the increased expression of TGF-β, IL-6, IL-23, IL-1β, TNF-α, and chemokines paralleled with the production of IL-17 in the liver during the infection course. This may suggest that IL-17 could facilitate granulomatous inflammation.

IL-17 neutralization ameliorated granulomatous inflammation and lessened liver damage

To directly ascertain the role of IL-17 in the development of egg-induced granuloma, we treated mice with IL-17-neutralizing mAb at the onset of granuloma formation. Because IL-17 production increased from 4 weeks p.i., infected C57BL/6 mice were systemically administrated with anti-IL-17 or an isotype-matched control mAb, starting on day 24 and continued on every 4 days for a total of five injections. Mice were sacrificed on day 42 p.i. Anti-IL-17 mAb, but not the control mAb, significantly improved the liver gross appearance. The livers from the S. japonicum infected, control mAb treated mice were full of large white patches, which represented the coalescence of granulomas into larger less-discrete inflammatory areas (Fig. 5A). This appearance was macroscopically similar to the livers of untreated mice that had been infected for the same length of time (data not shown). After anti-IL-17 treatment, however, discrete granulomas of the livers were discernable (Fig. 5B). Granulomatous lesions formed in anti-IL-17 mAb-treated mice were characterized by less-inflammatory cell infiltration and attenuated hepatic coagulative necrosis (Fig. 5C–F). Morphometric analysis showed that the average granuloma size in mice treated with IL-17 neutralizing antibody reduced by nearly 30%, compared with that in the control mice (40.70 ± 34.20 × 103 vs. 64.28 ± 38.65×103 μm2; Fig. 5G). Accordingly, anti-IL-17 mAb-treated mice displayed attenuated liver injury, as indicated by considerably decreased levels of serum alanine transaminase (ALT) and aspartate transaminase (AST; Fig. 5H).

Figure 5.

Anti-IL-17 treatment ameliorated hepatic granulomatous inflammation and the degree of liver injury in S. japonicum infected mice. Mice were infected and administered anti-IL-17 mAb or a control IgG, as described in Materials and methods. All the samples were collected from 6-week-infected mice. (A and B) Representative gross appearance and (C–F) histopathology of the livers of mice treated with anti-IL-17 mAb or control IgG are shown. Original magnification (C and D) ×100; (E and F) ×200. Bar = 100 μm. (G) Hepatic egg granuloma size was measured by computer-assisted morphometric analysis. Data are shown as the mean ± SEM of four to six mice per group from one experiment representative of three. (H) Serum ALT/AST levels of mice treated with neutralizing anti-IL-17 mAb or control IgG. *p < 0.05, **p < 0.01, and ***p < 0.001, unpaired two-tailed Student's t-test .

To determine whether the above differences in inflammatory response were due to dissimilar antigen stimulation, we measured egg burdens in the individual livers. No relevant differences could be obtained between the two groups. Insignificant differences were also observed and analyzed in organ weights and parasite burdens, and data were summarized in Table 1.

Table 1. Parasite burden, egg burden, and organ weight from mice treated with anti-IL-17 or a control IgG
 Control IgG-treated S. japonicum infected miceAnti-IL-17-treated S. japonicum infected mice
Worms/mouse12 ± 2.8213 ± 1.41
Eggs/liver (×104)11.08 ± 3.219.5 ± 0.86
Liver weight (% body weight)8.87 ± 0.958.55 ± 1.12
Spleen weight (% body weight)1.72 ± 0.251.71 ± 0.34

IL-17 neutralization reduced recruitment of neutrophils and production of inflammatory mediator

To explore the cellular mechanisms underlying the significant effects of anti-IL-17 on egg-induced granulomatous inflammation, we analyzed the main cell populations within the granuloma lesions, including lymphocytes, macrophages, eosinophils, and neutrophils. Flow cytometry was conducted on granuloma cells from mice treated with either anti-IL-17 mAb or a control IgG. Our data did not reveal obvious differences in the percentages of CD19+ (B cells), CD4+, CD8+, and F4/80+ cells (macrophages; data not shown), but the accumulation of Ly6G+ neutrophils in the granulomas from anti-IL-17-treated mice was significantly impaired (Fig. 6A and B). We also counted the numbers of eosinophils in the granuloma hematoxylin and eosin (H&E) staining sections from the two groups of mice, and found no significant difference (data not shown). These data suggested that the decreased granuloma size in anti-IL-17-treated mice is mainly due to reduced neutrophils infiltration.

Figure 6.

IL-17 neutralization diminished neutrophil infiltration and reduced proinflammatory cytokine and chemokine in granulomatous livers. Infected mice were treated with neutralizing anti-IL-17 mAb or an isotype control mAb, as described in Materials and methods. Liver granuloma cells and liver sections were all from 6-week-infected mice. (A) Liver granulomatous cells were stained with and anti-Ly6G mAb; values represent the percentage of Ly6G+ cells within the granulocyte gate. (B) The absolute numbers of neutrophils in granulomas of each mouse were calculated and shown as the mean + SEM of four to six mice per group from one experiment representative of three. (C–G) Cytokine mRNA expression of IL-6, IL-1β, IL-23p19, TNF-α, IL-10 and (H–J) chemokine mRNA expression of CXCL1, CXCL2, and MCP-1 in the livers were measured by real-time PCR. Data for all the transcripts were normalized to β-actin. (K–N) Granuloma cell production of IL-6, TNF-α, CXCL1, and CXCL2 following stimulation with 50 μg/mL of SEA for 48 h was measured by ELISA. (C–N) All data are shown as the mean + SEM of four to six mice per group. *p < 0.05 compared with control IgG-treated mice, unpaired two-tailed Student's t-test.

To address the molecular mechanisms of anti-IL-17 in improving hepatic immunopathology, we measured cytokines expression involved in the induction and effector function of Th17 under the condition of IL-17 being neutralized. Cytokines IL-6 and IL-1β (Fig. 6C and D), necessary for Th17 cells development were significantly lower in anti-IL-17-treated mice, whereas no difference was found in IL-23p19 (Fig. 6E), although it was critical for Th17 generation in murine S. mansoni. Additionally, the expression of CXCL1 (Gro-α, KC; Fig. 6H) and CXCL2 (Gro-β, MIP-2; Fig. 6I) chemokines, important in neutrophil recruiting and activation, was markedly inhibited after IL-17 blockade. However, anti-IL-17 had no effect on the levels of TNF-α (Fig. 6F) or monocyte chemotactic protein-1 (MCP-1; Fig. 6J). These data correlated very well with less-neutrophil infiltration into the granulomas after anti-IL-17 treatment (Fig. 6A and B). We also noticed that there was a trend of higher IL-10 (Fig. 6G) production in most anti-IL-17-treated mice, but these changes did not reach statistical significance (p = 0.2).

To determine if reduced cytokine/chemokine expression in the total liver samples reflected the changes in the local microenvironment of granuloma foci, we isolated granuloma cells from the livers of the same groups, and stimulated them in the presence of SEA. As expected, granuloma cells from anti-IL-17-treated mice generated significantly lower amounts of IL-6 (Fig. 6K), as well as CXCL1 (Fig. 6M) and CXCL2 (Fig. 6N), except for TNF-α (Fig. 6L). Because the limited number of granuloma cells can be isolated from the liver of single mouse, we restricted the ELISA measurements to TNF-α, IL-6, CXCL1, CXCL2, IL-4, and IFN-γ. These data indicated that anti-IL-17 treatment significantly suppressed egg-induced granulomatous inflammation.

Neutralization of IL-17 also downregulated IFN-γ and IL-4 in egg-induced hepatic granulomas

Schistosoma egg granuloma formation is mediated by CD4+ T cells. The natural undisturbed 6-week S. japonicum infection in C57BL/6 mouse is characterized by high concentrations of Th2 cytokines and low levels of Th1 cytokines [[43]]. To ascertain whether the cytokine environment was altered after neutralization of IL-17 in vivo, IFN-γ and IL-4 produced by SEA-stimulated cells from hepatic granulomas, mesenteric lymph nodes (MLN) and spleens were determined. Granuloma cells from anti-IL-17-treated mice secreted significantly lower amounts of IFN-γ (Fig. 7A) and IL-4 (Fig. 7B) compared with cells from the mice treated with the isotype control IgG (p = 0.0019, 0.0262, respectively). The same changes of cytokine production by SEA-stimulated MLN (Fig. 7C and D) and spleen (Fig. 7E and F) cells were also found, but the differences were not statistically significant (p = 0.1053, 0.5474 for IFN-γ; p = 0.1324, 0.0795 for IL-4, respectively). No IFN-γ or IL-4 was detected in the supernatants from SEA-stimulated mesenteric nodes cells and spleen cells from normal uninfected mice (data not shown). The results of the two group of infected mice were unexpected, because previous studies using IL-17−/− mice (C57BL/6 background) have shown that there was a marked increase in IFN-γ production by both MLN cells and granuloma cells during S. mansoni infection [[44]]. Consistent with the ELISA data, flow cytometric analysis of liver granuloma cells demonstrated that anti-IL-17-treated mice had less IFN-γ and IL-4-producing cells (Fig. 7G). However, the treatment did not affect the Th1 or Th2 differentiation, as indicated by comparable mRNA levels of transcription factors T-bet and GATA3 in the livers (Fig. 7H). These data suggested that both Th1 and Th2 responses were attenuated after administration of anti-IL-17 in the hepatic granuloma lesions.

Figure 7.

Reduced expression of IFN-γ and IL-4 in granuloma cells from anti-IL-17-treated mice. Liver granuloma, MLN, and spleen cells were isolated 6 weeks after infection from individual anti-IL-17 or control IgG-treated mice and cultured for 48 h as described in Materials and methods. (A, C, and E) IFN-γ and (B, D, and F) IL-4 levels in the supernatants were measured by ELISA and expressed as mean + SEM for each group (n = 4–6). Data are representative of three experiments. **p < 0.01, *p < 0.05, unpaired two-tailed Student's t-test. (G) The frequency of IFN-γ- or IL-4-producing cells from liver granuloma cells was determined by intracellular staining and flow cytometry. Freshly isolated granuloma cells were incubated in the presence of PMA, ionomycin, and BFA for 4 h, and then stained for the expression of IFN-γ and IL-4. Data are from one experiment representative of three with four to six samples per group. Values are the percentage of cells in the lymphoid gate. (H) mRNA expression of the transcription factors T-bet and GATA3 in the livers was measured by real-time RT-PCR. Data for the two transcripts were normalized to β-actin. RNA was isolated from the livers of 6-week-infected mice. Data represent mean + SEM of four to six mice per group and are representative of three experiments.

Discussion

The granulomatous inflammatory response to schistosome eggs is considered to be CD4+ T-cell-mediated. To understand the complex series of events that occur during the granulomatous inflammatory response, we studied cytokines produced by CD4+ T cells affecting the granuloma formation. In addition to Th1, Th2, and regulatory T cells, Th17 cells are a recently recognized subset of CD4+ T effector cells that have now been broadly linked to disease pathogenesis in multiple inflammatory and infectious conditions including schistosomiasis [[12, 13, 17, 22, 26, 32, 33, 44-47]]. The aim of this study was to investigate the potential role of IL-17, the main effector cytokine of Th17, in egg-induced granulomatous inflammation during the natural S. japonicum infection in C57BL/6 mice. Here, we first demonstrated the dynamic expression of IL-17 during the course of hepatic granulomatous inflammation. IL-17-producing CD4+ T cells were identified in the granuloma lesions. IL-17 neutralization significantly mitigated S. japonicum egg-induced hepatic immunopathology and hepatocyte necrosis, which was accompanied by reduced release of inflammatory mediators and impaired neutrophil infiltration.

Cohorts of mice were examined biweekly after infection for a total of 12 weeks to determine IL-17 expression in the livers during granuloma response. IL-17 was upregulated shortly after the onset of egg deposition in S. japonicum infected mice. In addition, high levels of IL-17 in the liver paralleled with the progress of acute granulomatous inflammation (6–8 weeks p.i.). In the chronic stage of granuloma response, the expression of IL-17 and IL-17-associated cytokines and chemokines became less prominent. Our results showed that IL-17 was associated with acute granuloma response.

We demonstrated that Th17 cells were present in egg-induced hepatic granulomas and were main cellular source of IL-17. A small portion of CD3+CD4 cells were found to produce IL-17 as well, which may be γδ T and/or CD8+ T cells, because it has been reported that IL-17 is produced by γδ T cells [[19, 48-51]] and CD8+ T cells [[52]] in other experimental systems. Interestingly, we found IL-17 production by CD3 cells (data not shown), but among these cells neither the NK1.1+ nor CD19+ cells were detected to produce IL-17. Thus granulomas contain several cell types that produce IL-17, other cell sources are worthy of further investigation.

To confirm the direct involvement of IL-17 in the development of granulomatous inflammation, we administered IL-17-specific neutralizing antibody into S. japonicum infected mice. This treatment resulted in markedly downregulated inflammation and mitigated hepatocyte damage. These effects were not observed in mice treated with an isotype-matched control IgG, indicating that the decreased granulomatous inflammation was associated with specific neutralization of IL-17. FACS analysis demonstrated that anti-IL-17 mAb reduced neutrophil infiltration. Prior studies have reported that blocking neutrophils by anti-Gr-1 mAb (RB6-8C5) significantly suppressed the development of acute hepatotoxicity in egg-implanted mice [[53]]. Their results are in concert with our findings that infected mice had markedly decreased levels of ALT/AST after anti-IL-17 treatment. Although it has long been recognized that neutrophils were recruited into granuloma lesions, the molecular mechanism was not clarified. Here we demonstrated that IL-17 is critical for the mobilization of neutrophils after host exposure to the egg.

Consistent with many other reports for a proinflammatory effect of Th17, we found that proinflammatory cytokines and chemokines involved in the induction and effector function of Th17 were also increased in the livers during S. japonicum infection. When endogenous IL-17 was neutralized, histological analyses revealed significantly reduced granulomatous inflammation, accompanied by decreased expression of neutrophil chemoattractants, such as CXCL1 and CXCL2, and proinflammatory cytokines, such as IL-6 and IL-1β, in the liver tissues. Consequently, anti-IL-17-treated mice showed impaired recruitment of neutrophils to the granulomas. We also found that administration of anti-IL-17 altered neither monocyte nor eosinophil content within the granulomas. Thus, similar to other systems [[54, 55]], enhancement of neutrophil recruitment is an important element in IL-17-mediated granuloma inflammation. A previous study using SEA/CFA-immunized, S. mansoni infected IL-17−/− and IFN-γ/IL-17−/− mice have shown that expression of IL-23p19 and IL-1β in MLNs was lower compared with that of WT mice [[44]]. Our data indicated anti-IL-17 decreased IL-1β markedly, however, had no effect on IL-23p19 in the granulomatous livers. The contradiction in results may stem from different animal models.

Several reports have shown that IL-17 may contribute to the recruiting IFN-γ-producing cells via chemokines [[56, 57]], cell surviving [[58]], or inducing IL-12 and IFN-γ by macrophages [[59]]. Also, it has been reported that IL-17A positively regulated Th2-mediated inflammation [[60]]. From our data, granuloma cells from anti-IL-17-treated mice released less IFN-γ and IL-4. Flow cytometric analysis of liver granuloma cells confirmed that anti-IL-17-treated mice had less IFN-γ and IL-4-producing cells, including both the CD4+ T and CD4 T cells. Analyses of the mRNA expression of T-bet and GATA3 suggested that anti-IL-17 had no effect on Th1 and Th2 differentiation. Therefore, in our model it is possible that anti-IL-17 downregulated the expression of IFN-γ and IL-4 via the similar mechanisms mentioned above.

We postulate that downregulation of egg-induced immunopathology in schistosomiasis by neutralization of IL-17 includes at least the following two basic mechanisms. The first is to block the induction of proinflammatory cytokines and chemokines, such as IL-6, IL-1β, TNF-α, CXCL1, and CXCL2, with a concomitant decrease in neutrophil recruitment. The second mechanism is the inhibition of Th1 and Th2 response, possibly by reducing recruitment cytokine-producing cells.

Taken together, our data demonstrate that Th17 cells are another important player contributing to egg-induced granulomatous inflammation. The contributions by each individual Th subsets to the development and/or progression of granuloma, as well as the complex reciprocal regulation between Th subsets, warrant further study. Although Th17 cells are a minor fraction of infiltrating CD4+ T cells within the granuloma, IL-17 might be a crucial player in the cytokine network regulating egg-induced immunopathology in S. japonicum infected C57BL/6 mice. In addition to inducing proinflammatory cytokines/chemokines and recruiting neutrophils, IL-17 may contribute to egg-induced granulomatous inflammation via an IFN-γ and/or IL-4-dependent mechanism, just as in autoimmune diabetes [[61]] and acute kidney injury (ischemia-reperfusion injury) [[62]]. Although the development of hepatic granuloma was only partially suppressed in anti-IL-17-treated mice, targeting IL-17 may represent a powerful new approach to curtail egg-induced immunopathology. Dissecting the mechanisms as how Th17 facilitates granuloma response and its inter-relationship with Th1 and Th2 cells will shed light on the immunopathology involved in schistosomiasis and may lead to novel treatments for patients with this disease.

Materials and methods

Infection of mice and SEA preparation

Six- to eight-week-old female C57BL/6 mice (Experimental Animal Center, Chinese Science Academy, Shanghai, China) were used in all the experiments. Schistosoma japonicum (Chinese mainland strain) infected Oncomelania hupensis snails were provided by Jiangxi Institute of Parasitic Diseases. After anesthetized by intraperitoneal injection of ketamine, mice were infected with 20 ± 2 freshly shed cercaria percutaneously. Some C57BL/6 mice were administrated by tail vein injection with 50 μg of anti-mouse IL-17 neutralizing mAb or an isotype-matched rat IgG2a mAb, at 24, 28, 32, 36, and 40 days after infection. Mice were sacrificed 48 h after the last antibody injection. All mice were housed under specific pathogen-free barrier conditions in Anhui Medical University animal facility. The protocols for all animal experiments were approved by the Institutional Animal Care and Use Committee at Anhui Medical University. Eggs were obtained from the livers of 40 cercaria-infected mice at 8 weeks of infection. SEA was prepared from homogenized eggs as previously described as previously described [[26]] and the protein concentration was determined by BCA Protein Assay Kit (Pierce, Thermo Scientific, USA).

Antibodies

Anti-mouse IL-17 neutralizing mAb (Clone 50104) and control rat IgG2a mAb were obtained from R&D Systems. The following monoclonal antibodies used for flow cytometry were purchased from BD Pharmingen (San Diego, CA, USA): PE-Cy5-conjugated anti-CD3e (17A2), FITC-conjugated anti-CD4 (GK1.5), PE-conjugated anti-IL-17 (TC11-18H10), PE-conjugated rat IgG2a isotype control (R3-34), FITC-conjugated anti-Ly6G (1A8), purified anti-CD16/CD32 (2.4G2).

Liver histology and immunohistochemistry

Liver samples from 6-week S. japonicum infected mice were fixed in 4% buffered formalin and processed through the routine paraffin embedding procedures. Sections (4 μm) were stained with H&E, and examined for quantitative and qualitative changes. In the evaluation of hepatic granuloma size, only those containing clearly identifiable central ovum were selected. The width and length of the lesion were measured by computer-assisted morphometric analysis software to calculate the granuloma area. For each specimen, at least 15 lesions were measured and the mean values obtained from four to six mice were used for statistical analysis.

Real-time quantitative RT-PCR

Total RNA from individual liver of schistosoma-infected mice as well as uninfected mice was extracted using the Trizol Reagent (Invitrogen, Carlsbad, CA, USA). For each sample, 2 μg of total cellular RNA was reverse-transcribed to cDNA with random primers and MMLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA) in a total reaction volume of 20 μL. Real-time quantitative RT-PCR on 2 μL of cDNA from each sample was performed in duplicates by SYBR Premix Ex Taq (Takara, Dalian, China) according to the manufacturer's instructions. All reactions were performed using an ABI-Prism 7500 Sequence Detector Systems (Applied Biosystems). The primers used in this experiment are listed in Table 2. Relative expression of the genes was calculated by using the comparative cycle threshold (Ct) method as previously described [[63]]. For analysis, the “housekeeping” gene encoding β-actin was used as a normalization control. The mean Ct value for the target gene compared with that of β-actin was referred to as ΔCt. The relative quantity of target mRNA was expressed as 2−ΔΔCt, in which ΔΔCt equals ΔCt of the experimental sample minus ΔCt of the control sample. Values are shown as mean ± SEM from three independent experiments. Dissociation curves were used to verify the specificity of the PCR products.

Table 2. Sequences of primers used in this study
GenesForwardReverse
IL-17ACCGCAATGAAGACCCTGATCAGGATCTCTTGCTGGATGAGA
IL-23CCAGCAGCTCTCTCGGAATCGATTCATATGTCCCGCTGGTG
IL-6ACACATGTTCTCTGGGAAATCGTAAGTGCATCATCGTTGTTCATACA
IFN-γGGATATCTGGAGCTGGCAATGATGGCCTGATTGTCTTTCAA
IL-4CTCATGGAGCTGCAGAGACTCTTCATTCATGGTGCAGCTTATCGA
IL-10TGAAGACCCTCAGGATGCGGAGAGCTCTG TCTAGG TCCTGG
TNF-αACTGGCAGAAGAGGCACTCCTG GCACCACTAGTTGGTTG
CXCL1GGCTGGGATTCACCTCAAAACCAAGGGAGCTTCAGG
CXCL2ACCAACCACCAGGCTACATCAGGGTCAAGGCAAACT
MCP-1TTAAAAACCTGGATCGGAACCAAGCATTAGCTTCAGATTTACGGGT
IL-1βCTGAACTCAACTGTGAAATGCTGATGTGCTGCTGCGAGA
T-betAGCCAGCCAAACAGAGAAGACTCAAATGTGCACCCTTCAAACCCTTCC
GATA3TCTCCAAGTGTGCGAAGAGTT CCTAGATCTGTCGCTTTCGGGCTTCAT
β-ActinAGAGGGAAATCGTGCGTGACCAATAGTGATGACCTGGCCGT

Cell preparations

Livers were removed aseptically from 6-week-old infected mice. Granuloma cells were isolated from individual liver as described by S. Ragheb and D. L. Boros with some modifications [[63, 64]]. Briefly, livers were homogenized in RPMI 1640 medium in a Waring blender at low speed for 20 s. The intact granulomas were collected after 1g sedimentation and extensive washing. Then the granulomas were digested in 10% FCS-supplemented Hank's buffer containing 0.2% type-IV collagenase (Sigma) for 30 min in a shaking water bath (210 rpm) at 37°C. The softened granulomas were disrupted further by repeated suction and expulsion through a 10 mL syringe. The cell suspensions were passed through a 200 mesh gauze and washed in RPMI 1640 medium. Single-cell suspensions from individual MLNs and spleens were prepared by pressing through 200 mesh metal sieve in RPMI 1640 medium. Following erythrocytes lysis with Tris-NH4Cl for 10 min on ice, the isolated granuloma cells, MLN cells, and spleen cells were extensively washed. Viable cells were counted by Trypan blue exclusion.

ELISA for cytokine and chemokine determination

Cells (5×106/well) from hepatic granulomas, MLNs, and spleens were cultured in 24-well plate with 1 mL complete medium in the presence of 50 μg/mL of SEA at 37°C in a humidified CO2 incubator. After 48-h incubation, culture supernatants were collected, centrifuged (2000g for 5 min), aliquoted, and stored at −80°C until analysis. The cytokine or chemokine levels in the supernatants were assessed by commercial ELISA kits (R&D Systems). For culture supernatants of hepatic granuloma cells, IL-6, TNF-α, IFN-γ, IL-4, CXCL1/KC, CXCL2/MIP2 were measured. For supernatants of MLNs and spleen cells, cytokines IFN-γ and IL-4 were detected.

For determining hepatic IL-17 levels, liver samples were obtained and processed as previously described [[63]]. Briefly, liver tissues were homogenized in lysis buffer containing Triton X-100, and a protease inhibitor cocktail (Complete Mini; Roche, Switzerland). The homogenates were centrifuged at 3000g and 4°C for 15 min. The concentrations of total protein in the supernatants were measured by BCA Protein Assay Kit. IL-17 concentration in the supernatants was determined by ELISA kit also obtained from R&D Systems. For every time point, four to six samples were measured, each in duplicate.

Determination of ALT/AST levels

Serum levels of the liver-associated ALT and AST were measured as indicators of hepatocellular damage. The concentrations of the enzymes were determined using a commercial kit (Rong Sheng, Shanghai, China) according to the manufacturer's instructions.

Flow cytometric analysis

To analyze the dominant cell population within granuloma lesions, freshly isolated granuloma cells were washed twice in staining buffer (BD Pharmingen) and preincubated with 10 μg/mL blocking antibodies (rat anti-mouse CD16/32, clone 2.4G2) for 15 min at 4°C. Then the cells were stained with antibodies for specific markers in a 50 μL volume for 30 min at 4°C.

To detect IL-17 production in CD4+ T cells from granuloma lesions, the isolated granuloma cells were incubated in the complete medium in the presence of SEA (50 μg/mL) for 48 h, with addition of 25 ng/mL phorbol 12-myristate 13-acetate (PMA, Sigma-Aldrich, St. Louis, MO, USA), 1 μg/mL ionomycin (Sigma-Aldrich), 1 μg/mL GolgiPlug (BD Pharmingen) for the last 4 h incubation. The cells were first stained for surface antigens CD3 and CD4 as described above. After being fixed and permeabilized with 200 μL Cytofix/Cytoperm (BD Pharmingen) for 20 min at 4°C, the granuloma cells were washed with 500 μL Perm/Wash solution (BD Biosciences) twice and were stained for cytoplasmic IL-17A with PE-anti-IL-17A (TC11-18H10). After washing twice, the samples were resuspended in 200 μL of 3% paraformaldehyde (pH 7.3). Data were acquired on a FACScalibur (Becton Dickinson, Franklin Lakes, NJ, USA) and analyzed with the WinMDI2.9 software. Granulocytes were gated based on forward and side light scatter.

Statistics

Data are shown as mean ± SEM (standard error of the mean) and statistical differences were determined using the unpaired two-tailed Student's t-test or analysis of variance (ANOVA). p value <0.05 was considered to be statistically significant.

Acknowledgments

This work was supported by the Natural Science Foundation of China (No. 30972569) and the Natural Science Foundation of Anhui Province (No. 090413109).

Conflict of interest

The authors declare no financial or commercial conflict of interest.

Abbreviations
ALT

alanine transaminase

AST

aspartate transaminase

Ct

cycle threshold

SEA

soluble schistosome egg Ags

Ancillary