SEARCH

SEARCH BY CITATION

Keywords:

  • Erk1/2;
  • Interleukin-6;
  • MicroRNA-24–3p;
  • Plasma cells;
  • Survival

Abstract

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

Plasma cells can survive for long periods and continuously secrete protective antibodies, but plasma cell production of autoantibodies or transformation to tumor cells is detrimental. Plasma cell survival depends on exogenous factors from the surrounding microenvironment, and largely unknown intracellular mediators that regulate cell homeostasis. Here we investigated the contribution of the microRNA 24–3p (miR-24–3p) to the survival of human plasma cells under the influence of IL-6 and SDF-1α (stromal cell derived factor 1), both of which are bone marrow survival niche mediators. Deep sequencing revealed a strong expression of miR-24–3p in primary B cells, plasma blasts, plasma cells, and in plasmacytoma cells. In vitro studies using primary cells and the plasmacytoma cell line RPMI-8226 revealed that (i) expression of miR-24–3p mediates plasma cell survival, (ii) miR-24–3p is upregulated by IL-6 and SDF-1α, (iii) IL-6 mediates cell survival under ER stress conditions via miR-24–3p expression, and (iv) IL-6-induced miR-24–3p expression depends on the activity of the MAP kinase Erk1/2. These results suggest a direct connection between an external survival signal and an intracellular microRNA in regulating plasma cell survival. miR-24–3p could therefore be a promising target for new therapeutic strategies for autoimmune and allergic diseases and for multiple myeloma.


Introduction

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

Plasma cells are key players in the immune system. They repre-sent the terminal stage of B-cell differentiation due to antigen-driven activation. The nonproliferating and refractory plasma cells develop from the intermediate stage of proliferating and migrating plasma blasts [1]. As part of the humoral immune system, plasma cells provide long-term protection against pathogens. However, when PCs secrete antibodies that are directed against auto-antigens or allergens, or when they transform to tumor cells, plasma cells can be highly pathogenic. The plasma cell population is divided in short-lived and long-lived cells [2]. Short-lived plasma cells secrete antibodies for days or weeks, whereas long-lived plasma cells can survive for years [3]. Long-term survival of plasma cells is a complex process that depends both on external signals, which in sum are referred to as the “survival niche”, as well as on the molecular competence to respond to these signals [4]. The bone marrow is the major site for long-term antibody production, but secondary lymphoid organs, the gut, and inflamed tissues could also provide survival niches [5, 6]. Reticular bone marrow stromal cells, basophil and eosinophil granulocytes, and others secrete IL-6, APRIL, and SDF-1α (stromal cell derived factor 1) that are able to mediate survival in vitro and in vivo [7, 8] Other external factors involved in mediating plasma cell survival are BAFF (B-cell activating factor), TNF, IL-4, IL-5, and IL-10 [9]. Current research focuses on the intracellular pathway(s) that mediate survival signaling in plasma cells. Functional studies in mice revealed the impact of the transcription factors Blimp1 (B lymphocyte-induced maturation protein-1), Bcl6 (B-cell lymphoma 6 protein), IRF-4 (interferon regulatory factor 4), and XBP1 (X-box binding protein 1) for plasma cell differentiation and survival [10-13]. Although several factors contributing to the bone marrow survival niche were also identified in humans, little is known about the intracellular mechanisms that mediate the exogenous survival signals in human plasma cells.

Posttranscriptional regulation by microRNAs (miRNAs) is an important factor in the regulation of various cellular processes including survival processes [14]. Within the B-cell lineage, the miR-17∼92 cluster plays an important role in B-cell and plasma cell development and maintenance [15] and miR-155 is required for class switch recombination and germinal center formation [16]. In order to clarify intracellular survival mechanisms of plasma cells, we analyzed the function of the miR-24–3p in human plasma cell survival. miR-24–3p is highly conserved throughout vertebrates and plays a crucial role in erythroid-cell differentiation [17], DNA repair [18], and cell-cycle regulation [19]. In this study, we identified miR-24–3p as a direct mediator of human plasma cell survival with strong expression in primary bone marrow plasma cells from healthy donors and plasmacytoma patients as well as in several human plasmacytoma cell lines. Furthermore, we show that miR-24–3p expression is upregulated by the survival factors IL-6 and SDF-1α and that IL-6 prevented apoptosis in association with increased miR-24–3p expression under conditions of ER stress in plasmacytoma cells. Inhibition of extracellular signal regulated kinase 1/2 (Erk1/2) led to significantly decreased miR-24–3p level, suggesting a role of the MAPK/Erk1/2 signaling in miR-24–3p-mediated plasma cell survival.

Results

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

Primary bone marrow plasma cells express miR-24–3p

To determine whether miR-24–3p is expressed in cells of the B-cell lineage, we analyzed their expression in FACS-sorted primary human blood B cells (CD22+) (Supporting Information Fig. 1), plasmablasts CD27++, CD19int, and CD38++) as well as bone marrow plasma cells (PC) (CD138++, CD38++) from healthy and plasmacytoma patients using deep sequencing of miRNA libraries. Our analysis revealed stable expression of miR-24–3p in all tested cell types. Noticeably, we found increased expression levels of miR-24–3p in bone marrow plasma cells from plasmacytoma patients in comparison to healthy donors (Fig. 1A). In addition, miR-24–3p was also expressed in the plasmacytoma cell lines RPMI-8226, U266, JK-6L, and XG1 (Fig. 1B). Subsequent functional analyses in vitro were performed with the human plasmacytoma cell line RPMI-8226, JK-6L, and U266.

image

Figure 1. Expression of miR-24–3p in primary human B-lineage cells and plasmacytoma cell lines. The miR-24–3p expression as a percentage of total miRNAs that were sequenced from miRNA libraries was determined. (A) Deep sequencing analysis of miR-24–3p in primary human peripheral blood B cells (B cell, n = 2 samples), pooled bone marrow plasma blasts from four healthy individuals (Pb) and plasma cells (BM-PC, n = 2), and bone marrow plasma cells from MM patients (MM-BM-PC, n = 5). (B) Deep sequencing analysis of miR-24–3p in four human MM cell lines (RPMI-8226, U266, JK-6L, and XG1). Data were obtained from one experiment.

Download figure to PowerPoint

Plasma cell survival depends on the expression of hsa-miR-24–3p

We used the plasmacytoma cell lines RPMI-8226, U266, and JK-6L as models to investigate the function of miR-24–3p in PCs. In addition, we studied primary human B cells isolated from PBMCs. During activation of primary B cells to plasmablasts with 2 μM/mL CpG ODN 22 for 72 h (B cells + CpG) miR-24–3p expression was strongly increased (Fig. 2A).

image

Figure 2. Expression of miR-24–3p mediates survival of PCs. (A) qPCR of miR-24–3p expression normalized to RNU1–1 from naïve B cells (B cell) and naïve B cells after activation with 2 μM/mL CpG ODN 22 (B cell + CpG) (n = 10) for 72 h. Relative expression levels were calculated by the ΔΔ cT method with naïve B cells as reference (set as 1). (B) Viability after miR-24–3p knockdown in primary B cells (72 h) using miR-24–3p siRNA (n = 12) or control siRNA (n = 6). (C) Viability after miR-24–3p knockdown. RPMI-8226 cells were transfected with either anti-miR-24–3p-siRNA (miR-24–3p siRNA) (n = 16) or negative control-siRNA (control siRNA) (n = 3) for 48 h. Number of vital cells (%) were determined using Trypan blue staining normalized to medium control (med, n = 12). (D) qPCR analysis of bim expression normalized to beta-actin from RPMI-8226 cells transfected with anti-miR-24–3p-siRNA (miR-24–3p siRNA) (n = 9) or negative control-siRNA (control siRNA) (n = 9) for 24 h. Relative expression levels were calculated by the ΔΔ cT method. Data are shown as mean +SEM; **p<0.01; ***p<0.001; two-tailed Student's t-test. (E) Bim protein expression after miR-24–3p knockdown. Protein extracts from RPMI-8226 cells transfected with anti-miR-24–3p-siRNA (miR-24–3p siRNA) for 24 and 48 h or negative control-siRNA (control siRNA) for 24 h were analyzed via western blot with anti-Bim-antibody detecting the isoforms BimEL (22 kDa) and BimL (15 kDa) (green). β-actin was used as a loading control (red). As positive control, cells were treated with 1 μM dexamethasone for 6, 12, 24, and 48 h. Semiquantitative analyses of BimEL and BimL expression normalized to beta-actin are shown in relation to lane 1. Data shown are from one experiment representative of three performed.

Download figure to PowerPoint

Since miR-24–3p expression has an antiapoptotic function in other cell types, we suppressed the miR-24–3p level in B cells and plasmacytoma cells with anti-miR-24–3p-siRNA. Transfection of naïve B cells (Fig. 2B), RPMI-8226 (Fig. 2C), JK-6L, and U266 (Supporting Information Fig. 2A and B) with miR-24–3p-siRNA (miR-24–3p siRNA) resulted in a significant reduction of viability compared with controls as shown by Trypan blue staining. Successful knockdown of miR-24–3p was confirmed by qPCR (Supporting Information Fig. 2C).

Interestingly, loss of viability after miR-24–3p knockdown was not associated with changes in the proliferation level of the treated cells: Labeling with 1 nM CFDA-SE of RPMI-8226 cells directly prior to siRNA transfection revealed no changes in the proliferation rate between cells that were transfected with miR-24–3p-siRNA (miR-24–3p-siRNA) or negative control siRNA (control) after 48 h (Supporting Information Fig. 2G). To further clarify the influence of miR-24–3p on apoptosis, we studied the expression of proapoptotic Bcl2 family protein Bim, a putative target of miR-24–3p (predicted by TargetScanHuman and PicTar databases). Transfection with miR-24–3p-siRNA resulted not only in increased apoptosis, but also in an upregulation of Bim on the mRNA level after 24 or 48 h in RPMI-8226 (as demonstrated by qPCR analysis, Fig. 2D) and in JK-6L and U266 (Supporting Information Fig. 2D) and on the protein level (Western blot, Fig. 2E). As positive control for Western blot detection of Bim, RPMI-8226 cells were treated with 1 μM of dexamethasone, an apoptosis inducer, and Bim was measured after 24 and 48 h. Taken together, these results indicate an antiapoptotic function of miR-24–3p in human PC.

miR-24–3p expression is regulated by exogenous IL-6 and SDF-1α stimulation

Since long-term PC survival is dependent on the continuous supply with external survival factors, we tested the influence of the well-characterized survival factors IL-6 and SDF-1α on miR-24–3p expression. Expression of miR-24–3p increased significantly in RPMI-8226 cells after stimulation with rh-IL-6 or rh-SDF-1α (10; 50; 100 ng/mL) after 24 h (Fig. 3A and B). miR-24–3p expression was calculated with the ∆∆ cT method under inclusion of the naïve control group. An increase of miR-24–3p expression after IL-6 stimulation (10; 50; 100 ng/mL) could also be detected in U266 and JK-6L cells (Supporting Information Fig. 3D). In parallel, we tested the influence of IL-6 or SDF-1α stimulation on the proliferation level of the treated RPMI-8226 cells. After CFDA-SE-labeling (1 nM), RPMI-8226 cells were stimulated with 10, 50, and 100 ng/mL of rh-IL-6 or rh-SDF-1α followed by FACS analysis after 0, 24, 48, and 72 h. In both IL-6 (Supporting information Fig. 3A and C) and SDF-1α (Supporting Information Fig. 3B) treated groups, no changes in proliferation levels were detectable compared with the naïve controls, respectively. These studies indicate that IL-6 and SDF-1α-mediated regulation of miR-24–3p expression and survival seems to be autonomous from cell proliferation.

image

Figure 3. IL-6 and SDF-1α enhance miR-24–3p expression. (A and B) Quantitative analysis of miR-24–3p expression in RPMI-8226 cells normalized to RNU1–1. RPMI-8226 cells were stimulated with 10, 50, and 100 ng/mL rh-IL-6 or SDF-1α for 24 h. Relative expression levels were calculated by the ΔΔ cT method with naïve cells as reference. Data are shown as mean +SEM of six samples pooled from three independent experiments; **p<0.01; ***p<0.001, two-tailed Student's t-test.

Download figure to PowerPoint

IL-6-mediated survival of plasma cells under ER stress is associated with miR-24–3p expression

We next sought to determine if miR-24–3p is involved in coping with intracellular stress caused by dysregulation of protein processing, which is a key mechanism for plasma cell survival. For this purpose, we treated RPMI-8226 cells with 0.25 μg/mL of the ER stress inductor tunicamycin with or without a simultaneous stimulation by 50 ng/mL rh-IL-6 or rh-SDF-1α for 24, 48, and 72 h. Trypan blue staining and annexin-V staining revealed an increased number of viable cells after simultaneous treatment with tunicamycin and IL-6 (p < 0.05) compared with that of the tunicamycin-only control group after 72 h in RPMI-8226 (Fig. 4A). In RPMI-8226, measurements after 24 and 48 h showed a lower effect of IL-6 on survival (Supporting Information Fig. 4A and B). The peak of this effect after 72 h coincided with enhanced miR-24–3p expression and a reduction in Bim-specific expression in the tunicamycin-/IL-6-treated cells (Fig. 4B and C). IL-6-mediated survival after tunicamycin treatment was also observed in JK-6L cells (48 h) together with enhanced miR-24–3p and lowered Bim expression (Supporting Information Fig. 4D–G). In contrast to IL-6, stimulation with SDF-1α showed no significant effect on RPMI-8226 viability for all time points tested (Fig. 4A; Supporting Information Fig. 4A and B). To validate tunicamycin-mediated ER stress, mRNA expression of hspa5A and chop, both important markers for ER-stress-induced apoptosis, were measured by qPCR analysis. The expression of both markers was upregulated during tunicamycin treatment (Supporting Information Fig. 4I and J). Given the enhanced expression of miR-24–3p together with increased IL-6-mediated survival under ER stress conditions, we tested the influence of miR-24–3p-specific knockdown in these cells. We found that miR-24–3p knockdown by transfection of 120 nmol miR-24–3p-siRNA (miR-24–3p-siRNA) in tunicamycin (0.25 μg/mL)/IL-6 (50 ng/mL) pretreated RPMI-8226 and JK-6L cells for 24 h resulted in a significant reduction of viable cells (p < 0.01) compared with those cells transfected with a negative control siRNA (Fig. 4D, Supporting Information Fig. 4H). Trypan blue staining also revealed that the positive effect of IL6 treatment on the viability of RPMI-8226 and JK-6L cells was entirely abolished by knockdown of miR-24–3p, since the number of viable cells was diminished to a similar level as in the tunicamycin control (Fig. 4D, Supporting Information Fig. 4H). Taken together, these results indicate a direct influence of exogenous IL-6 on survival under ER stress conditions due to the upregulation of the antiapoptotic miR-24–3p in plasma cells.

image

Figure 4. IL-6 mediates survival of PCs under ER-stress conditions dependent on miR-24–3p expression. (A) Viability of RPMI-8226 cells after treatment with 0.25 μg/mL tunicamycin (Tunica.) with either additional stimulation by 50 ng/mL rh-IL-6 (Tunica. + IL-6) or 50 ng/mL rh-SDF-1α (Tunica. + SDF-1 α) for 72 h. Number of vital cells (%) were determined using Trypan blue staining normalized to naïve cells (naive). (B) qPCR analysis of miR-24–3p expression normalized to RNU1–1 from RPMI-8226 cells treated with 0.25 μg/mL tunicamycin (Tunica.) alone or together with 50 ng/mL rh-IL-6 (Tunica. + IL-6) for 72 h. (A and B) Data are shown as mean ± SEM of six samples from three independent experiments (*p<0.05). (C) qPCR analysis of Bim expression normalized to beta-actin from RPMI-8226 cells treated with 0.25 μg/mL tunicamycin (Tunica.) alone or together with 50 ng/mL rh-IL-6 (Tunica. + IL-6) for 72 h. Relative expression levels were calculated by the ΔΔ cT method. Data are shown as mean +SEM of five samples from three independent experiments (*p<0.05). (D) Number of vital RPMI-8226 cells (%) treated with 0.25 μg/mL tunicamycin alone (n = 8) or together with 50 ng/mL rh-IL-6 (n = 12) for 72 h following transfection with anti-miR-24–3p-siRNA (miR-24–3p siRNA) (n = 26) or negative control-siRNA (control siRNA) (n = 26) for 24 h. Number of vital cells (%) were determined using Trypan blue staining normalized to naïve cells (naive). Data are shown as mean ± SEM of eight samples from three independent experiments; *p<0.05; **p<0.01; two-tailed Student's t-test.

Download figure to PowerPoint

IL-6-induced expression of miR-24–3p is mediated by Erk1/2

Since IL-6-induced upregulation of miR-24–3p appears to play a crucial role in preventing ER stress induced cell death of plasma cells, we sought to identify the involved signaling pathway. miR-24–3p is encoded in the 3`UTR of the gene c9orf3, a zinc-dependent metallopeptidase on chromosome 9. Therefore, we tested if the IL-6-induced upregulation in RPMI-8226 cells is associated with changes in c9orf3 expression. We found that the expression of c9orf3 was elevated after 24 h of stimulation with different concentrations of IL-6 (10; 50, and 100 ng/mL) (Supporting Information Fig. 5B).

Next, we hypothesized that IL-6 might regulate miR-24–3p expression in RPMI-8226 cells through the MAPK signaling pathway, which can be activated by IL-6. For this purpose, we suppressed Erk1/2, a downstream kinase in the MAPK pathway in IL-6-stimulated RPMI-8226 cells, in JK-6L cells, and in U266 cells. Quantitative PCR analysis revealed a decreased expression of the precursor and mature miR-24–3p in RPMI-8226 cells treated for 24 h with different concentrations of the ERK Activation Inhibitor Peptide II (anti-Erk1/2) (50, 100, and 500 ng/mL), a specific inhibitor of Erk1/2 activation (Fig. 5A and C). As an additional control, we treated RPMI-8226 cells with 50 ng/mL rh-IL-6 alone or together with either 500 ng/mL of anti-Erk1/2 and 10 μM U0126, respectively for 24 h followed by qPCR analysis of miR-24–3p and c9orf3 expression (Fig. 5B and D). Consistent with our finding that Erk1/2 signaling is an important mediator for miR-24–3p expression, anti-Erk1/2/IL-6 and U0126/IL-6-treated RPMI-8226 cells expressed less miR-24–3p (p < 0.05; p < 0.01) compared with that expressed by the IL-6 control group (IL-6) (Fig. 5B). As a control, successful transfection of RPMI-8226 cells with mapk1-siRNA was confirmed by qPCR (Supporting Information, Fig. 5A) and the reduction of phosphorylated pErk1/2 after treatment of RPMI-8226 cells with U0126 or anti-Erk1/2 on the protein level was confirmed by Western blot analysis (Supporting Information Fig. 5I). In harmony with the findings in RPMI-8226, Erk 1/2 inhibition also caused a significantly reduced expression of miR-24–3p and c9orf3 (Supporting Information Fig. 5C, D, G, and H) and an enhanced expression of the proapoptotic Bim (Supporting Information Fig. 5E and F) in IL-6-stimulated U266 and JK-6L cells.

image

Figure 5. Erk1/2-dependent expression of miR-24–3p. (A) miR-24–3p-precursor (miR-24–3p-PRE) and (C) miR-24–3p expression in RPMI-8226 cells normalized to RNU1–1 after treatment with 50, 100, and 500 ng/mL of anti-Erk1/2 for 24 h. (B and D) Quantitative analysis of (B) miR-24–3p and (D) c9orf3 expression normalized to RNU1–1 in RPMI-8226 cells treated with 50 ng/mL rh-IL-6 (IL-6); 50 ng/mL rh-IL-6 together with 500 ng/mL of the anti-Erk1/2 peptide (IL-6+anti-Erk1/2) or 10 μM +U0126 (IL-6+U0126) for 24 h.(A–D) Data are shown as mean ± SEM of eight samples from three to five independent experiments (*p<0.05, ***p<0.01). (E and F) Quantitative analysis of (E) miR-24–3p expression and (F) c9orf3 expression normalized to β-actin normalized to RNU1–1 in RPMI-8226 cells treated with 100 nmol of specific anti-Erk1/2 (Erk1/2 siRNA) or negative control siRNA (control siRNA) for 72 h. The relative expression levels were calculated by the ΔΔ cT method. Data are shown as mean ± SEM of nine samples from three independent experiments; **p<0.01; ***p<0.01; *p<0.05; **p<0.01; ***p<0.01, two-tailed Student's t-test.

Download figure to PowerPoint

These results could also be verified by specific Erk1/2 knockdown in IL-6 (50 ng/mL) treated cells. miR-24–3p (p < 0.001) and c9orf3 (p < 0.01) levels were significantly reduced compared with those of the control groups (control siRNA) after transfection with Erk1/2 siRNA in RPMI-8226 cells (Fig. 5E and F) and in JK-6L and U266 cells (Supporting Information, Fig. 5J–M). This suggests a parallel regulation of miR-24–3p and c9orf3. Thus MAPK/Erk1/2-mediated IL-6 signaling is involved in the regulation of miR-24–3p in plasma cells. These findings demonstrate that miR-24–3p is an intrinsic antiapoptotic mechanism capable of responding to exogenous survival factor signaling in plasma cells.

Discussion

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

Numerous studies have illustrated the relevance of plasma cell longevity for the orchestration and maintenance of protective and pathological immune responses. Long-lived plasma cells maintain protective antibody levels even in the absence of specific antigen. Survival of plasma cells depends on the interaction of exogenous and intracellular signals, the survival niche. Within their niche, autoreactive and allergen-specific plasma cells are protected against various immunosuppressive therapies and irradiation. In this study, we revealed a putative novel mechanism for regulation of plasma cell survival upon stimulation by external survival factors. We found miR-24–3p expression in primary B cells, bone marrow PB, and bone marrow plasma cells as well as in various plasmacytoma cell lines. Functional analysis revealed that exogenous IL-6 and SDF-1α upregulate miR-24–3p expression in human plasmacytoma cells and in in vitro stimulated primary B cells and that miR-24–3p expression has an antiapoptotic effect. This provides evidence for a direct connection between exogenous survival signals of the plasma cell survival niche with an intracellular response.

For continuous survival, plasma cells need a specific microenvironment, the survival niche, which provides sufficient exogenous factors for long-term survival [9]. Among those survival factors are IL-6 and SDF-1α, which are provided by mesenchymal and hematopoietic cells like eosinophil granulocytes, reticular stromal cells, monocytes and macrophages in bone marrow, lymphatic organs, mucosa-associated lymphatic tissues, and chronically inflamed tissues. In the extrafollicular areas of secondary lymphatic tissues, long-lived plasma cells are found in direct association with sources of IL-6 secretion [6, 20]. Expression of miR-24–3p, which has an anti-apoptotic effect, significantly increases after stimulation with IL-6 and SDF-1α in vitro. Thus miR-24–3p could mediate plasma cell survival in response to external survival signals. Interestingly, long-lived plasma cells, which express CD28, can probably actively contribute to their own survival niche by inducing IL-6 expression in surrounding CD80/86 cells [21, 22]. Thus, miR-24–3p-mediated cell survival could function as a positive feedback loop for a constant prevention of apoptosis in plasma cells within a niche. Moreover, IL-6 produced by bone marrow stromal cells and osteoblasts [23] is one major contributor for the plasmacytoma cell survival niche and correlates with tumor cell mass, disease stage, and prognosis [24, 25]. Plasmacytoma cell migration, homing, and survival depend on continuous availability of external signals, respectively. In particular, SDF-1α/CXCL12 and its cognate receptor CXCR4 and VEGF1 are essential for plasmacytoma cell migration and homing [26]. Similar to protective plasma cells, plasmacytoma cells are able to stimulate IL-6 secretion in their vicinity by attracting mesenchymal stem cells. IL-6 together with IGF-1 is even able to overcome bortezumib-induced apoptosis [27]. The observed long-lasting and high expression of miR-24–3p in bone marrow plasmacytoma cells could result from previous transformation processes and could enable survival and expansion of plasmacytoma cells in their bone marrow microenvironment. Furthermore, the availability of IL-6 and SDF-1α in the surrounding tissue or IL-6 expression by the plasmacytoma cell itself could augment this effect in the sense of a positive feedback loop. Expression of miR-24–3p in primary B cells, plasma blasts, and their upregulation after activation of primary B cells with CpG suggests that the antiapoptotic role of miR-24–3p could preserve the plasma cells from apoptosis, even during differentiation and maturation and could mediate long-term survival of the mature plasma cells settled in the bone marrow niche.

Long-term repression of harmful ER stress is thought to be one major mechanism for maintaining longevity in plasma cells [28]. We found that survival of RPMI-8226 plasmacytoma cells exposed to the ER stress inductor tunicamycin [29], which inhibits glycosylation of proteins in the ER, could be prolonged significantly by simultaneous exposure to IL-6. This effect was associated with an increased expression of miR-24–3p and a decrease in Bim-mRNA expression in these cells. Supporting these findings, miR-24–3p knockdown in IL-6 and tunicamycin-treated cells abrogated the protective effect. These data suggest that miR-24–3p mediates the antiapoptotic function of IL-6 under the ER stress. In contrast to IL-6, stimulation with SDF-1α also increases mature miR-24–3p level but only induced a mild, nonsignificant increase of viable cells under ER stress conditions.

It has been proposed that one single miRNA is able to repress multiple targets and thus can modulate various cellular processes. It is still under investigation how one individual miRNA coordinates its effects and how this causes cell-type specific response patterns. miR-24–3p has been reported to repress the proapoptotic targets FAF1, Caspase-9 and Apaf-1 with miR-24–3p expression associated with survival [30-32]. Conversely, miR-24–3p also targets prosurvival genes such as Bcl-2 and PAK4, which could induce cell death [33, 34]. miR-24–3p has been recently reported to regulate apoptosis in cancer cells by targeting X-linked inhibitor of apoptosis protein (XIAP), a strong repressor of caspase-3, -7, and -9 [35]. Furthermore, miR-24–3p is thought to regulate cell-cycle progression by suppression of E2F2 and c-Myc [19]. We found elevated expression of Bim mRNA and protein, a mediator of both ER stress induced and mitochondrial apoptosis [36, 37], after specific knockdown of miR-24–3p in plasmacytoma cells. Supporting our data, Bim has recently been identified as a direct target for miR-24–3p in hematopoietic cells [32] and mouse cardiomyocytes [38] and its knockdown resulted in elevated apoptosis events. In harmony with this finding, the suppression of IL-6 induces upregulation of Bim and an activation of Bcl2-associated X protein (Bax) in plasmacytoma cells, resulting in apoptosis [39, 40]. Bim is also a direct target of the miR-17∼92 cluster, which also contributes to the pathogenesis of plasmacytoma [41]. Targeting Bim represents a direct way to influence apoptotic signaling. Interestingly, we found in three plasmacytoma cell lines that miR-24–3p apparently acts via Bim and XIAP (Supporting Information Fig. 2D and F), but not via FAF1 (Supporting Information Fig. 2E). Thus, future studies should address the modulation of different putative target proteins by miR-24–3p specifically in plasma cells.

IL-6 triggers the activation of various signaling pathways including the MEK/MAPK, and the JAK/STAT3 pathway [42]. Addressing the question which part of the IL-6 signaling pathway could be involved in miR-24–3p regulation, we investigated the role of Erk1/2 in miR-24–3p expression. Inhibition of the Erk1/2 kinase, a downstream member of the MAPK pathway, led to a drastic reduction of both precursor and mature miR-24–3p. This suppression occurred equally in mature/precursor miR-24–3p and in c9orf3 transcripts, the host gene of miR-24–3p.

The miR-24–3p is encoded in two distinct clusters. The miR-24–1 cluster encompasses miR-24–3p, miR-23b, and miR-27b and is encoded on chromosome 9, whereas the miR-24–2 on chromosome 19. The miR-24–1 cluster lies within the 3`UTR of c9orf3, a gene coding for the zinc-dependent metallopeptidase aminopeptidase O (AP-O). Little is known about the regulation of the miR-24–1 cluster/c9orf3 in humans. To date, no miR-24–1 cluster-specific promoter sequences have been identified. Interestingly, in mice miR-27b seems to co-regulated with its host gene [43]. The parallel reduction of both c9orf3 and mature miR-24–3p expression after Erk1/2 inhibition could also be explained by a co-regulation of both genes by Erk1/2 or its downstream signaling members. Furthermore, in support of the observation by Paroo et al. [44] that phosphorylation of TRBP by Erk1/2 is an integral part of the miRNA-processing complex, it could be speculated that IL-6-mediated upregulation of mature miR-24–3p is specifically mediated by the MAPK pathway.

Thus, further experiments should address the questions, how c9orf3 expression and concomitant miR-24–3p expression are regulated and if the c9orf3 gene has a particular function in plasma cells.

The permanent presence of IL-6 in the bone marrow niche together with resulting MAPK signaling and miR-24–3p expression could provide a direct way for mediating plasma cell survival. Our findings indicate that miR-24–3p mediates IL-6-induced plasma cell survival in health and disease due to an antiapoptotic effect. A miR-24–3p-directed therapy could provide a novel approach for the treatment of autoimmune disease, allergy or multiple myeloma. IL-6, one of the exogenous survival signals provided by the plasma cell survival niche, induces miR-24–3p expression dependent on Erk1/2 activity. Taken together, these data provide evidence for a direct connection between exogenous survival signals of the plasma cell survival niche with an intracellular response.

Materials and methods

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

General procedures

ERK activation inhibitor peptide II was purchased from Merck (Darmstadt, Germany). U0126, rabbit anti-human Phosho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) and rabbit anti-human p44/42 MAPK (Erk1/2) antibody were obtained from Cell Signaling Technology (Frankfurt am Main, Germany). Rabbit anti-human Bim antibody was obtained from Abcam (Cambridge, UK). Anti-beta-actin antibody was obtained from Sigma (Hamburg, Germany). Bim-specific Western blot (WB) was performed with the Odyssey system from Li-COR (Bad-Homburg, Germany) using donkey anti-rabbit IRDye 800 (Li-Cor) and donkey anti-mouse IgG IRDye 700 (Rockland, Gilbertsville, PA, USA) for detection. Phospho-p44/p42- and p44/p42-specific WB was performed with Fusion-FX7 imaging system (Peqlab, Erlangen, Germany). Dexamethasone and tunicamycin were obtained from Sigma. CpG ODN 22 was kindly provided by the Department of Immunology from the Philipps-University of Marburg.

FACS analysis and cell sorting

Primary human B cells were isolated by centrifugation in Ficoll density gradient (GE Healthcare, Freiburg, Germany). Then, immunomagnetic cell sorting of CD22+ blood B cells or immunomagnetic cell enrichment of CD38++ cells from peripheral blood mononucleated cells was done according to manufacturer's instructions (MACS kit, Miltenyi Biotech, Bergisch-Gladbach, Germany). MoFlo cell sorting of CD27++CD19int.CD38++ plasma blasts from CD38-enriched peripheral blood mononucleated cells or MoFlo cell sorting of CD138++CD38++ plasma cells from bone marrow aspirates was done after staining with respective antibodies 15 min on ice (all antihuman antibodies from Miltenyi Biotech, except anti-human CD38 from BD Biosciences, Mountain View, CA, USA). The purity of plasma cell samples was >90% CD138++CD38++ cytoplasmatic kappa/lambda+ as determined by FACS analysis. Healthy bone marrow donor material was obtained from patients attending the Department of Surgery, University of Erlangen-Nürnberg, after patients had given written informed consent. Myeloma bone marrow samples were obtained from patients attending the Department of Haematology, Medical clinic 5, University of Erlangen-Nürnberg. Patients were diagnosed as MM (n = 5) according to criteria described in the myeloma management guidelines [45]. Patient samples were collected after written consent of subjects in accordance with the Declaration of Helsinki and approved by the local ethics committee (Erlangen Regional Ethics Committee, approval #3954).

Cell culture procedures

The human plasmacytoma cell lines U266 (DSMZ ACC-No. 9, Braunschweig, Germany), RPMI-8226 cells (DSMZ ACC-No. 402, Braunschweig, Germany), and JK-6L [46] were cultured in RPMI 1640 medium (PAA Laboratories, Cölbe, Germany) at 37°C and 5% CO2, all supplemented with 10% heat inactivated fetal bovine serum (for JK-6L 20% FCS), 50 μM ß-mercaptoethanol, 2 mM l-glutamine, 1 mM sodium pyruvate, and 100 U/mL Pen/Strep.

Stimulation of plasmacytoma cells (1 × 106 cells/well) was performed in six-well trays with different concentrations (10; 50; 100 ng/mL) of either rh-SDF-1α (ImmunoTools; Friesoythe, Germany) or rh-IL-6 (ImmunoTools) for 24 and 48 h. Afterward, cell pellets were frozen in liquid nitrogen until further analysis.

Primary human B cells were isolated from fresh blood samples from healthy donors using the whole blood B-cell isolation kit II from Miltenyi (Bergisch Gladbach, Germany) and cultured in 250 μL of RPMI-1640 medium (10% FCS, 2 mM l-Glutamine, 1 mM sodium pyruvate, and 100U/mL Pen/Strep) under conditions described above. Blood samples were obtained after written consent of the donors and approval of the local ethics committee.

Proliferation staining was performed in six-well trays with 2 mL of medium and 1 μM CFDA-SE (Invitrogen; Darmstadt, Germany) according to the manufacturer's recommendations following detection with the FACS Calibur System after 24, 48, and 72 h and compared with staining levels at 0 h.

Erk1/2 inhibition

U0126 was used at a concentration of 10 μM and anti-Erk1/2 was used at 500 ng/mL. U0126 was administered 1 h prior to stimulation with 50 ng/mL IL-6 for 24 h. Afterward, cell extracts were obtained for WB analysis and total RNA was isolated for qPCR analysis. Medium only cultured cells were used as references.

Transfection

For transfection, 1 × 105 cells were plated in each well of a 48-well tray. For primary B-cell transfection, 1 × 105 cells were seeded in a 96-well plate. Transfection with 120 nmol miR-24–3p-specific siRNA (miScript miR-Inhibitor, Qiagen, Hilden, Germany) was performed with HiPerFect for 24 and 48 h according to the manufacturer's recommendations. As positive controls, the miR-1-transfection control (100 nmol Anti-hsa-miR-1 inhibitor and 100 nmol anti-hsa-miR-1-mimic) from Qiagen was used. Viable cell populations were detected with Trypan blue staining. Transfections with the 120 nmol miScript-Inhibitor Negative Control were used as negative controls. Cell counts were normalized to untreated cells. Erk1/2 specific knockdown was performed with 100 nmol of MAPK1 control siRNA and the AllStars Negative Control siRNA (Qiagen). Seventy-two hours after transfection, cells were harvested and the expression of miR-24–3p and c9orf3 was quantified via qPCR. Transfection efficiency was determined by qPCR using miR-24–3p and MAPK1 Quantitect Primer Assay (Qiagen). RNU1–1 and beta-actin were used as references.

Stress assay

For stress induction, cells were plated in six-well plates and cultivated in 2 mL of RPMI-1640 medium. 0.25 μg/mL tunicamycin was added and after 24, 48, and 72 h incubation, the cell vitality was determined by Trypan blue staining. Apoptosis detection was performed with the FITC-Annexin-V-Apoptosis- Detection-Kit-I (BD Pharmingen, Heidelberg, Germany) according to the manufacturer's protocol.

Deep sequencing

For deep sequencing analysis, small RNA libraries of B-cell lines and sorted B-cell subsets were generated by Vertis Biotechnologie AG (Freising, Germany). Briefly, small RNA were isolated from sorted cells using the mirVana miRNA isolation kit (Ambion Life Technologies, Karlsruhe, Germany) and separated on a denaturing 15% polyacrylamide (PAA) gel and stained with SYBR Green II. The small RNA fractions with a length of 19 to 29 bases were obtained by electroelution of the RNAs from the gel, precipitated, and dissolved in water. After poly(A)-tailing using poly(A) polymerase followed by treatment with tobacco acid pyrophosphatase (TAP), an RNA adapter containing a specific “bar code” sequence for each sample was ligated to the 5´-phosphate of the RNA. After first-strand cDNA synthesis using an oligo(dT)-adapter primer and the M-MLV reverse transcriptase, the resulting cDNAs were PCR amplified to about 10–20 ng/μL using a high fidelity DNA polymerase. Next, cDNAs were mixed in approximately equal amounts and products of appropriate length were fractionated on a preparative 6% PAA gel by electroelution. Illumina sequencing of the cDNA samples was performed by GATC Biotech (Konstanz, Germany). Bioinformatic analysis was performed with the miRAnalyzer software [47].

mRNA and miRNA analysis

Total RNA, including miRNA, was isolated by using Trifast reagent (Peqlab) according to the manufacturer's recommendations. For cDNA synthesis of mRNA and miRNA, 500 ng of each probe was used and qPCR was carried out with the miScript-PCR System from Qiagen in combination with the kappa-fast-SybrGreen (Peqlab). mRNA expression was normalized to beta-actin and miRNA expression was normalized to RNU1–1. The relative expression level was computed using the ΔΔ cT analysis method. The following human mRNA primers were used (5′–3′): beta-actin forward: GATCATTGCTCCTCCTGAGC, reverse: ACTCCTGCTTGCTGATCCAC. Bim/bcl2l11 forward: TGCTGTCTCGATCCTCCAGTGGG, reverse: GCCTGGCAAGGACTTGGG. chop forward: CACTACCCACCTTTCCCAGA, reverse: GTCTACTCCAAGCCTTCCCC, hspa5 forward: GCGCCGCGGCCTGTATTTCTA, reverse: AGGAGCACAGCGCAATTTCCG. c9orf3_Ex1/Ex2 forward: CATGCTATCAGGATATGGTAC, reverse: CATGTTGACATGGCAACGGG. hu-FAF1 forward: TGAGGCCTATCGCCTTTCAC, hu-FAF1 reverse: TTGCGAATCTGCTCCAAACG. hu-XIAP forward: ACCCTCCCCTTGGACCGA, hu-XIAP reverse: CTCTTGAAAATAGGACTTGTCCACC.

Statistical analysis

Experiments were run in triplicate and were repeated in a minimum of three independent trials. Statistics were performed with GraphPad Prism software V5.03 (GraphPad Software, La Jolla, CA, USA). Data are presented as mean ± SEM. The two-tailed Student's t-test was used to determine statistical significance. p < 0.05 was considered statistically significant.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

This work was supported by the Deutsche Forschungsgemeinschaft (DFG) SFB/TR22, TPA17 (to M.Z.) and BFOR832 (to H.M.J.), the Interdisciplinary Center for Clinical Research (IZKF, project D7) at the University Hospital of the University of Erlangen-Nürnberg and the Hiege Foundation to H.M.J and J.W. The authors thank Lars Abram for invaluable advice during the entire project. We thank Sabine Jennemann, Regina Stöhr (Department of Pediatrics), Julia Moldt, and Guido Weidler (Laboratory of Molecular Plant Physiology and Photobiology, Philipps University Marburg) for their excellent technical help. We also thank Tobias Rogosch and Sebastian Kerzel (Pediatric Department, Philipps University, Marburg, Germany) for helpful discussions.

References

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information
Abbreviations
SDF-1α

stromal cell derived factor 1

XIAP

X-linked inhibitor of apoptosis protein

Supporting Information

  1. Top of page
  2. Abstract
  3. Introduction
  4. Results
  5. Discussion
  6. Materials and methods
  7. Acknowledgements
  8. Conflict of interest
  9. References
  10. Supporting Information

As a service to our authors and readers, this journal provides supporting information supplied by the authors. Such materials are peer reviewed and may be re-organized for online delivery, but are not copy-edited or typeset. Technical support issues arising from supporting information (other than missing files) should be addressed to the authors.

FilenameFormatSizeDescription
eji2761-sup-0001-FigureS1.pdf1826K

Figure S1. Enrichment of human CD22+ B cells. Peripheral blood mononuclear cells (PBMCs) were purified by density gradient centrifugation from peripheral blood. B cells were isolated with magnetic anti-CD22 beads (MACS). Purity of B cells was analyzed by staining with FITC-conjugated anti-CD19 antibody and FACS. Top right panel: depleted fraction, lower right panel: enriched fraction.

Figure S2. miR-24–3p knockdown in U266 and JK-6L cells. (A),(B) Viability after miR-24–3p knockdown. U266 (A) and JK-6L cells (B) were transfected with either anti-miR-24–3p-siRNA (miR-24–3p siRNA) (n = 16) or negative control-siRNA (control siRNA) (n = 3) for 24 h (U266, n = 6) and 48 h (JK-6L, n = 11). Viability (%) determined with trypan-blue staining normalized to medium control (med.). (C) control qPCR of miR-24–3p expression normalized to RNU1–1 from RPMI-8226 cells after transfection with either negative control siRNA (control siRNA) or miR-24–3p-specific siRNA (miR- 24–3p siRNA). Relative expression levels were calculated by the __ cT method with negative control as reference (set as 1). (D) qPCR analysis of bim expression normalized to beta-actin from U266 and JK-6L cells transfected with anti-miR-24–3psiRNA (miR-24–3p siRNA) (n = 9) or negative control-siRNA (control siRNA) (n = 9) for 24 or 48 h. (E), (F) qPCR analysis of potential apoptosis related targets of miR-24–3p faf1 (FAS-associated factor 1) and xiap (X-linked inhibitor of apoptosis protein) normalized to beta-actin from RPMI-8226, U266 and JK-6L cells transfected with anti-miR-24–3p-siRNA (miR-24–3p siRNA) (n = 9) or negative control-siRNA for 24 or 48 h. Relative expression levels were calculated by the __ cT method with negative control as reference (set as 1). (G) Proliferation rate (%) in RPMI-8226 cells labeled with 1nM CFDA-SE following transfection with anti-miR-24–3p-siRNA (miR-24–3p siRNA), negative control-siRNA (control siRNA) and FACS-analysis after 48 h. Reference: medium cultured RPMI-8226 cells (med.). Mean ± SEM. n = 3.

Figure S3. Proliferation level after stimulation with IL-6 or SDF-1α. RPMI-8226 cells labeled with 1nM CFDA-SE followed by stimulation with 10 ng/ml, 50/ml ng and 100 ng/ml rh-IL-6 (A) or SDF-1α (B) subsequent FACS-analysis after 24, 48, and 72h. Reference: naïve RPMI-8226 cells (black bars). Mean±SEM. n = 4. (C) Representative histograms. (D) Quantitative analysis of miR-24–3p expression in U266 and JK-6L normalized to RNU1–1. Cells were stimulated with 10 ng/ml, 50 ng/ml and 100 ng/ml rh-IL-6 for 24 h. Relative expression levels were calculated by the __ cT method with negative control as reference (set as 1). Mean values ± SEM; ** p<0.01; *** p<0.001.n = 9

Figure S4. IL-6 mediated survival of PC under ER-stress conditions. RPMI-8226 cells treated with 0.25 μg/ml tunicamycin (Tunica.) and 50 ng/ml rh-IL-6 (Tunica.+IL- 6), or 50 ng/ml rh-SDF-1α (Tunica.+SDF-1 α) for 24 h (A) and 48 h (B). Trypan-blue staining normalized to naïve cells (naive). n = 6. RPMI-8226 (C) and JK-6L cells (D) treated with 0.25 μg/ml tunicamycin (Tunica.) and 50 ng/ml rh-IL-6 (Tunica.+IL-6) followed by annexin-V/PI staining and FACS analysis. Naïve cells were used as control. Representative histograms. (E) Viability of JK-6L cells after treatment with 0.25 μg/ml tunicamycin (Tunica.) or 50 ng/ml rh-IL-6 (Tunica. + IL-6) for 48 h. Viability (%) was determined using trypan-blue staining normalized to naïve cells (naive). n = 12. qPCR analysis of miR-24–3p expression normalized to RNU1–1 (F) and bim expression normalized to beta-actin (G) from JK-6L cells treated with 0.25 μg/ml tunicamycin (Tunica.) alone or together with 50 ng/ml rh-IL-6 (Tunica. + IL-6) for 48 h. Relative expression levels were calculated by the __ cT method. n = 6. (H) Viability of JK-6L cells treated with 0.25 μg/ml tunicamycin alone (n = 6) or together with 50 ng/ml rh-IL-6 (n = 6) for 48 h following transfection with anti-miR-24–3p-siRNA (miR-24–3p siRNA) (n = 26) or negative control-siRNA (control siRNA) (n = 6) for 24 h. Viability (%) was determined using trypan-blue staining normalized to naïve cells (naive). Mean values ± SEM. ** p<0.01.; *** p<0.01. hspa5 (I) and chop (J) expression in naïve RPMI-8226 cells (0 h) normalized to beta-actin and after stimulation with 0,25 μg/ml tunicamycin for 4, 8, and 24h. The relative expression level has been calculated by the __ cT method. Mean values ± SEM. n = 4.

Figure S5. Erk1/2-dependent expression of miR-24–3p. (A) Representative control qPCR of mapk1 expression normalized to beta-actin from RPMI-8226 cells after transfection with either negative control siRNA (control siRNA) or mapk1-specific siRNA (mapk1 siRNA). Relative expression levels were calculated by the __ cT method with negative control as reference (set as 1). (B) c9orf3 expression in RPMI- 8226 cells normalized to beta-actin. RPMI-8226 cells were stimulated with 10 ng/ml, 50 ng/ml and 100 ng/ml of rh-IL-6 for 24 h n = 9. Quantitative analysis of miR-24–3p expression normalized to RNU1–1 in JK-6L (C) and U266 cells (D) treated with 50 ng/ml rh-IL-6 (IL-6); 50 ng/ml rh-IL-6 together with 500 ng/ml of the anti-Erk1/2 peptide (IL-6+anti-Erk1/2) or 10 μM U0126 (IL-6+U0126) for 24 h. n = 9. Quantitative analysis of bim expression normalized to beta-actin in JK-6L (E) and U266 cells (F) treated with 50 ng/ml rh-IL-6 (IL-6); 50 ng/ml rh-IL-6 together with 500 ng/ml of the anti-Erk1/2 peptide (IL-6+anti-Erk1/2) or 10 μM U0126 (IL-6+U0126) for 24 h. n = 9. Quantitative analysis of c9orf3 expression normalized to beta-actin in JK-6L (G) and U266 cells (H) treated with 50 ng/ml rh-IL-6 (IL-6); 50 ng/ml rh-IL-6 together with 500 ng/ml of the anti-Erk1/2 peptide (IL-6+anti-Erk1/2) or 10 μM U0126 (IL-6+U0126) for 24 h. n = 9, n = 3. Relative expression levels were calculated by the __ cT method with naïve cells as reference. (I) RPMI-8226 cells treated with 50 ng/ml rh-IL-6 together with either 10 μM U0126 or 500 ng anti-Erk1/2 peptide for 24 h. Western Blot were performed for pErk1/2 (phospho p44/p42) detection. Beta-actin was used as loading control, the figure is cropped to show pErk lanes. Quantitative analysis of miR-24–3p expression normalized to RNU1–1 and c9orf3 expression normalized to beta actin in JK-6L (J), (L) and U266 cells (K), (M) treated with 100 nmol of specific anti-Erk1/2 (Erk1/2 siRNA) or negative control siRNA (control siRNA) for 48 h. n = 3. The relative expression levels were calculated by the __ cT method. Mean ± SEM. * p<0.05, ** p<0.01, *** p<0.01.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.