A novel XPD mutation in a compound heterozygote; the mutation in the second allele is present in three homozygous patients with mild sun sensitivity

Authors


Abstract

The XPD protein plays a pivotal role in basal transcription and in nucleotide excision repair (NER) as one of the ten known components of the transcription factor TFIIH. Mutations in XPD can result in the DNA repair-deficient diseases xeroderma pigmentosum (XP), trichothiodystrophy (TTD), cerebro-oculo-facial-skeletal syndrome, and in combined phenotypes such as XP/Cockayne syndrome and XP/TTD. We describe here an 18-year-old individual with mild sun sensitivity, no neurological abnormalities and no tumors, who carries a p.R683Q mutation in one allele, and the novel p.R616Q mutation in the other allele of the XPD gene. We also describe four patients from one family, homozygous for the identical p.R683Q mutation in XPD, who exhibit mild skin pigmentation and loss of tendon reflexes. Three homozygous patients presented with late-onset skin tumors, and two with features of premature aging and moderate cognitive decline. Cells from the compound heterozygous individual and from one of the patients homozygous for p.R683Q exhibited similar responses to UV irradiation: reduced viability and defective overall removal of UV-induced cyclobutane pyrimidine dimers, implying deficient global genomic NER. Cells from the compound heterozygous subject also failed to recover RNA synthesis after UV, indicating defective transcription-coupled NER. Mutations affecting codon 616 in XPD generally result in functionally null proteins; we hypothesize that the phenotype of the heterozygous patient results solely from expression of the p.R683Q allele. This study illustrates the importance of detailed follow up with sun sensitive individuals, to ensure appropriate prophylaxis and to understand the mechanistic basis of the implicated hereditary disease. Environ. Mol. Mutagen., 2012. © 2012 Wiley Periodicals, Inc.

INTRODUCTION

The nucleotide excision repair (NER) pathway removes helix distorting lesions and unusual structures in DNA that can occur throughout the genome in living cells. In humans, this pathway involves more than 30 proteins that recognize a lesion, denature the DNA to form a bubble around the lesion, incise the DNA strand a few nucleotides upstream and downstream of the lesion and remove the lesion-containing oligonucleotide, synthesize a patch to replace the removed segment, and ligate the patch to the contiguous DNA strands to restore the original sequence [Gillet and Scharer,2006 and references therein]. NER comprises two sub-pathways, global genomic repair (GGR) and transcription-coupled repair (TCR), which remove lesions from the genome overall and from actively transcribed DNA strands respectively [reviewed in Hanawalt and Spivak,2008]. Both modes of NER require the transcription factor IIH (TFIIH), a protein complex with 10 subunits. Two of the subunits, the helicases XPB and XPD, are essential for basal transcription and for NER, respectively; XPB opens the double-stranded DNA in the promoter to allow priming of nascent RNA and transcription by RNA polymerases I and II, whereas XPD unwinds the DNA around lesions and verifies the strand containing the lesion to facilitate repair. In addition to its ATP-dependent 5′-3′ helicase activity, XPD is involved in maintaining the integrity of the TFIIH complex. Mutations in XPD can result in the DNA repair-deficient diseases xeroderma pigmentosum (XP), trichothiodystrophy (TTD), cerebro-oculo-facial-skeletal syndrome (COFS), and in combined phenotypes such as XP/Cockayne syndrome and XP/TTD. XP can result from mutations in eight different genes: XPA through XPG, which code for NER factors, and XPV that codes for the translesion synthesis DNA polymerase eta. The general characteristic symptoms of XP are extreme sun sensitivity, elevated propensity to cancers of the skin and other exposed tissues, and ∼20% of the patients present with neurological abnormalities.

Attempts to decipher the relationships between XPD mutant genotypes and phenotypes have frustrated researchers, due to the apparent disparity between the contrasting mild or severe symptoms resulting from neighboring mutations, and in some cases from the same mutation in different individuals; the large proportion of XPD compound heterozygotes adds to the difficulties.

Although the human XPD protein remains refractive to crystallization, the crystal structures of XPD proteins from the archea Sulfolobus acidocaldarius, Sulfolobus tokodaii, and Thermoplasma acidophilum have been resolved [Fan et al.,2008; Liu et al.,2008; Wolski et al.,2008]. These structures reveal, as expected for a helicase, that XPD has two motor domains separated by an ATP-binding cleft; two additional domains, a FeS cluster and an Arch domain were revealed as well. Solving the crystal structures of the complexes formed with human wild type and mutant XPD proteins bound to DNA and to other TFIIH subunits will provide important insights into the structure-function correlations of this multifunctional protein, and help to understand how one defective protein can lead to five distinctly different diseases.

We describe here an 18-year-old individual with mild sun sensitivity, but no neurological abnormalities or tumors, who carries the p.R683Q mutation in one XPD allele and the novel p.R616Q mutation in the other allele. We also describe four patients of Jewish Iraqi origin, who are homozygous for the p.R683Q mutation. These patients are mildly sun-sensitive, and have low frequency and late onset of skin tumors and neurological decline. We have determined that cells from three of these individuals are UV-sensitive and defective in repair of UV-induced photoproducts. These cases provide insights into molecular bases of the phenotype, and illustrate the need for accurate diagnoses of patients presenting with heightened sun sensitivity, so that preventive measures and clinical follow-up can be established.

METHODS

Human Subjects

The Institutional Review Board of the Western Galilee Hospital and the Israeli Ministry of Health approved the study. All subjects (or the parents of XP32NH) signed informed consents for participation in this study.

Cells and Culture

Fibroblasts were obtained from skin biopsies of unaffected individuals (29NH, 31NH, 82NH, and 83NH), an XP-G-mutated patient with XP and CS (XPCS142NH), and a subject (XP32NH) in Naharia, Israel, by T. F.-Z.; and from the XP-D patients homozygous for the p.R683Q mutation (XP62TA, XP32TA, and XP29TA) and an unaffected control (93TA) by H. S. in Tel Aviv, Israel. The cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 4.5% glucose, 15% fetal bovine serum, 1% antibiotic-antimycotic solution and 2 mM glutamine (Invitrogen, Carlsbad, CA) at 37°C in a 5% CO2 humidified atmosphere.

Genomic DNA Isolation

Ten milliliters of blood were collected from the study participants. Genomic DNA was extracted from blood using a standard salting out method [Miller et al.,1988] and from skin fibroblasts by organic extraction [Sambrook et al.,1989].

RNA and cDNA Extraction

Total RNA was extracted from skin fibroblasts using the GenElute Mammalian Total RNA Miniprep Kit (Sigma-Aldrich, St. Louis, MO) according to manufacturer instructions. RNA samples were stored at −80°C until used. RNA (1 μl) was reverse-transcribed to cDNA using the ThermoScript RT-PCR System (Invitrogen, Carlsbad, CA) using an Oligo (dT) primer according to manufacturer instructions. cDNA was stored at −20°C.

Sequencing

The XPD gene from all four patients in this study was sequenced using cDNA and PCR with primers covering all 22 exons. Six fragments encompassing the entire cDNA were amplified using primers 1 through 12 shown in Supporting Information Table SI. PCR conditions were as follows: denaturation at 95°C for 5 min, 35 cycles at 94°C for 15′ sec, 55°C for 30′ sec, and 72°C for 10′ sec, and elongation at 72°C for 5 sec. Amplicons were purified using the MinElute purification kit (Qiagen, Valencia, CA) and a second round of PCR was carried out with the same primers for 25 cycles at 96°C for 10 sec, at 50°C for 5 sec, and at 60°C for 4 min, using the Big Dye Terminator Kit (Applied Biosystems, Foster City, CA) following manufacturer's instructions. PCR products were purified using the DyeEx 2 spin kit (Qiagen) and sequenced directly. Sequence analysis was performed using the ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Following the identification of the two XPD mutations in the heterozygous proband, the DNA from her parents was sequenced using primers 13 and 14 (Supporting Information Table SI). The numerical identity of the nucleotides was assigned according to the sequence of the cDNA and flanking segments determined by Weber et al. [1990].

Genetic Complementation Assay

XP62TA and wild type control fibroblasts were cotransfected with the plasmid pCMVluc luciferase reporter vector (Promega), and with one of a series of plasmids (a generous gift from L. Grossman, lately of Johns Hopkins) that carry the cDNAs of each of the XP repair genes, from XPA to XPG. The cells were seeded in 6-well plates at 2 × 105 cells per well the day prior to transfection. After washing with PBS, the cells were incubated with 0.5 ml of a solution containing 1 μg pCMVluc, undamaged or irradiated with 700 J/m2 UV 254 nm, 25 μg of plasmid carrying XP cDNA where indicated, 5% DEAE-Dextran, 0.7 mM CaCl2, and 0.5 MgCl2 in PBS for 1 hr at 37°C. The cells were washed with PBS and incubated with culture medium for 40–48 hr. Luciferase activity was measured with a kit (Promega) using a luminometer.

Carrier Detection Assay

A 295 bp fragment of genomic DNA containing the suspected mutation was amplified using the primers XPD-ex22-F: 5′-GTTTCCCGTTCATTTCCCAG-3′, and XPD-ex22-R: 5′-TGGAGGAGAAGCTCAGCCTG-3′. PCR conditions were: denaturation at 94°C for 5 min; 35 cycles at 94°C for 15 sec, at 55°C for 30 sec and at 72°C for 10 sec; and incubation at 72°C for 5 min. The familial mutation abolishes an AciI restriction site [Taylor et al.,1997]. Amplified fragments of DNA containing the mutation were digested with AciI (New England Biolabs, Beverly, MA) and electrophoresed on 8% acrylamide gels.

MTT Assay for UV Sensitivity

Cells were plated at a density of 5,000 per well in 12-well plates and incubated overnight. The cells were rinsed twice with phosphate buffered saline (PBS) and irradiated with a germicidal UV lamp emitting mostly at 254 nm, then reincubated with fresh medium for three days. The medium was removed, the cells were rinsed once with PBS, and incubated with 200 ml/well of medium with no phenol red containing 10% fetal bovine serum and 0.5 mg/ml MTT (3-[4, 5-dimethyl-2-yl]-2, 5-diphenyltetrazolium bromide, Sigma-Aldrich) for four hours. The medium was gently removed, and 400 μl DMSO was added to each well; the plate was placed on an orbital shaker for five min and the intensity of the color was measured by optical density at 540 nm in a microplate reader (Bio-Rad, Hercules, CA). Values from wells containing reagents but no cells were subtracted from all measurements; values from unirradiated cells were taken as 100% survival.

ELISA for Detection of Cyclobutane Pyrimidine Dimers (CPD)

Cells were plated on three 10-cm dishes for each cell line at a density of 1–2 × 106 cells/dish and incubated overnight. Cells were irradiated with 20 J/m2 of UV and harvested immediately (0 time) or incubated with medium for 3 days before harvest. Unirradiated controls were harvested at the same time as the “0 time” cells. The cells were detached with trypsine, centrifuged, resuspended with 0.2 ml cold PBS, and the DNA was purified with a genomic DNA extraction kit (Invitrogen). The DNA was sheared by passing it through a 28G needle five times, and the concentration was determined with a NanoDrop apparatus (Thermo Scientific, Waltham, MA). ELISA was carried out as described [Mori et al.,1991; Spivak and Hanawalt,2006; Spivak et al.,2002] using TDM-2 monoclonal anti-CPD antibody, a kind gift of Dr. Toshio Mori, diluted 1:5,000 in PBS. Other reagents were biotin-F(ab')2 fragment of anti-mouse IgG (H+L) (Invitrogen), peroxidase-streptavidin (Invitrogen/Zymed), and o-phenylene diamine (OPD tablets, Sigma-Aldrich). Antibody-specific signals were normalized to the respective “0 hours” value for each cell line, after subtraction of values obtained for unirradiated cells. The two-way ANOVA test was used to determine the statistical significance of results.

Recovery of RNA Synthesis

The assay was performed as described [Slor et al.,2000] with minor modifications. Briefly, cells were incubated for 48 hr in the presence of 0.01 Ci/ml 14C-thymidine (Nuclear Center, Israel) to prelabel cellular DNA. Duplicate sets of dishes were UV-irradiated (8 J/m2) or not, and the cells were pulse-labeled for 60 min with 3H-uridine (5 Ci/ml; Amersham-GE Healthcare, Piscataway, NJ) either immediately after UV irradiation or after 24 hr of incubation. DNA and RNA were precipitated in ice-cold trichloroacetic acid and collected on nitrocellulose membrane filters (Millipore, Billerica, MA); radioactivity was determined by scintillation counting. All RNA synthesis data were normalized to DNA concentrations using the ratio of 3H/14C. Recovery of RNA synthesis was calculated from the ratio of RNA synthesis in UV-irradiated cells to RNA synthesis in unirradiated cells.

Real time PCR

Fibroblasts were harvested from one near-confluent 25 cm2 flask for each cell line and RNA was extracted using the RNeasy mini kit (Qiagen) according to the manufacturer's protocol. One μg RNA was taken for cDNA synthesis using the Superscript Firststrand synthesis kit for real-time PCR (Invitrogen) according to the manufacturer's protocol.

Real time PCR was performed using the Quantifast Sybr Green PCR kit (Qiagen), according to the manufacturer's protocol, and ran in a 7300 Real-Time PCR System (Applied Biosystems). XPD primers were designed using Vector NTI software and purchased from Sigma. XPD primer sequences: forward: GTTTCCCGTTCATTTCCCAG, reverse: TGGAGGAGAAGCTCAGCCTG. GAPDH primers were purchased from QuintiTect Primer assay (Qiagen). XPD mRNA levels were corrected to GAPDH levels and relative levels were calculated in relation to XPD mRNA levels in the 82NH wild type control. The results shown are the averages and standard deviations from two experiments.

Protein Modeling

The molecular graphics were prepared using UCSF Chimera software. The protein model was based on the crystal structure solved for Sulfolobus acidocaldarius (PDB entry 3CRV) [Fan et al.,2008].

RESULTS

Clinical Descriptions

The subject XP32NH, a 17-year-old high school student, was referred for genetic evaluation of sun sensitivity. Her parents are Jewish of mixed ethnic background from Yemen and Egypt (father) and from Iraq (mother), and are not consanguineous. They and their two other healthy children have no significant family history of sun sensitivity, skin tumors, or other medical problems.

The patient was unusually sensitive to sun exposure since birth, with episodes of severe sunburn, resulting in erythema, facial edema and blistering on the back and shoulders. Tests for antinuclear antibodies, systemic lupus erythematosus, and subacute lupus erythematosus were negative. She was treated with antihistamines occasionally before sun exposure, and she always used sunscreens.

Upon recent examination at age 18, her facial skin, including earlobes and lips, was minimally erythematous. Lower lip was minimally eroded. Her cheeks were covered with several brownish flat macules, a few mm in diameter (Fig. 1a). Some lentigines were also present on her upper back and chest. Skin examination also revealed a Becker's melanosis on her left buttock (Fig. 1b). No malignant or premalignant tumors of the skin were seen. The rest of the physical, audiologic, ophthalmologic, and neurologic examinations were normal (Table I).

Figure 1.

Photographs illustrating mild skin pigmentation in XP-D patients. A, B: In addition to freckling on the face, the XP32NH subject presents with a café au lait pigmented area on the mid-upper-back, and a larger, light-brown pigmented area with hirsutism (Becker's melanosis) on the left buttock, indicated by arrows. The XP62TA (C) and XP32TA (D) siblings and their cousin XP29TA (E) exhibit mild hyperpigmentation in sun-exposed skin. Facial and body hair turned white at age 45 in XP29TA.

Table I. Phenotypes of XPD Patients in This Study
 Patient I – XP62TAPatient II – XP32NHXP32TAXP29TAXP30TAa
  • Explanation of symbols: −, not present; +, mild; ++, moderate; +++, severe. (1) perforated eardrum.

  • a

    This patient was not seen by us. Data obtained by phone interview with the patient.

Demographics     
Age at last observation54y18y56y50y50y
Age at onset of symptomsInfantileChildhoodInfantileChildhoodChildhood
SexFemaleFemaleFemaleMaleMale
Ancestral groupIraqi JewsIraqi/Sephardic JewsIraqi JewsIraqi JewsIraqi Jews
Genetic mutationXPD, R683Q/R683QXPD, R683Q/R616HXPD, R683Q/R683QXPD, R683Q/R683QXPD, R683Q/R683Q
Clinical ocular symptoms     
Photophobia+++
Conjunctivitis, dry eye
Impaired vision+
Photosensitivity++
Cataract++
Myopia+
Retinal neovascularizationN/A
Neurologic phenotype     
Cognitive decline+/−++N/A
Loss of tendon Reflexes+++N/A
Loss of tonusN/A
Hearing loss+ (1)
Ataxia++
Responses to sun exposure     
Sunburn+++++++++++
Irritation+++++++++++
Blisters++
Freckles+++++++++++
Skin peeling++
Hyperpigmentation++++
Hypopigmentation+
Dry skin+++
Cancer     
Skin cancerBCCBCC*2*4 skin tumors removed. Pathological results N/A
Benign skin neoplasm, other organs 

XP62TA is a 54-year old woman presenting with freckling on arms and neck (Fig. 1c), mild sun sensitivity, loss of tendon reflexes, and incipient cognitive decline. She had one basal cell carcinoma (BCC) removed from her face at age 53. Her affected sister XP32TA (Fig. 1d) had a similar presentation except for normal cognition and absence of tumors, but an affected male cousin XP29TA (Fig. 1e) exhibited signs of premature aging, with white hair and beard at age 45 (this feature has not been otherwise reported in this family), moderate but progressive cognitive decline, and ataxia (unsteady walk). This patient had two BCCs removed from his upper lip at age 49. Another affected male, XP30TA, brother of XP29TA, presents with photophobia, photosensitivity, impaired vision, ataxia, hyperpigmentation, and he had four skin tumors removed. This individual was not seen, and he did not wish to be photographed; the information was obtained through a telephone interview. Table I summarizes the clinical data from the five subjects in this study.

Response of XP32NH and XP62TA Cells to UV-Irradiation

Fibroblasts from XP32NH and XP62TA were clearly more sensitive to irradiation with UV at 254 nm than were the wild type cells (Fig. 2a). Resumption of transcription in cells treated with DNA damaging agents such as UV or chemical carcinogens depends on TCR of the lesions induced by the agent. To examine the ability of XP32NH cells to carry out TCR, we measured the incorporation of radioactively labeled uridine into nascent transcripts in cells immediately after UV-irradiation, and in cells that had been allowed to recover for 24 hr. As shown in Figure 2b, transcription recovered in the wild type cells but not in XP32NH cells or in cells from a patient mutated in the XPG gene with combined XP/CS phenotype.

Figure 2.

Responses of XP32NH and XP62TA cells to UV irradiation. A: The MTT assay was used to assess survival of wild type 29NH (squares), XP-D compound heterozygous XP32NH (circles) and XP-D homozygous XP62TA (triangles) cells after UV irradiation. Values from wells containing reagents but no cells were subtracted from all measurements; values from unirradiated cells were taken as 100% survival. B: Recovery of RNA synthesis after UV (8 J/m2). The 3H-uridine incorporated into nascent RNA was normalized to the 14C-thymidine-labeled DNA for each culture, and expressed as percent of the 3H/14C ratio in unirradiated cells. White: “0 hr”; black: “24 hr”. Cells were wild Type 31NH, XP/CS XPCS142NH, and XP-D compound heterozygous XP32NH. Averages ± SD of two experiments are shown in panels A and B.

The very mild symptoms of the XP32NH patient suggested the possibility of classifying her as either XP or UV-sensitive syndrome (UVSS). Cells from UVSS individuals are characterized by UV-sensitivity and lack of TCR; however, they exhibit normal genomic repair of UV-induced photoproducts [Spivak and Hanawalt,2006]. To determine whether the XP32NH patient should be diagnosed as UVSS or as XP, we investigated the ability of her cells and of cells obtained from the XP62TA homozygous patient to repair cyclobutane pyrimidine dimers (CPD) in their genomes, using ELISA and a monoclonal anti-CPD antibody. Wild type NH29 cells removed 89.6 ± 3.2 CPD within 72 hr of irradiation with 20 J/m2, while the mutants XP32NH and XP62TA removed 40.8 ± 17.6 and 23.3 ± 19.1 CPD within the same period, respectively.

Determination of the Genetic Defect

The symptoms in patients from the Iraqi Jewish family pointed to a mild XP phenotype. XP62TA fibroblasts were tested using a host cell reactivation assay combined with genetic complementation. Cells were co-transfected with UV-irradiated pCMVluc plasmids carrying the luciferase gene, and with one of a series of plasmids carrying cDNA for each of the seven XP complementation groups, from XPA to XPG. Only wild type 93TA cells and mutant cells expressing the XPD cDNA were able to repair the UV-damaged luciferase gene, and thus express luciferase at 80% and 72%, respectively, of the values obtained with undamaged reporter plasmids. In contrast, cells expressing XPA, XPB, XPC, XPE, XPF, or XPG exhibited 1-2% luciferase activity.

Sequencing analyses determined that all the patients in this family were homozygous for a c.2126G>A mutation resulting in the p.R683Q amino acid substitution. A pedigree of this family is shown in Figure 3.

Figure 3.

Pedigree of a family with homozygous XPD mutations. Circles depict females, squares depict males, diamonds indicate that sex is unknown. Horizontal bars indicate marriages, double horizontal bars show consanguineous marriages, and diagonal double bars indicate divorce. Affected subjects are shown in black. The number 5 indicates five male offspring.

The mild sun sensitivity and lack of neurological presentation exhibited by the XP32NH patient were consistent with mild XP or with UVSS, as mentioned above. UVSS can be caused by mutations in three genes: CSA [Nardo et al.,2009], CSB [Horibata et al.,2004], or KIAA1530 [Nakazawa et al.,2012; Schwertman et al.,2012; Zhang et al.,2012]. However, given the Iraqi Jewish ancestry of the subject's mother, a mutation at position c.2126 in XPD was suspected.

Sequencing analysis of the XPD gene revealed that the patient carries two different mutations: the c.2126G>A mentioned above, inherited from her mother, and the novel c.1925G>A inherited from her father, which result in the amino acid changes pR683Q and pR616Q respectively (Fig. 4). DNA amplification by PCR followed by restriction enzyme analysis was used to verify the c.2126G>A sequence alteration, which eliminates an AciI restriction site, and to allow accurate and rapid testing of family members (not shown).

Figure 4.

Analysis of mutations in the XPD gene in the subject and parents. The patient XP32NH carries the maternal c.G2126A and paternal c.G1925A mutations, which result in the p.R616Q and p.R683Q amino acid substitutions, respectively. Black arrows, wild type base; red arrows, mutated base.

The phenotype of XP patients can be caused not only by abnormalities or absence of the respective protein, but also by significantly lower protein levels. We measured the levels of XPD mRNA in cells from two normal control individuals and from the four XPD subjects for whom we had cells available. The data, shown in Table II, indicates that although the values for XPD mRNA vary from 48–153% of that found in one of the normal cells, the differences are not sufficient to account for the clinical presentations of the patients.

Table II. Levels of XPD mRNA in Cells From Normal and Affected Subjects
SubjectGenotypeRelative mRNAStandard error
  1. Data are the averages and standard errors from two experiments.

82NHXPD +/+(100)11.1
83NHXPD +/+153.30
XP32NHXPD −/− compound heterozygous48.222.1
XP62TAXPD −/− homozygous57.45.1
XP32TAXPD −/− homozygous89.00.8
XP29TAXPD −/− homozygous79.26.6

DISCUSSION

We describe here an 18-year-old sun-sensitive individual with no manifestations other than occasional erythema after exposure to sunlight and mild lentiginosis. Cells from this patient exhibit the responses to UV irradiation that are characteristic for the XP–A, -B, -D, -E, -F, and –G complementation groups: reduced cell survival, defective repair of UV-induced photoproducts in the genome overall, and no recovery of RNA synthesis after UV exposure indicating lack of transcription-coupled repair. The principal photoproducts induced by UV at 254 nm are CPDs and 6,4-pyrimidine pyrimidones (6,4-PP). Although removal of 6,4-PP was not examined, deficient repair of this lesion in cells from the patient and from an individual with combined XP/CS is implied by the absolute lack of recovery of RNA synthesis after UV. The genetic analysis revealed that the patient is a compound heterozygote, with two different mutations in XPD. Her mother is heterozygous for the G to A transition at nucleotide 2126 in the cDNA, and her father has a novel G to A transition at nucleotide 1925 in one allele; XP32NH carries both mutated alleles (Fig. 4). No other alterations in the patient's XPD gene were found.

In addition, we describe four patients from one family who are homozygous for the p.R683W mutation in XPD. These patients, two sets of siblings who are first cousins, present with mild sun sensitivity, low frequency and late onset of tumors and various degrees of neurological manifestations, from absent to moderate.

Mutations within codon 683 are the most frequently found in XPD patients, among whom the p.R683W mutation is the most prevalent [Taylor et al.,1997; Kobayashi et al.,2002; Boyle et al.,2008; Emmert et al.,2009]. Interestingly, to the best of our knowledge no other DNA repair-deficient syndromes have been associated with mutations at this site. The wild type arginine (R) at this position participates in interactions with TFIIH, and also plays an important role in DNA binding, particularly at double-strand/single-strand junctions. Replacing this positively charged residue with tryptophan (W) or glutamine (Q) may severely interfere with DNA binding and thereby lead to the disease phenotype [Wolski et al.,2008]. Indeed, in vitro assays with purified wild type and mutant proteins confirmed that a p.R683W-mutated protein failed to interact with p44 within TFIIH, with consequent instability of the TFIIH complex and lack of p44-dependent stimulation of the helicase activity of XPD; however, the basal transcription activity was normal [Dubaele et al.,2003]. The resolution of the crystal structure of Sulfolobus acidocaldarius XPD (SaXPD) protein by Fan et al. predicts that R531 (R683 in humans) is a DNA binding site within the helicase domain. The R683W-equivalent mutation resulted in greatly reduced ATPase and helicase activities of SaXPD [Fan et al.,2008]. We have used the structure described by Fan and coworkers as a basis to indicate the positions of the amino acids implicated in the mutations described in this study (Fig. 5).

Figure 5.

XPD crystal structure and location of the mutations. A: XPD fold and domains, based on the structure of XPD from Sulfolobus acidocaldarius (PDB entry 3CRV) and the annotation by Fan et al. [Cell, 2008]. Helicase domain HD1 (cyan), HD2 (green), 4FeS (orange) and Arch (purple) domains are indicated. Mutation sites R616 and R683 are shown in red. B: Zoom-in on R616, showing this amino acid protruding into the solvent. C: Zoom-in on R683, showing that it sits by the bound citrate, isopropyl alcohol, and glycerol (white) from the crystallization buffer in apparent mimicry with DNA components.

The mutation p.R683Q has been reported for three homozygous individuals, XP9MA, and the siblings XP15-16PV [Taylor et al.,1997] and references therein). These three patients exhibited sun sensitivity; however only XP9MA presented with several cancers, defective growth and ophthalmic pathology. Mamada et al. described a fourth patient, XP77TO, with mild sun sensitivity, skin cancers at ages 44 and 65, and sensorineural deafness in his 60s [Mamada et al.,1988]; this individual carries the p.R683Q mutation in one allele and the correct base at that position in the other allele; since only the mutated base was detected in the cDNA, a null mutation in the second allele was suspected but not identified. This individual is thus functionally hemizygous [Kobayashi et al.,2002]. XP30BR is another compound heterozygous patient with sun sensitivity but, at age 16, no neurological defects; this patient carries p.R683Q and p.Fs609 mutations [Offman et al.,2008; Viprakasit et al.,2001], thus might also be considered as a p.R683Q hemizygous. No pigmentary abnormalities or cancers have been detected to date, but the patient has been strictly protected from sunlight since 1-year old (A. Lehmann, personal communication). XP9MA appears to be the exception among patients with p.R683Q mutations cited in the literature, who generally exhibit mild symptoms. Phenotypic variations can also be found among patients with the p.R683W mutation [Taylor et al.,1997]. Our observations in patients XP62TA, XP32TA, and XP29TA homozygous for p.R683Q are consistent with those of the cases above, and interestingly display variations in their symptomatology even though they are closely related. This suggests that the genetic or epigenetic background of each individual with mutations in XPD can strongly influence the range and severity of the phenotypic manifestations.

Codon 616 normally codes for arginine (R). No homozygous mutations in humans have been reported for this codon. To investigate the effect of various homologous XPD mutations, Taylor et al. turned to the yeast Schizosacharomyces pombe, whose rad15 gene has a high degree of homology with human XPD. Rad15 is an essential gene, thus rescue from lethality in Sch. pomberad15-null cells can be used to test the function of cloned rad15 mutants. When rad15-carrying p.R615P (equivalent to human p.R616P) was expressed, no rescue was observed, whereas expression of the p.R683W-mutated protein resulted in viable cells [Taylor et al.,1997]. The equivalent to the human residue 616 in S. tokodaii is located on the surface of the p44 interaction domain [Liu et al.,2008]; mutations in this codon can result in loss of catalytic function and/or destabilization of the TFIIH complex. Indeed, Dubaele et al. have shown that W or P substitutions at position 616 resulted in abolished basal transcription activity in vitro [Dubaele et al.,2003].

Taken together, these results support the hypothesis that the R616Q substitution in XP32NH codes for a null protein, and that the patient's phenotype is then a consequence of p.R683Q as a functional hemizygous, a situation similar to that of XP77TO and XP30BR described above. Consistent with our hypothesis, patients with p.R616W or p.R616P mutations have been diagnosed with XP, TTD, or COFS; the phenotypes of these individuals are determined by the mutation affecting the second XPD allele in each case [Taylor et al.,1997; Broughton et al.,2001; Graham et al.,2001; Lehmann,2001]. However, alternative explanations for the patient's phenotype, such as a dominant negative effect cannot yet be ruled out; further studies are needed to determine the functional status of a p.R616Q-mutated XPD protein. No dominant mutations in XPD have been found to date among DNA repair-deficient human subjects, whereas certain mutations in rad3, the XPD homolog in the yeast Sacharomyces cerevisiae, are dominant; these mutants are not UV-sensitive and proficiently remove UV-induced photoproducts, but the TFIIH complex is unable to complete the reaction, leading to DNA strand breaks and requiring homologous recombination to resolve consequent replication fork obstructions [Moriel-Carretero and Aguilera,2010].

Although two of the patients described here exhibit no signs of cancerous lesions to date, the history of patients with the p.R683Q mutation suggests that they might develop malignancies as a consequence of severe sunburn episodes. Strict adherence to protective measures and periodic follow up are necessary to avoid new cancer-promoting events and to detect tumors at an early stage. This study adds important information to the growing library of mutations recorded for XPD, and it provides a model for the work up and follow-up of sun sensitive patients.

Acknowledgements

The authors thank the subjects for numerous examinations and interviews, and for providing biological samples. They are indebted to the late L. Grossman for XP cDNA plasmids, to A. Lehmann, K. Tanaka, and M. Stefanini for sharing unpublished observations, and to K. Kraemer and the late D. Bush for advice. TF-Z was the recipient of a Feldman Family Foundation award for visiting professors at Stanford University.

Note Added in Proof

Dr. Falik-Zaccai led all aspects of the research and co-wrote the manuscript, Reut Erel-Segal performed RNA synthesis experiments and identified the causative mutations, Liran Horev ascertained patients and performed dermatology examinations, Ora Bitterman-Deutsch performed dermatology examinations and skin biopsies, and photographed the patients, Sivan Koka recruited the patients and prepared Table I, Sara Chaim interviewed patients and provided genetic counseling, Zohar Keren performed tissue cultures, RNA synthesis experiments and molecular analyses, Limor Kalfon performed RNA synthesis and cell survival experiments, Bella Gross evaluated the neurological status of patients, Zvi Segal performed ophthalmologic examinations, Shlomi Orgal did recovery of RNA synthesis experiments, Yishay Shoval performed real time PCR experiments and drew Figure 5, Hanoch Slor provided cells and clinical data from patients, Graciela Spivak performed experiments and data analyses and co-wrote the manuscript, Philip C. Hanawalt oversaw research and contributed to writing the manuscript.

Ancillary