SEARCH

SEARCH BY CITATION

Keywords:

  • Dexamethasone;
  • Glucocorticoid;
  • Glucocorticoid receptor;
  • Fathead minnow

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

Synthetic glucocorticoids are pharmaceutical compounds prescribed in human and veterinary medicine as anti-inflammatory agents and have the potential to contaminate natural watersheds via inputs from wastewater treatment facilities and confined animal-feeding operations. Despite this, few studies have examined the effects of this class of chemicals on aquatic vertebrates. To generate data to assess potential risk to the aquatic environment, we used fathead minnow 21-d reproduction and 29-d embryo–larvae assays to determine reproductive toxicity and early-life-stage effects of dexamethasone. Exposure to 500 µg dexamethasone/L in the 21-d test caused reductions in fathead minnow fecundity and female plasma estradiol concentrations and increased the occurrence of abnormally hatched fry. Female fish exposed to 500 µg dexamethasone/L also displayed a significant increase in plasma vitellogenin protein levels, possibly because of decreased spawning. A decrease in vitellogenin messenger ribonucleic acid (mRNA) expression in liver tissue from females exposed to the high dexamethasone concentration lends support to this hypothesis. Histological results indicate that a 29-d embryo–larval exposure to 500 µg dexamethasone/L caused a significant increase in deformed gill opercula. Fry exposed to 500 µg dexamethasone/L for 29 d also exhibited a significant reduction in weight and length compared with control fry. Taken together, these results indicate that nonlethal concentrations of a model glucocorticoid receptor agonist can impair fish reproduction, growth, and development. Environ. Toxicol. Chem. 2012;31:611–622. © 2011 SETAC


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

Dexamethasone is a synthetic glucocorticoid that mimics the effects of the natural steroid cortisol. This pharmaceutical is an anti-inflammatory agent commonly prescribed in human and veterinary medicine. It has been estimated that approximately 27,000 human prescriptions containing dexamethasone as the active pharmaceutical ingredient were dispensed in the United States in 2004 1. With the abundance of dexamethasone and similar synthetic corticosteroids being produced and consumed, the potential exists for these drugs to enter the environment and cause adverse effects in nontarget species. In one study, assessment of water samples using a CALUX reporter gene bioassay for glucocorticoid-like activity identified levels ranging from 0.39 to 1.3 ng dexamethasone Eq/L in surface water and 11 to 243 ng dexamethasone Eq/L in industry, hospital, and municipal sewage treatment plant effluents 2. Recently, dexamethasone was detected in river water collected downstream from a French pharmaceutical factory at a concentration of approximately 10 µg/L 3. Additionally, studies that detect pharmaceuticals in surface waters, as well as drinking water, at concentrations of parts per trillion to parts per billion 4–7 are mounting, making these chemical pollutants a concern to environmental researchers and the public alike.

In human and veterinary patients, dexamethasone is known to be a glucocorticoid receptor agonist that regulates several transcription factors, including activator protein-1, nuclear factor-AT, and nuclear factor-κB, leading to the activation and repression of key genes involved in the inflammatory response, eventually culminating to its therapeutic effect as an anti-inflammatory, immunosuppressive drug 8–10. Comparatively little is known concerning the effects of the drug in nontarget species. Tests to measure the acute and chronic toxicity of dexamethasone have been conducted on a rotifer, three crustaceans, and an algal species, examining the effects of not only the parent compound but its photochemical derivatives. It was determined that, for acute tests with dexamethasone and its photoderivatives, median effective concentration (EC50) values for Daphnia magna and median lethal concentration (LC50) values for Thamnocephalus platyurus and Brachionus calyciflorus were greater than 10 mg/L, concentrations unlikely to be found in surface waters 11. In chronic tests, dexamethasone inhibited Ceriodaphnia dubia population growth by 50% at 0.05 mg/L but caused no effect on Pseudokircheneriella subcapitata at 100 mg/L 11. Therefore, evidence from existing studies indicates minimal environmental risk of dexamethasone to nonvertebrate species.

Various fish species also have been exposed to dexamethasone experimentally. However, in general, the intent of these studies was not to examine specifically the effects of dexamethasone as an aquatic contaminant but rather to use the drug as a glucocorticoid agonist to mimic cortisol or the stress response to examine basic physiological questions 12–14. Stress responses in teleost fish have been studied rather extensively. Cortisol is the major corticosteroid produced by the interrenal tissue and is central to the stress response. Because dexamethasone is a synthetic version of this steroid, hypotheses on possible adverse effects of the drug can be developed based on stress–response studies. Specifically, stress and elevated plasma cortisol concentrations (ranging from 140 ng/ml in a carp study to 265 ng/ml in goldfish) have been linked to a number of reproductive anomalies in several fish species, including rainbow trout (Oncorhynchus mykiss), tilapia (Oreochromis niloticus and Tilapia zillii), carp (Cyprinus carpio L.), and goldfish (Carassius auratus) 15–18. An extensive review by Milla et al. 19 examined the effects of corticosteroids on both female and male teleost fish reproduction, indicating that females undergoing stress have reduced vitellogenin levels and estrogen production and exhibit unsuccessful spawning behavior, delayed oocyte maturation and ovulation, reduced egg size, and poor progeny quality. For males, an elevation in cortisol caused decreased 11-ketotestosterone production, caused delayed testicular development, and impeded spermatogenesis, resulting in smaller gonads and poor sperm quality 19, 20. Therefore, information derived from studies examining the effects of cortisol and other stressors led to the hypothesis that synthetic glucocorticoids, such as dexamethasone, may have detrimental effects on teleost fish reproduction. Furthermore, it has been demonstrated in trout that activation of the glucocorticoid receptor by cortisol interferes with the ability of estradiol to stimulate transcription from the estrogen receptor, leading to decreased plasma vitellogenin levels 21. Finally, studies have shown that glucocorticoid receptors and estrogen receptors are coexpressed in fish brain and pituitary 19, 21. Taken together, this information indicates a potential for interactions between the hypothalamus–pituitary–interrenal and the hypothalamus–pituitary–gonadal axes.

The objectives of the present studies were to examine the effects of dexamethasone in the context of an environmental contaminant on fathead minnow reproduction and early life stages, employing 21-d adult and 29-d embryo–larval exposures, to evaluate reproduction, growth, and development. Sex reversals have been reported for fish exhibiting elevated cortisol levels during key stages of sex differentiation 22, 23. Therefore, another goal was to employ a novel method for the determination of genotypic sex of the fathead minnow to evaluate potential sex reversal associated with dexamethasone exposure.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

Test material and organisms

Dexamethasone was obtained from Sigma Aldrich (D1756; ≥98% pure). Stock concentrations were prepared by the addition of dexamethasone powder to 1 L of UV-treated, filtered Lake Superior water; stirred for 1 h; sonicated in a water bath for 1 h; stirred overnight; and then diluted into 19 L of Lake Superior water in a glass carboy to the desired stock concentration. Adult male and female fathead minnows of reproductive age (5–6 months) were obtained from an on-site culture unit at the U.S. Environmental Protection Agency (U.S. EPA) Mid-Continent Ecology Division. Adult minnows used for the study displayed prominent secondary sex characteristics, that is, dorsal fat pads and tubercles on males and ovipositors on females. All exposures and laboratory practices using the fathead minnows were reviewed and approved by the Animal Care and Use Committee in accordance with the Animal Welfare Act and Interagency Research Animal Committee guidelines.

Exposure conditions

Continuous flow-through exposures were conducted by pumping appropriately diluted dexamethasone stock solutions to 20-L glass tanks containing 10 L water. The system was designed to deliver a flow of approximately 45 ml/min of Lake Superior water, without the use of carrier solvents. Temperature was maintained at 25 ± 1°C, with a photoperiod of 16:8 h light:dark. Fish were fed thawed adult brine shrimp twice per day to satiation.

Range-finding exposure

To determine exposure concentrations for the reproduction assay, a 4-d range-finding experiment was conducted with concentrations of 0 (control), 0.1, 1, 10, 100, and 1,000 µg dexamethasone/L. One tank containing eight fish (four males and four females) and four breeding substrates (ceramic tile) was assigned to each treatment. Food intake, spawning activity, and fish survival were observed daily. Concentrations of dexamethasone in the exposure tanks were measured on days 0, 2, 3, and 4 of the experiment. Water quality parameters assessed throughout the experiment were (mean ± SD) temperature 25 ± 0.6°C, dissolved oxygen 5.3 ± 0.9 mg/L, pH 7.4 ± 0.1, and flow rate 45.9 ± 2.4 ml/min. On the last day of the experiment, fish were anesthetized with buffered tricaine methanesulfonate (MS-222; Finquel; Argent), and plasma was collected for vitellogenin measurement and liver tissue for RNA extraction followed by quantitative real-time polymerase chain reaction (qRT-PCR) analysis.

Twenty-one-day reproduction study

The 21-d dexamethasone exposure followed a basic study design described previously 24. Briefly, two pairs of male and female fathead minnows, divided by a transparent, porous, plastic divider, were introduced to 20-L aquaria. Each side of the divided tank contained one breeding substrate. During a 14-d acclimation phase, fish were held in the experimental system receiving UV-treated, filtered Lake Superior (control) water, and fecundity of each pair was monitored daily. Dexamethasone exposure commenced using only pairs that had successfully spawned during the acclimation. Three concentrations of dexamethasone (0.1, 50, and 500 µg/L) and a control (Lake Superior water only) were delivered to six replicate tanks per treatment. Water quality and flows were assessed throughout the duration of the experiment (mean ± SD), including temperature 26 ± 0.3°C, dissolved oxygen 6.0 ± 0.5 mg/L, pH 7.5 ± 0.3, hardness 45.4 ± 2.8 mg/L as CaCO3, alkalinity 38.8 ± 2.7 mg/L as CaCO3, conductivity 94.4 ± 2.7 s/cm, and flow rate 44.1 ± 2.3 ml/min.

The total number of eggs spawned and number of fertile eggs produced by each mating pair were recorded daily. To determine hatching success, 50 eggs per spawn (when there were >50 fertile eggs) were collected and held in egg cups under flow-through conditions with Lake Superior water and observed over a 5-d period, which was sufficient time for 100% hatching of viable eggs.

After the 21-d exposure, the adult fish were anesthetized in buffered MS-222 and wet weights measured. Blood was collected from the caudal vasculature and centrifuged in heparinized microhematocrit tubes to separate the plasma, which was then stored at −80°C until extracted. Dissection and collection of liver, gonad, and anterior kidney followed. Care was taken between sample collections to eliminate RNase contamination by cleaning dissection tools and platforms with RNaseZap (Ambion). Total gonad weights were recorded prior to division into subsamples for determination of the gonadosomatic index. A 10-mg portion of each gonad was used for an ex vivo steroid production assay, and the remaining gonad was preserved for RNA extraction. As a measure of secondary sex characteristics, tubercle size and number were scored according to procedures outlined by Jensen et al. 25.

Twenty-nine-day embryo–larvae exposure and grow-out

Eggs were harvested from seven mating pairs of fathead minnows that had been bred to contain sex-linked genetic markers for sex determination 26. In total 100 to 400 eggs ranging from developmental stage 8 (32-celled blastodisc) to developmental stage 12 (early gastrula) 27 were collected from each spawning substrate and pooled. To verify fertilization and stage, 50 fertilized eggs from the pooled sample were evaluated microscopically and then divided into egg cups. Two egg cups, suspended by a metal rod, were maintained in 10-L tanks with three replicate tanks per treatment. Three dexamethasone concentrations (0.1, 50, and 500 µg/L) and a control (Lake Superior water only) were used. To prevent fungal contamination, eggs were gently agitated by rocking the suspended cups three times daily by hand. Fungally infected eggs were removed from egg cups and counted daily until all viable eggs had hatched. Newly hatched fry were released to the tank, and egg cups were removed after the eggs had all hatched. Tanks were inspected daily for fry mortality and cleaned two or three times per week throughout the exposure. Water quality and delivery characteristics were assessed throughout the duration of the dexamethasone exposure (mean ± SD): temperature 26 ± 0.6°C, dissolved oxygen 7.0 ± 0.3 mg/L, pH 7.7 ± 0.2, hardness 46.9 ± 2.0 mg/L as CaCO3, alkalinity 39.5 ± 0.7 mg/L as CaCO3, conductivity 91.8 ± 0.2 s/cm, and flow rate 45.1 ± 2.1 ml/min.

On day 29 of the dexamethasone exposure, 50 fry were randomly selected from each of the three replicate tanks per treatment and transferred to flow-through tanks containing Lake Superior (control) water only and grown to sexual maturity (approximately five months). Mortality was monitored daily, and fish were maintained on a brine shrimp diet. To prevent crowding as the fish grew, the fish in each tank were evenly divided into duplicate tanks eight weeks postdexamethasone exposure.

When the fathead minnows reached sexual maturity, displaying vivid secondary sex characteristics, they were divided into separate tanks by phenotypic sex to ensure that balanced sample sizes were obtained. In total, 12 males and 12 females randomly selected from each treatment group were sacrificed after being anesthetized with MS-222. Wet weights were measured, followed by collecting blood, liver, gonad, head, kidney, and tail clips. Phenotypic sex and tubercle scores were also recorded.

Opercula deformities became apparent three weeks postexposure. To assess the deformity further, six fish from the control tanks (two males and four females) and six fish (two males and four females) from the high dexamethasone concentration (500 µg/L) were selected for histological analysis, collecting those with the most severe operculum deformities based on gross examination.

The remaining 473 fish in the grow-out tanks were then anesthetized with MS-222, weight and length were measured, phenotypic sex was determined, operculum deformities were recorded, and tail fin clips were collected. Fin clips were used for determination of genotypic sex as described previously 26.

Steroid and vitellogenin measurements

Using an adaptation of McMaster et al. 28, as described by Ankley et al. 29, ex vivo production of testosterone from testis and ovary tissue and 17β-estradiol from ovary tissue were determined. A radioimmunoassay protocol described by Jensen et al. 25 was used to measure concentrations of testosterone and 17β-estradiol after a liquid:liquid extraction of either plasma or ex vivo culture media samples with diethyl ether. Measurements of the estrogen-inducible egg yolk precursor protein vitellogenin were determined from plasma samples using an enzyme-linked immunosorbent assay, following procedures described elsewhere 30, with the use of a fathead minnow polyclonal antibody and a purified fathead minnow vitellogenin standard.

Chemical analysis

The dexamethasone concentrations in the exposure tanks were measured with a high-performance liquid chromatography method with mass spectral detection. The liquid chromatography–mass spectrometry (1946 LC/MSD; Agilent Technologies) method consisted of injecting 50 µl tank water onto a Kinetex C18 column, 2.1 × 50 mm (Phenomenex) set at 25°C with an isocratic elution using a mobile phase of 60% methanol/0.1% formic acid at a flow rate of 200 µl/min. Dexamethasone was measured using the response of the positive polarity secondary ion masses of 393, 394, and 431 amu using an electrospray source. The liquid chromatography–mass spectrometry detection limit was 50 ng/L. No dexamethasone was detected in any control tank sample over the course of the experiment. Water samples were collected from each exposure tank and directly analyzed (0.1 µg dexamethasone/L treatment) or diluted in ultrapure water prior to analysis (50 µg dexamethasone/L and 500 µg dexamethasone/L treatments) over the course of the exposure period. To account for the difference between undiluted and diluted samples, all results were recovery corrected using the appropriate matrix recovery value. The average (± SE) dexamethasone recovery in spiked samples was 99% (± 2.7, n = 15) for the diluted matrix and 86% (± 3.0, n = 8) for the undiluted sample matrix.

Gene expression analysis

Quantitative real-time polymerase chain reaction was used to quantify the relative abundance of mRNA transcripts for genes involved in the hypothalamus–pituitary–gonadal axis, cholesterol synthesis, and oogenesis as well as those that could aid in elucidating a possible adverse outcome pathway for the actions of dexamethasone on fathead minnows. TRI reagent (Sigma) was used to extract total RNA from gonad and liver according to the manufacturer's protocol. A Nanodrop ND 1000 spectrophotometer (Nanodrop Technologies) was used to measure RNA concentrations. Further purity of the RNA samples was assessed based on optical densities at 260/280 nm and 260/230 nm. Total RNA samples were then diluted to 10 ng/µL in preparation for qRT-PCR analysis. Relative transcript abundance of vitellogenin mRNA 31, estrogen receptor 1 mRNA, glucocorticoid receptor mRNA 32, and 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMG-CoA reductase) mRNA expressed in liver tissue and aromatase (cyp19a1a) mRNA 33, annexin A1a mRNA, prostaglandin-endoperoxide synthase 1 mRNA, and prostaglandin-endoperoxide synthase 2 mRNA expressed in ovary tissue were determined using protocols previously described 34. Primers for most of the gene products have been described elsewhere 34; those for HMG-CoA reductase, annexin A1a, prostaglandin-endoperoxide synthase 1, and prostaglandin-endoperoxide synthase 2 genes (Table 1) were designed based on expressed sequence tags homologous to zebrafish (Danio rerio) nucleotide sequences using a methodology described previously 29. The qRT-PCR assays were performed using Power SYBR Green RNA-to-Ct 1-Step Kit (Applied Biosystems). Each 12-µl reaction contained 20 ng total RNA, 100 nM forward primer, and 100 nM reverse primer. The thermocycling program was set to 48°C for 30 min to allow for reverse transcription, followed by 95°C for 10 min and finally 40 cycles of 95°C for 15 s and 60°C for 60 s for PCR amplification. A standard curve was created for each gene of interest following a tenfold serial dilution ranging from 200 to 20,000,000 copies. The standard curve was used to interpolate values from the standard curve normalizing to the mass of total RNA in the reaction and expressed as copies of mRNA/ng total RNA for each sample.

Table 1. Nucleotide sequences used for developing gene-specific primers and primer sequencesa
Gene of interestZebrafish query sequencebFathead minnow sequence (EST)Percentage identityE valuePrimers
  • a

    HMG-CoA = 3-hydroxy-3-methyl-glutaryl-CoA reductase; anxa1a = annexin A1a; ptgs1 = prostaglandin-endoperoxide synthase 1; ptgs2a = prostaglandin-endoperoxide synthase 2.

  • b

    The zebrafish (Danio rerio) query sequence refers to the zebrafish mRNA sequence for the gene of interest that was queried in the National Center for Biotechnology Information (NCBI) database using the nucleotide Basic Local Alignment Search Tool (BLASTn) to search the fathead minnow (Pimephales promelas) expressed sequence tag (EST) database.

  • c

    Denotes forward primer sequence.

  • d

    Denotes reverse primer sequence.

HMG-CoA reductaseNM_1014292.1DT195263.1900.0acgatgcatggccgtcatc tgaacgaccacagtgctgaacd
anxa1aNM_181758.1DT314737.1870.0agatgccagggccttgtatgc cagcagcagtcaagcagttctcd
ptgs1NM_153656.1DT150866.1875e-169ttccaccatactttcgccaaac ttcgacttcagcccttcaatgd
ptgs2aNM_153657.1DT169792.1890.0ggtcccatttggtcgacagtb cctctgtggatcagggatgaac

Operculum and gill histopathology

Gross morphological images of the left and right operculum were taken for each of the 12 fish selected for histological examination. Bouin's fixative was then perfused through the mouth to fix gill structures, followed by immersion of the whole body into a fixative solution for 72 h. Postfixation trimming was performed by a transverse cut approximately 1 mm posterior to the operculum–gill cavity and another transverse cut posterior to the vent to remove the tail. Pectoral fins were removed and discarded. The head and body were placed into a tissue cassette for processing. Samples were washed twice with 70% ethanol saturated with lithium carbonate solution prior to decalcification by Surgipath Decalcifier II. Tissues were processed using a Sakura Tissue Tek VIP 1000 tissue processor (Sakura Finetek USA) and embedded in paraffin with the ventral surface of the fish facing downward. The heads of four control and four exposed fish selected from the 500 µg dexamethasone/L treatment group were sectioned. Blocks were trimmed until the gills were visible, taking sections at 200- or 300-micrometer intervals until reaching the lens of the eye, creating three or four slides per sample. Slides were then stained with hematoxylin and eosin.

Genotyping

For genotyping, DNA samples were collected from archived tail clips stored at −20°C. Muscle samples (∼1 mg) were cut from the tails and digested in a proteinase K solution (Sigma) modified from Truett 35. Each sample was digested at 50°C for 1 h in 50 µl digest buffer (50 mM KCl, 1.5 mM MgCl2, 0.1 mM calcium acetate, 11 mM Tris-HCl, pH 8.5, 0.01% gelatin, 0.45% Tween-20, 4% glycerol, 4 U proteinase K). Digestion samples were mildly vortexed halfway through the incubation. After digestion, samples were placed in a 95°C water bath for 15 min to inactivate proteinase K and then centrifuged at 3,000 g for 3 min, with supernatant used directly in genotyping PCRs.

Genotyping reactions were performed as previously described 26. Briefly, 10-µl reactions using the polymerase Paq 5000 (Stratagene) were performed with final concentrations of 50 µM of each dNTP (Sigma) and 0.5 µM of each primer (custom synthesized by Integrated DNA Technologies). Genotyping reactions contained 0.5 µl crude sample digest as a template. Thermocycler conditions for genotyping reactions consisted of an initial denature step at 95°C for 2 min followed by 25 cycles of 95°C denature for 20 s, 60°C anneal for 20 s, and 72°C extension for 30 s. A final 5-min extension step at 72°C completed each reaction. Genotyping products were visualized after separation with precast 3% agarose gels (Bio-Rad).

Statistical analysis

Parametric data from the 21-d reproduction study, including steroid and vitellogenin measurements, and from the qRT-PCR assays were analyzed by using general linear models analysis of variance with treatment and replicate as independent variables. When no significant replicate effect or treatment by replicate effect was identified from the analysis, the replicate was excluded as a variable, and a one-way analysis of variance was performed to assess differences across treatment groups. Duncan's multiple-comparisons test was used as a post hoc test to examine differences among all treatment groups. Nonparametric data were analyzed by using the Kruskall–Wallis test, followed by Dunn's post hoc analysis. When concentration values from radioimmunoassay data were below the detection limit, values of one-half the detection limit were used in the analysis. Differences were considered significant at p ≤ 0.05. The operculum data from the 29-d embryo–larvae exposure was analyzed using Fisher's exact t test to compare treatment groups.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

Range-finding experiment

No mortalities occurred during the 4-d dexamethasone range-finding exposure, although fish in the 1,000 µg dexamethasone/L treatment group were not consuming a majority of the brine shrimp fed to them. The food accumulation was thought to be indicative of possible toxicity, so concentrations near 1,000 µg dexamethasone/L were not included in the subsequent 21-d reproduction assay.

Fathead minnow 21-d reproduction assay

Measured dexamethasone concentrations were slightly below target (0.1, 50, and 500 µg/L) concentrations but were relatively stable throughout the 21-d exposure period (Table 2). Water samples for analytical measurements of chemical concentrations were collected on days 1, 3, 7, 10, 17, and 21 of the exposure, with the mean (SE; n = 36) dexamethasone concentration in the 0.1, 50, and 500 µg/L treatment groups at 0.08 (0.003), 43.4 (0.5), and 469 (9) µg/L, respectively. Dexamethasone was not detected in any of the control tanks.

Table 2. Water (µg/L) concentrations of dexamethasone during a 21-d reproduction and 29-d embryo–larvae fathead minnow test
Dexamethasone (target concentration)21-d reproduction test (day of exposure)29-d embryo–larvae test (day of exposure)
1a37101721Mean1357111418212628Mean
  • a

    Test day.

  • b

    ND = not detected; detection limit for water was 50 ng/L.

  • c

    Mean (SE) of determinations from six separate tanks.

  • d

    Mean (SE) of determinations from three separate tanks.

Control (0)NDb,cNDNDNDNDNDNDdNDNDNDNDNDNDNDNDND
0.1 µg/L0.08 (0.001)0.08 (0.001)0.08 (0.002)0.08 (0.002)0.08 (0.003)0.08 (0.003)0.08 (0.003)0.09 (0.002)0.08 (0.003)0.10 (0.002)0.11 (0.007)0.11 (0.001)0.11 (0.003)0.10 (0.003)0.10 (0.002)0.10 (0.002)0.12 (0.002)0.10 (0.004)
50 µg/L44.3 (0.3)44.1 (0.3)42.5 (0.3)42.2 (0.8)44.0 (0.2)42.7 (0.4)43.4 (0.5)43.1 (0.3)43.1 (0.3)45.1 (1.1)44.1 (0.4)40.5 (0.6)41.8 (0.5)40.2 (0.6)42.2 (0.9)42.8 (0.5)43.2 (0.6)42.7 (0.7)
500 µg/L488 (5)481 (7)473 (8)448 (6)439(4)465 (5)469 (9)395 (4)387 (2)423 (6)471 (12)404 (15)423 (9)430 (7)434 (16)430 (12)432 (10)424 (11)

Two female mortalities occurred in the 500 µg dexamethasone/L treatment group on days 14 and 15. Although these mortalities could have been dexamethasone induced, one female mortality also occurred in the control group on day 18.

Dexamethasone significantly modified endpoints related to fecundity. A significant decrease (∼50% reduction compared with control) in cumulative average number of eggs spawned per female occurred in the 500 µg/L treatment group (Fig. 1A). In parallel, the mean number of spawns per female decreased in a concentration-dependent manner (Fig. 1B). Fathead minnow females exposed to 50 µg dexamethasone/L had a larger number of eggs per spawn compared with those exposed to 500 µg dexamethasone/L (Fig. 1C). There was no significant effect on fertility (all >60%) or hatchling success (all >75%; Fig. 2). However, from the subset of 50 eggs per spawn that hatched, a significant increase in abnormal hatch was observed (Supplemental Data, Fig. S1) from embryos spawned in the 500 µg dexamethasone/L treatment (Fig. 2). Six abnormalities associated with the spine, body shape, heart, and yolk sac were identified as defined by Jezierska et al. 36 (Supplemental Data, Fig. S1).

thumbnail image

Figure 1. Effects of 21-d exposure to dexamethasone on fathead minnow cumulative egg production (A), spawns per female (B), and number of eggs per spawn (C). Spawns per female and eggs per spawn are represented as mean (± SE). Spawning pairs per treatment over the duration of the 21-d exposure (n = 10–12). Letters represent significant differences between treatments (p < 0.05).

Download figure to PowerPoint

thumbnail image

Figure 2. Effects of 21-d dexamethasone exposure on adult fathead minnows, percentage of hatch per treatment replicate, with 50 eggs per replicate. A nonparametric analysis (Kruskal–Wallis test) of the data was conducted to account for uneven replicates among treatment groups with n = 45, n = 37, n = 39, and n = 20 for 0, 0.1, 50, and 500 µg dexamethasone/L, respectively. Letters indicate significant differences between treatments (p < 0.05). Upper-case and lower-case letters correspond to analysis of total hatch and abnormal hatch data, respectively.

Download figure to PowerPoint

Significant morphological changes were identified in male fathead minnows exposed to 0.1 µg dexamethasone/L; a significant increase in gonadal somatic index was observed compared with the control treatment group (Table 3). There were no differences in body mass or tubercle score for the males in any treatment group. Females exposed to 50 µg dexamethasone/L exhibited a significant increase in gonadal somatic index compared with the control treatment group but did not differ in body mass and showed no evidence of tubercle formation (Table 3). Plasma 17β-estradiol concentrations from females exposed to 500 µg dexamethasone/L were depressed from 3.2 to 0.6 ng/ml, although no effects were observed at other dexamethasone concentrations (Fig. 3A). Similarly, ex vivo 17β-estradiol production was reduced in a concentration-dependent manner to 50% of control in the female fathead minnows (Fig. 3B). No significant modulation of ex vivo testosterone production was observed for either females (Fig. 3C) or males (Supplemental Data, Fig. S2A). Female fish in the 500 µg dexamethasone/L treatment group had significantly greater vitellogenin concentrations compared with all other treatment groups, increasing approximately 40% over control (Fig. 3D). Dexamethasone did not affect plasma vitellogenin concentrations in the males (Supplemental Data, Fig. S2B).

Table 3. Effects of a 21-d dexamethasone exposure on growth and secondary sex characteristic development of adult fathead minnowsa
 SexDexamethasone concentration (nominal; µg/L)
00.150500
  • a

    Mean (± SD, n = 12, except dexamethasone 500 µg/L females, n = 10, and control females, n = 11), fish mass, gonadal somatic index (GSI), and tubercle score for male and female fathead minnows.

  • b

    Significance (p < 0.05), comparing treatment to control.

Mass (g)M3.3 ± 0.63.6 ± 0.53.3 ± 0.63.3 ± 0.7
 F1.3 ± 0.31.2 ± 0.31.4 ± 0.31.2 ± 0.3
GSI (%)M1.2 ± 0.41.6 ± 0.5b1.2 ± 0.51.0 ± 0.4
 F11 ± 414 ± 517 ± 4b15 ± 5
Tubercle scoreM21 ± 224 ± 223 ± 121 ± 2
 F0000
thumbnail image

Figure 3. Effects of 21-d dexamethasone exposure (0.1, 50, and 500 µg/L) on plasma estradiol (A), ex vivo synthesis of estradiol (B), testosterone by ovary tissue from fathead minnows (C), and female plasma vitellogenin protein concentration (D). Ovaries (n = 10–12). Bars on graph represent mean (± SE). Letters indicate statistically significant differences between treatments (p < 0.05).

Download figure to PowerPoint

In contrast to the elevated plasma vitellogenin observed in the females, hepatic vitellogenin mRNA was not significantly affected and was perhaps even decreased (p = 0.08; Fig. 4A). Estrogen receptor and HMG-CoA reductase mRNA abundance in female liver tissue were not significantly affected by dexamethasone (Fig. 4B and D). Glucocorticoid receptor mRNA abundance was significantly increased in the liver of female fathead minnows exposed to 50 µg dexamethasone/L (Fig. 4C), but no significant differences were identified when head kidney tissue was analyzed (Supplemental Data, Fig. S3). Both CYP19a (aromatase) and vitellogenin receptor mRNA levels were assessed in female gonad tissue and showed no significant effects (Supplemental Data, Fig. S3). Three known human gene targets for dexamethasone, annexin A1a, prostaglandin-endoperoxide synthase 1, and prostaglandin-endoperoxide synthase 2, were analyzed as potential indicators of effects on inflammatory status in fathead minnow ovary tissue. However, no significant treatment effects were observed (Supplemental Data, Fig. S3).

thumbnail image

Figure 4. Relative transcript abundance of four gene products in liver tissue from adult female fathead minnows exposed to 0 (control), 0.1, 50, or 500 µg dexamethasone/L for 21-d as determined by qRT-PCR. Bars on graph represent mean (± SE). Letters indicate significant differences between treatments (p < 0.05). (A) Vitellogenin (Vtg). (B) Estrogen receptor 1 subtype (Esr1). (C) Glucocorticoid receptor (GR). (D) 3-Hydroxy-3-methyl-glutaryl-CoA reductase (HMG-CoA reductase).

Download figure to PowerPoint

Twenty-nine-day embryo–larvae exposure and grow-out

As with the 21-d test, measured concentrations of dexamethasone for the 29-d exposure were slightly below target (0.1, 50, and 500 µg/L) concentrations but were again relatively stable throughout the 29-d exposure period (Table 2). Approximately 70% of all eggs used for the 29-d dexamethasone embryo–larvae exposure hatched normally. Most of those that did not hatch succumbed to fungus. Abnormally hatched fry were not quantified during the present study because the experimental setup was not compatible with accurately identifying malformations. The fry grew throughout the exposure period, so there was a noticeable difference in the size of the animals exposed to 500 µg dexamethasone/L compared with all other treatments. On day 29 of the exposure, 50 fry were collected from each treatment tank and moved to grow-out tanks receiving clean Lake Superior water. Fry that were not used for the grow-out period were weighed and measured. The weight and length of the fry from the 500 µg dexamethasone/L treatment group were significantly less than those of fry from all other treatments (Supplemental Data, Fig. S4A and B). However, at sexual maturity (i.e., after the grow-out), no significant differences in weight were seen among the treatment groups (Supplemental Data, Fig. S4A).

During the third week of grow-out, we noted that several fish previously exposed to 500 µg dexamethasone/L displayed deformed operculum. On weeks 16 and 17 postdexamethasone exposure, fish were sampled, and abnormal operculum was distinguished as unilateral left, unilateral right, or bilateral. After analyzing all fish, we determined that 36.1% of fish exposed to 500 µg dexamethasone/L displayed an operculum deformity, which was a significantly higher incidence compared with the control fish (p < 0.0001; Table 4). Among those, 57.7% (30/52 fish) had developed a bilateral deformity, 23.1% (12/52 fish) had developed a unilateral left deformity, and 19.2% (10/52 fish) had developed a unilateral right deformity. Fathead minnows from the control and 0.1 and 50 µg dexamethasone/L treatment groups displayed 4.7% (7/148 fish), 4.2% (6/144 fish), and 5.52% (8/145) deformed operculum (unilateral and bilateral), respectively.

Table 4. Effects of the 29-d dexamethasone exposure on fathead minnow operculum development after fresh water growth to sexual maturitya
 Dexamethasone (µg/L)All treatment groups
00.150500
  • a

    Fish were examined for operculum deformity after anesthetized in MS-222. Fisher's exact t test was used to determine statistical differences between treatments and control.

  • b

    p < 0.0001.

No. deformed operculum7685273
Total n148144145144581
Percentage deformed4.74.25.536.1b12.6
Bilateral deformity2133036
Left side deformed3341222
Right side deformed2211015

Histological preparations confirmed the gross malformations of the head and opercula of fathead minnows exposed to 500 µg dexamethasone/L during the 29-d embryo–larval test. Opercular bones of control fish were relatively straight and formed a plate that could seal the opercular cavity from external water (Fig. 5A), whereas those from the dexamethasone (500 µg/L)-treated fish were flexed rostrally (Fig. 5B). The adjacent bones anterior to the deformed operculum were also abnormal, with the distal margin of these bones curving away from the midline of the fish. In control fish, these bones form a convex curve toward the midline (Fig. 5A). In addition, the bones that form the posterior margin of the buccal cavity were angled differently in the dexamethasone-treated fish versus the control fish.

thumbnail image

Figure 5. Histological samples from 29-d embryo–larval test collected from fish exposed to 500 µg dexamethasone/L for 29 d followed by a 4-month grow-out in clean water. Duplicate samples of male and female control fish (A) and dexamethasone-treated male and female fish (B; 500 µg/L). [Color figure can be seen in the online version of this article, available at wileyonlinelibrary.com]

Download figure to PowerPoint

Photographs of the fish taken prior to dissection (Fig. 6) illustrate the differences in gross morphology between the control animals and the malformed operculum of fish treated with dexamethasone. Histological images of the gill region reveal prominent malformations in the anteriormost arches, where the tips of adjacent filaments along each hemibranch of the arch appear to be fused to each other in the fish exposed to dexamethasone (500 µg/L) during embryo–larval development. Also, the respiratory lamellae (secondary lamellae), which typically project from each filament, were embedded within the fused epithelial regions of the filament body.

thumbnail image

Figure 6. Gill histopathology from 29-d embryo–larval test displaying the gross image of a representative control (A; 0 µg/L) and 500 µg dexamethasone/L-treated (D) fish and the histological images of their gill regions with both 0 µg/L treatment (B) and 500 µg/L treatment (E) at ×5 and 0 µg/L treatment (C) and 500 µg/L treatment (F) at ×40 magnifications.

Download figure to PowerPoint

Genotyping

To identify possible sex reversals caused by dexamethasone exposure, phenotypic sex was determined by morphological examination of the gonads, and all remaining fish were categorized as either female (296 fish) or male (283 fish). Eighteen individuals could not be reliably classified because of the small size or immature status of the gonads. Consequently, phenotypic sex for these individuals was determined by histological examination of the gonads. In virtually all instances, phenotypic sex reflected genotypic sex. All females examined lacked the sex-linked marker associated with the male genotype, with the exception of one female each from the 0.1 and 50 µg dexamethasone/L treatment groups (Table 5). All males possessed the marker with the exception of two males in the 500 µg dexamethasone/L treatment (Table 5).

Table 5. Genotyping using a sex-linked genetic marker to identify male genotype of fathead minnow exposed to dexamethasone for 29-d and grown out to sexual maturity in clean water
Dexamethasone treatment (µg/L)Female phenotypeMale phenotype
Marker presentMarker absentMarker presentMarker absent
  • a

    Two fish had unclear phenotypes that were not fixed for future histological analyses, n = 579.

0077710
0.1179640
50172720
500a066742

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

The present studies were designed to assess the reproductive success, growth, and development of fathead minnow at different life stages exposed to the widely prescribed synthetic glucocorticoid receptor agonist dexamethasone. Results from the present study indicate that the pharmaceutical can interfere with reproduction and with normal growth and development at nonlethal concentrations. However, it is important to note that most of the adverse effects observed in the present studies occurred in fish exposed to 500 µg dexamethasone/L, which greatly exceeds environmentally relevant concentrations. Cumulative fecundity and spawning frequency were significantly reduced for fathead minnows exposed to 500 µg dexamethasone/L during the 21-d test. Ex vivo 17β-estradiol production and plasma 17β-estradiol concentrations were also significantly inhibited in fathead minnow females exposed to 500 µg dexamethasone/L. Elevated cortisol levels associated with stress have been implicated in poor spawning outcomes and reduced sex steroid concentrations (including 17β-estradiol) in other fish species, which is consistent with the findings from the present study 16, 17, 20. Parallel reductions in vitellogenin also have been reported in these types of studies 37, highlighting the important role 17β-estradiol plays in modulating hepatic production of vitellogenin. Therefore, an unexpected observation from the current study in females exposed to 500 µg dexamethasone/L was elevated plasma vitellogenin concentrations. There is no evidence from competitive binding assays with human or rainbow trout estrogen receptor that dexamethasone binds to the receptor (V. Wilson and J. Denny, Duluth, MN, USA, personal communication). Therefore, the drug is unlikely to be directly activating the ER and causing vitellogenin induction in the females. This is supported by the fact that there was no evidence of vitellogenin induction in exposed males. Furthermore, there was a slight decrease in hepatic vitellogenin mRNA transcript abundance in females at the high dexamethasone concentration, which would be consistent with the significant reductions in ex vivo 17β-estradiol production and plasma 17β-estradiol concentrations. Ovarian vitellogenin receptor mRNA levels were unaltered by dexamethasone, providing further evidence that the increased plasma vitellogenin was unlikely because of altered receptor binding. Additionally, liver estrogen receptor 1 mRNA levels, known to be induced following ER activation, were not affected by dexamethasone exposure. Based on these results, we hypothesize that the increased plasma vitellogenin observed in the females was related to the inhibition of spawning caused by dexamethasone, leading to a subsequent saturation of vitellogenin in the ovary, thereby preventing the normal transport of the lipoprotein from the plasma into the ovary.

Several other genes commonly altered by interactions with endocrine-active chemicals also were assessed in the present study. Aromatase or Cyp19a is an important enzyme in the steroid synthesis pathway responsible for the conversion of testosterone to 17β-estradiol 33, and HMG-CoA is the enzyme that controls the rate-limiting step in cholesterol synthesis in the steroid synthesis pathway 38. Levels of neither Cyp19a nor HMG-CoA mRNA were altered by dexamethasone exposure, indicating that the adverse effects on 17β-estradiol production were unlikely because of the direct action of dexamethasone on the steroid synthesis pathway.

In humans, dexamethasone provides its therapeutic anti-inflammatory benefit by acting on specific molecular targets, including the glucocorticoid receptor annexin, prostaglandin endoperoxide synthase 1, and prostaglandin endoperoxide synthase 2 39–41. Through gene expression analyses, annexin and prostaglandin endoperoxide synthase mRNA have been identified in the ovarian tissue of various fish species, providing evidence of potential involvement of these genes in gonad differentiation and ovulation, respectively 42–44. When these genes were assessed in the fathead minnow tissue, there were no significant treatment differences, with the exception of the glucocorticoid receptor, which was increased in liver tissue from the 50 µg dexamethasone/L treatment group. The possible linkage of this finding relative to reproductive effects is unclear.

Females exhibited a significant increase in the mass of the ovary relative to body mass (Table 3) after exposure to 50 µg dexamethasone/L, which corresponds, interestingly, to a slight increase in the number of eggs per spawn observed at this concentration (Fig. 1C). Our group has previously seen an increased gonadal somatic index in reproductively active females exposed to ketoconazole, an antifungal pharmaceutical, speculating that this increase is a function of egg maturity, alternating between spawns 29. The only significant impact that dexamethasone had on male fathead minnow was an increase in the mass of the testes relative to body mass (Table 2) following the exposure to 0.1 µg/L, an environmentally relevant concentration 2. The lack of concentration-dependent changes in these common apical endpoints was rather unexpected. However, for Japanese eel, it was found that cortisol increases DNA replication and mitosis in spermatogonia at moderate concentrations but that excessive concentrations inhibited this proliferative effect 45. Another study demonstrated a similar nonmonotonic effect of cortisol on gonadal somatic index and activation of spermatogenesis in knifefish 46. From these studies, it could be hypothesized that dexamethasone acts in a similar manner on spermatogenesis in male fathead minnows, leading to the noted increase in gonadal somatic index at a moderate but not a high test chemical concentration.

Increased frequencies of body malformations in newly hatched larvae collected during the 21-d test were significant for parents exposed to 500 µg/L dexamethasone. The deformities were initially recognized by larval immobility, aberrant swimming patterns, or uncharacteristic size and were classified as abnormal spinal curvatures, yolk sac malformations, edema, or total body shortening. These results suggest that dexamethasone may adversely affect embryonic development, leading to offspring deformities. The development of such deformities in the offspring could translate into a negative impact on populations if such an exposure were possible in a natural setting.

A significant reduction in length and weight was observed for fry on day 29 of the embryo-larval exposure to 500 µg dexamethasone/L. This reduction in growth was transient, because fathead minnows that were subsequently grown to sexual maturity in control water (postexposure) recovered to weights comparable to those of controls. The most striking anomaly in fathead minnows exposed to dexamethasone during the embryo-larval stage was the development of deformed operculum and gill arches. It was unclear whether the opercular malformations were the primary lesions or one of a series of bony malformations in and around the head of the fish. Fathead minnows that had been exposed to 500 µg dexamethasone/L were found to have a significantly higher incidence of this deformity compared with all other treatment groups. Histological examination of fathead minnows exhibiting the opercula malformation showed evidence of altered gill morphology with the fusion of secondary lamella to the epithelial filament on the structures facing the external environment. The observed lesions are likely the result of the malformed opercular bones rather than a direct effect of dexamethasone on the gill lamellae. The role of the operculum is to protect the fragile gill from the external environment and regulate water movement across the filaments, allowing the gill epithelium to carry out its important role in maintaining proper respiration, ionic regulation, acid–base balance, and excretion of nitrogenous waste 47. With such gross abnormalities of the opercular complex, it was surprising that mortalities were not associated with the observed malformations. However, in the natural environment, truncated opercula could predispose affected fish to physical injury, bacterial infections, or parasite infestations that could lead to poor survival rates.

It has been reported that elevated cortisol levels during gonadal sex differentiation can lead to sex reversal in Japanese flounder (Paralichthys olivaceus) and pejerrey (Odontesthes bonariensis) 22, 23. Therefore, we hypothesized that exposure to dexamethasone might cause a similar effect in the fathead minnow. Genotyping results using fish from the 29-d embryo-larvae study did not support this hypothesis. There was no evidence of deviations from phenotypic versus genotypic sex in fish allowed to grow to sexual maturity. However, the genotyping results from the present study (Table 5), showed a <1% error rate (marker mismatch) and provide practical evidence as to the utility of the sex-linked marker for the determination of genetic sex, a methodology outlined by Olmstead et al. 26.

In conclusion, the present studies provide evidence of a variety of adverse effects in fathead minnows exposed to the pharmaceutical dexamethasone at concentrations unlikely to be encountered in the natural environment. Detrimental effects on reproduction, growth, and development were observed with exposure to a high concentration of dexamethasone. Together, the present studies suggest that dexamethasone and perhaps similar glucocorticoids have no substantial effect on teleost fish at environmentally relevant concentrations.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

We thank K. Lott for his assistance in maintaining the fathead minnow cultures. J. Tietge provided helpful review comments on an earlier version of the manuscript. This article has been reviewed in accordance with the requirements of the U.S. EPA Office of Research and Development; however, the recommendations made herein do not represent U.S. EPA policy. Mention of products or trade names does not indicate endorsement by the U.S. EPA.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information
  • 1
    Kostich MS, Lazorchak JM. 2008. Risks to aquatic organisms posed by human pharmaceutical use. Sci Total Environ 389: 329339.
  • 2
    Van der Linden SC, Heringa MB, Man HY, Sonneveld E, Puijker LM, Brouwer A, Van der Burg B. 2008. Detection of multiple hormonal activities in wastewater effluents and surface water, using a panel of steroid receptor CALUX bioassays. Environ Sci Technol 42: 58145820.
  • 3
    Gilbert N. 2011. Drug waste harms fish. Nature 476: 265.
  • 4
    Benotti MJ, Snyder SA. 2009. Pharmaceuticals and endocrine disrupting compounds: Implications for ground water replenishment with recycled water. Ground Water 47: 499502.
  • 5
    Jones OA, Voulvoulis N, Lester JN. 2001. Human pharmaceuticals in the aquatic environment: A review. Environ Technol 22: 13831394.
  • 6
    Ramirez AJ, Brain RA, Usenko S, Mottaleb MA, O'Donnell JG, Stahl LL, Wathen JB, Snyder BD, Pitt JL, Perez-Hurtado P, Dobbins LL, Brooks BW, Chambliss CK. 2009. Occurrence of pharmaceuticals and personal care products in fish: Results of a national pilot study in the United States. Environ Toxicol Chem 28: 25872597.
  • 7
    Besse JP, Garric J. 2008. Human pharmaceuticals in surface waters. Implementation of a prioritization methodology and application to the French situation. Toxicol Lett 176: 104123.
  • 8
    Paliogianni F, Raptis A, Ahuja SS, Najjar SM, Boumpas DT. 1993. Negative transcriptional regulation of human interleukin 2 (IL-2) gene by glucocorticoids through interference with nuclear transcription factors AP-1 and NF-AT. J Clin Invest 91: 14811489.
  • 9
    Smoak KA, Cidlowski JA. 2004. Mechanisms of glucocorticoid receptor signaling during inflammation. Mech Ageing Dev 125: 697706.
  • 10
    De Bosscher K, Vanden Berghe W, Haegeman G. 2003. The interplay between the glucocorticoid receptor and nuclear factor-kappaB or activator protein-1: Molecular mechanisms for gene repression. Endocr Rev 24: 488522.
  • 11
    DellaGreca M, Fiorentino A, Isidori M, Lavorgna M, Previtera L, Rubino M, Temussi F. 2004. Toxicity of prednisolone, dexamethasone and their photochemical derivatives on aquatic organisms. Chemosphere 54: 629637.
  • 12
    Li D, Yang XL, Zhang SJ, Lin M, Yu WJ, Hu K. 2008. Effects of mammalian CYP3A inducers on CYP3A-related enzyme activities in grass carp (Ctenopharyngodon idellus): Possible implications for the establishment of a fish CYP3A induction model. Comp Biochem Physiol C Toxicol Pharmacol 147: 1729.
  • 13
    Lutton BV, Callard IP. 2008. Influence of reproductive activity, sex steroids, and seasonality on epigonal organ cellular proliferation in the skate (Leucoraja erinacea). Gen Comp Endocrinol 155: 116125.
  • 14
    Pierce AL, Dickey JT, Felli L, Swanson P, Dickhoff WW. 2010. Metabolic hormones regulate basal and growth hormone-dependent igf2 mRNA level in primary cultured coho salmon hepatocytes: effects of insulin, glucagon, dexamethasone, and triiodothyronine. J Endocrinol 204: 331339.
  • 15
    Consten D, Bogerd J, Komen J, Lambert JG, Goos HJ. 2001. Long-term cortisol treatment inhibits pubertal development in male common carp, Cyprinus carpio L. Biol Reprod 64: 10631071.
  • 16
    Coward K, Bromage NR, Little DC. 1998. Inhibition of spawning and associated suppression of sex steroid levels during confinement in the substrate-spawning Tilapia zillii. J Fish Biol 52: 152165.
  • 17
    Schreck CB, Contreras-Sanchez W, Fitzpatrick MS. 2001. Effects of stress on fish reproduction, gamete quality, and progeny. Aquaculture 197: 324.
  • 18
    Lister A, Nero V, Farwell A, Dixon DG, Van Der Kraak G. 2008. Reproductive and stress hormone levels in goldfish (Carassius auratus) exposed to oil sands process-affected water. Aquat Toxicol 87: 170177.
  • 19
    Milla S, Wang N, Mandiki SN, Kestemont P. 2009. Corticosteroids: Friends or foes of teleost fish reproduction? Comp Biochem Physiol A Mol Integr Physiol 153: 242251.
  • 20
    Pickering AD, Pottinger TG, Carragher J, Sumpter JP. 1987. The effects of acute and chronic stress on the levels of reproductive hormones in the plasma of mature male brown trout, Salmo trutta L. Gen Comp Endocrinol 68: 249259.
  • 21
    Lethimonier C, Flouriot G, Valotaire Y, Kah O, Ducouret B. 2000. Transcriptional interference between glucocorticoid receptor and estradiol receptor mediates the inhibitory effect of cortisol on fish vitellogenesis. Biol Reprod 62: 17631771.
  • 22
    Yamaguchi T, Yoshinaga N, Yazawa T, Gen K, Kitano T. 2010. Cortisol is involved in temperature-dependent sex determination in the Japanese flounder. Endocrinology 151: 39003908.
  • 23
    Hattori RS, Fernandino JI, Kishii A, Kimura H, Kinno T, Oura M, Somoza GM, Yokota M, Strussmann CA, Watanabe S. 2009. Cortisol-induced masculinization: Does thermal stress affect gonadal fate in pejerrey, a teleost fish with temperature-dependent sex determination? PLoS One 4: e6548.
  • 24
    Ankley GT, Jensen KM, Kahl MD, Korte JJ, Makynen EA. 2001. Description and evaluation of a short-term reproduction test with the fathead minnow (Pimephales promelas). Environ Toxicol Chem 20: 12761290.
  • 25
    Jensen KM, Korte JJ, Kahl MD, Pasha MS, Ankley GT. 2001. Aspects of basic reproductive biology and endocrinology in the fathead minnow (Pimephales promelas). Comp Biochem Physiol C Toxicol Pharmacol 128: 127141.
  • 26
    Olmstead AW, Villeneuve DL, Ankley GT, Cavallin JE, Lindberg-Livingston A, Wehmas LC, Degitz SJ. 2011. A method for the determination of genetic sex in the fathead minnow, Pimephales promelas, to support testing of endocrine-active chemicals. Environ Sci Technol 45: 30903095.
  • 27
    Delvin EW, Brammer JD, Puyear RL, McKim JM. 1996. Prehatching Development of the Fathead Minnow Pimephales promelas Rafinesque. EPA/600/R-96/079. U.S. Environmental Protection Agency, Washington, DC, pp 149.
  • 28
    McMaster ME, Munkittrick KR, Jardine JJ, Robinson RD, Van Der Kraak GJ. 1995. Protocol for measuring in vitro steroid production by fish gonadal tissue. Canadian Technical Report of Fisheries and Aquatic Sciences. Fisheries and Oceans Canada, Burlington, Ontario, Canada.
  • 29
    Ankley GT, Jensen KM, Kahl MD, Makynen EA, Blake LS, Greene KJ, Johnson RD, Villeneuve DL. 2007. Ketoconazole in the fathead minnow (Pimephales promelas): Reproductive toxicity and biological compensation. Environ Toxicol Chem 26: 12141223.
  • 30
    U.S. Environmental Protection Agency. 2002. A Short-Term Test Method for Assessing the Reproductive Toxicity of Endocrine-Disrupting Chemicals Using the Fathead Minnow (Pimephales promelas). EPA/600/R-01/067. National Health and Environmental Effects Research Laboratory, Mid-Continent Ecology Division, Duluth, MN.
  • 31
    Villeneuve DL, Knoebl I, Larkin P, Miracle AL, Carter BJ, Denslow ND, Ankley GT. 2008. Altered gene expression in the brain and liver of female fathead minnows Pimephales promelas Rafinesque exposed to fadrozole. J Fish Biol 72: 22812340.
  • 32
    Filby AL, Tyler CR. 2005. Molecular characterization of estrogen receptors 1, 2a, and 2b and their tissue and ontogenic expression profiles in fathead minnow (Pimephales promelas). Biol Reprod 73: 648662.
  • 33
    Villeneuve DL, Knoebl I, Kahl MD, Jensen KM, Hammermeister DE, Greene KJ, Blake LS, Ankley GT. 2006. Relationship between brain and ovary aromatase activity and isoform-specific aromatase mRNA expression in the fathead minnow (Pimephales promelas). Aquat Toxicol 76: 353368.
  • 34
    Villeneuve DL, Blake LS, Brodin JD, Greene KJ, Knoebl I, Miracle AL, Martinovic D, Ankley GT. 2007. Transcription of key genes regulating gonadal steroidogenesis in control and ketoconazole- or vinclozolin-exposed fathead minnows. Toxicol Sci 98: 395407.
  • 35
    Truett GE. 2006. Preparation of Genomic DNA From Animal Tissues. Jones and Bartlett, Salsbury, MA, USA.
  • 36
    Jezierska B, Lugowska K, Witeska M. 2009. The effects of heavy metals on embryonic development of fish (a review). Fish Physiol Biochem 35: 625640.
  • 37
    Teitsma C, Lethimonier C, Tujague M, Anglade I, Saligaut D, Bailhache T, Pakdel F, Kah O, Ducouret B. 1998. Identification of potential sites of cortisol actions on the reproductive axis in rainbow trout. Comp Biochem Physiol C Pharmacol Toxicol Endocrinol 119: 243249.
  • 38
    Pallottini V, Scalici M, Gibertini G, Marino M, Trentalance A. 2010. 3-Hydroxy 3-methylglutaryl coenzyme A reductase: A new biomarker of fish exposure to water pollution. Bull Environ Contam Toxicol 85: 381384.
  • 39
    Kalinec F, Webster P, Maricle A, Guerrero D, Chakravarti DN, Chakravarti B, Gellibolian R, Kalinec G. 2009. Glucocorticoid-stimulated, transcription-independent release of annexin A1 by cochlear Hensen cells. Br J Pharmacol 158: 18201834.
  • 40
    Newton R, Seybold J, Kuitert LM, Bergmann M, Barnes PJ. 1998. Repression of cyclooxygenase-2 and prostaglandin E2 release by dexamethasone occurs by transcriptional and post-transcriptional mechanisms involving loss of polyadenylated mRNA. J Biol Chem 273: 3231232321.
  • 41
    Bezugla Y, Kolada A, Kamionka S, Bernard B, Scheibe R, Dieter P. 2006. COX-1 and COX-2 contribute differentially to the LPS-induced release of PGE2 and TxA2 in liver macrophages. Prostaglandins Other Lipid Mediat 79: 93100.
  • 42
    Lister AL, Van Der Kraak GJ. 2009. Regulation of prostaglandin synthesis in ovaries of sexually-mature zebrafish (Danio rerio). Mol Reprod Dev 76: 10641075.
  • 43
    Shang X, Sun J, He Y, Zhao W, Li Q, Zhou F, Chen B, Cheng H, Zhou R. 2007. Identification and predominant expression of annexin A2 in epithelial-type cells of the rice field eel. J Cell Biochem 101: 600608.
  • 44
    Fujimori C, Ogiwara K, Hagiwara A, Rajapakse S, Kimura A, Takahashi T. 2011. Expression of cyclooxygenase-2 and prostaglandin receptor EP4b mRNA in the ovary of the medaka fish, Oryzias latipes: Possible involvement in ovulation. Mol Cell Endocrinol 332: 6777.
  • 45
    Ozaki Y, Higuchi M, Miura C, Yamaguchi S, Tozawa Y, Miura T. 2006. Roles of 11beta-hydroxysteroid dehydrogenase in fish spermatogenesis. Endocrinology 147: 51395146.
  • 46
    Shankar DS, Kulkarni RS. 2000. Effect of cortisol on testis of freshwater fish Notopterus notopterus (Pallas). Indian J Exp Biol 38: 12271230.
  • 47
    Evans DH. 1987. The fish gill: Site of action and model for toxic effects of environmental pollutants. Environ Health Perspect 71: 4758.

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

All Supplemental Data may be found in the online version of this article.

FilenameFormatSizeDescription
etc_1729_sm_SupplFigs.doc13057KSupplemental Figures

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.