SEARCH

SEARCH BY CITATION

Keywords:

  • 2,3,7,8-tetrachlorodibenzo-p-dioxin;
  • Bank vole;
  • Field vole;
  • Cytochrome P450;
  • Aryl hydrocarbon receptor

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

The gene expression and induction of cytochrome P450 (CYP)-enzymes following 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) peroral administration was studied in the livers of two wild vole species—the bank vole (Myodes glareolus) and the field vole (Microtus agrestis). The dioxin-sensitive C57BL/6 mouse was used as a reference. Doses of 0.05, 0.5, 5.0, and 50 µg/kg were applied to ascertain a dose–response relationship, and the dose of 50 µg/kg was applied to the study time course for up to 96 h. The cytochrome P450 1A1 (CYP1A1) mRNA expression showed an expected dose-dependent increase equally in both vole species. Bank voles expressed notably higher CYP2A mRNA levels as compared with field voles. Both species exhibited dose-dependent increases in putative CYP1A-, CYP2B-, and CYP2A-associated activities as measured by fluorometric assays for ethoxyresorufin-O-deethylase (EROD), penthoxyresorufin-O-depenthylase (PROD), and 7-ethoxycoumarin-O-deethylase (ECOD), respectively. Putative CYP2A-associated coumarin-7-hydroxylase (COH) activity showed a slight increase at the two highest doses of TCDD in field voles but not in bank voles, and their basal COH activity was only one-fourth or less of that in field voles. Overall, however, bank voles tended to exhibit higher CYP-associated enzyme activities measured at the two largest doses of TCDD than field voles. A western blot analysis of aryl hydrocarbon receptor (AhR) revealed that the two vole species had differential band patterns, suggesting dissimilar structures for their AhRs. Environ. Toxicol. Chem. 2012;31:663–671. © 2011 SETAC


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Polychlorinated dibenzo-p-dioxins and -furans (PCDD/Fs) belong to a group of persistent environmental pollutants commonly referred to as dioxins. Dioxins are known to cause a variety of adverse effects including endocrine disruption, reproductive and developmental toxicity, immunosuppression, and cancer. They are also highly potent inducers of xenobiotic metabolism. As lipophilic compounds, dioxins bioaccumulate in organisms and furthermore biomagnify in the food chain 1, 2.

The biological and toxic effects of acute and chronic dioxin exposures vary in a species-, strain-, age-, gender-, tissue-, and dose-specific manner 3, 4. Most of the toxic effects of dioxins and related compounds are mediated by aryl hydrocarbon receptor (AhR) 5, 6, and the molecular basis for wide inter- and intraspecies differences seems to be related to polymorphisms in this receptor 7. Activation of the AhR leads to induction or repression of a varied combination of genes, including cytochrome P450 1A1 (CYP1A1), the most studied gene for AhR activation. Certain dioxins, especially 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), are known to be the most potent inducers of CYP1A1 and other CYP1 family members, CYP1A2 and CYP1B1, which generally catalyze the metabolism of both endogenous (e.g., bilirubin, estradiol, and arachidonic acid) and xenobiotic compounds, such as polycyclic aromatic hydrocarbons (PAHs), caffeine, and some drugs 8. Although CYP1 family members have long been believed to be the only CYP enzymes regulated by the AhR, certain CYP2A enzymes have been shown to be upregulated by AhR ligands 9.

In our previous study 10, we screened the xenobiotic metabolism of bank voles (Myodes [Clethrionomys] glareolus) living in a former sawmill area contaminated by PCDD/Fs. Several CYP-associated activities were significantly elevated in these animals compared with bank voles in a control area. Interestingly, a comparison of lipid-based tissue PCDD/F concentrations of bank voles and field voles (Microtus agrestis) from the same contaminated sawmill area 11 indicated that field voles had substantially lower levels of PCDD/Fs compared with bank voles. This interspecies difference raised the question whether this was purely because of different diet and habitat, or whether there were also differences in the induction pattern of xenobiotic-metabolizing enzymes leading to differences in the elimination of dioxins. The aim of the present study was to compare the dose- and time-dependency of induction of xenobiotic-metabolizing enzymes after dioxin exposure using TCDD as a model compound, and to find out if these species diverge in their induction responses to TCDD.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Chemicals

The TCDD was purchased from the UFA-oil Institute and was over 99% pure as confirmed by gas chromatography–mass spectrometry. It was dissolved in corn oil (Sigma Chemicals) and the dosing solutions were sonicated for 20 min and mixed in a magnetic stirrer before dosing.

Animals and experimental design

Bank voles were trapped in August 2008 using Ugglan multiple capture live traps in an unpolluted rural area of Suonenjoki, Central Finland (62°4′ N 27°8′ E), in a forest dominated by Pinus sylvestris and Vaccinium myrtillus, the typical habitat of the species in northern Europe. Field voles were caught in the perimeter of a cereal field, an area located close to the forest where bank voles were caught. Trapped animals were divided by species and sex, measured for body mass, and housed in standard polypropylene mouse cages, size 36 × 22 × 15 cm for 2 to 3 bank voles or 50 × 36 × 20 cm for 3 to 4 field voles (Tecniplast, Italy). Only voles that could be identified as juveniles (i.e., born in summer 2008) based on pelage characteristics were selected. A constant room temperature of 22°C, relative humidity of 50 to 60%, and photoperiod of 12 h were applied. Standard laboratory chow (Altromin 1314F; AltrominSpezialfutter) and tap water were supplied ad libitum.

After a 3- to 5-d period of preadaptation to the cages, voles were randomly allocated into experimental groups of 6 to 8 individuals of each sex. Depending on the group, they received a single dose of either TCDD dissolved in corn oil or pure corn oil by oral gavage (4 mg/kg). The TCDD doses were 50 µg/kg in the time-course experiment and 0.05, 0.5, 5.0, or 50 µg/kg in the dose–response experiment. The experimental design with sampling timepoints, doses, and animal numbers is presented in Table 1. Animals were euthanized by cervical dislocation and the liver was preserved and frozen in liquid nitrogen. Samples were stored at −80°C until analysis. Experiments were performed in accordance with the Finnish legal requirements, under a license given by the National Animal Experiment Board.

Table 1. Experimental design and the number of animals per group
Time (h)Time-responseDose (µg/kg)Dose-responseDose (µg/kg)Dose-response (24 h)
Myodes glareolusMicrotus agrestisMyodes glareolusMicrotus agrestisC57BL/6
N (♂)N (♀)N (♂)N (♀)N (♂)N (♀)N (♂)N (♀)N (♀)
085550856805
2487680.0587870.055
4878680.587760.55
7266365776755
968875       

As a reference to the vole data, liver and cDNA samples from an earlier study carried out in female C57BL/6 mice with the same doses of TCDD 12 were employed in the dose–response experiment and used for CYP expression and enzyme activity analyses.

CYP1A1 and CYP2A5 expression analysis

The liver samples were homogenized and total RNA was isolated using Trizol reagent (Invitrogen). The cDNA was synthesized with Omniscript reverse transcriptase (Qiagen) using random hexamers (Roche), and used as a template for quantitative polymerase chain reaction (PCR) analysis. The expression levels of CYP1A1 and CYP2A5 mRNAs were analyzed using Power SYBR Green PCR Master Mix and Applied Biosystems 7000 Real-Time PCR System by the absolute quantification system. Standard curves were generated using isolated and purified PCR products produced with the same primers designed for the quantitative PCR.

The PCR primers were selected from highly conserved regions of CYP1A1 and CYP2A5 mRNAs from various species. The CYP1A1 primers were based on mouse (NM-001136059), rat (NM-012540), and mink (EU046493) sequences, CYP2A5 on mouse (NM-007812), rat (NM-012542), and hamster (D86952) sequences. The housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used for normalization and its primers were based on mouse (NM-008084), rat (NM-017008), and dog (NM-001003142) sequences. The following primers were used: CYP1A1, ctccacacccgtggtggtgc, and gcattctgggccaggcgcc; CYP2A5, gctgtgcggacaggaggcagtc, and gaagtcccgcagcgtggcgatg; and GAPDH, ccatgccatcactgccaccca, and ggccatgccagtgagcttccc. Polymerase chain reaction was initiated with an incubation step of 10 min at 95°C to activate AmpliTaq Gold DNA Polymerase. This was followed by 40 cycles consisting of denaturation at 95°C for 15 s and annealing/extension for 1 min at 60, 65, or 68°C for CYP2A5, CYP1A1, or GAPDH, respectively. A dissociation curve was run to verify the absence of nonspecific amplification. Negative controls were included in each run. The expression levels were related to mRNA concentrations of GAPDH to normalize the amount of cDNA in PCR reactions. The average amplification efficiencies were 115, 104, and 107% for CYP2A5, CYP1A1, and GAPDH, respectively, and R2 values ranged from 0.988 to 0.999 in all quantitative (q)PCR reactions.

Enzyme assays

Liver tissue was homogenized in four volumes of ice-cold phosphate buffer, pH 7.4, and the resulting homogenate was first centrifuged at 10,000 g for 30 min. The supernatant was then centrifuged at 100,000 g for 60 min. The final microsomal pellet was suspended in 0.1 M phosphate buffer and stored at −80°C until analysis.

Fluorometric enzyme analysis was applied for CYP1A1/2 (ethoxyresorufin-O-deethylase [EROD]), CYP2B (penthoxyresorufin-O-depenthylase [PROD]), and CYP2A (coumarin-7-hydroxylase [COH] and 7-ethoxycoumarin-O-deethylase [ECOD]). Both EROD and PROD activities were measured as described by Burke et al. 13. The activity of COH was measured as described by Aitio 14, with minor modifications described by Raunio et al. 15, 16, and ECOD was analyzed by the method of Greenlee and Poland 17.

Western blotting

For western blot analysis of the AhR, liver samples from both genders of field and bank voles treated with corn oil 48 h earlier or with 50 µg/kg TCDD 1 or 4 d previously were used. A total of 80 µg protein was run on a 7.5% separating gel (Bio-Rad), transferred on Hybond nitrocellulose membrane, and incubated with an antibody recognizing the highly conserved N-terminal end of the AhR (BIOMOL), diluted 1:5,000. Visualization of the bands was performed as described previously 18. Band intensities were subjected to a semiquantitative densitometric analysis using GS-800 Calibrated Densitometer and Quantity One software (both from Bio-Rad). For normalization across gels, a randomly selected sample was run on every gel.

Statistical analysis

Normality of the data was tested by the Kolmogorov–Smirnov test with Lilliefors Significance Correction. Comparisons between sexes and between species were carried out either by a two-tailed t test for unrelated samples for equality of means, preceded by Levene's test for equality of variances, or one-way analysis of variance (ANOVA) followed by Tukey's honestly significant difference test for multiple comparisons. The results are given as group means ± SD. The limit for statistical significance was set at 0.05.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Body and liver weight

The body weights of the animals at the beginning of the study, the body weight gain during 96 h, and the relative liver weight are presented in Table 2. The relative liver weight tended to increase in both species within 96 h after the dose of 50 µg/kg TCDD, although the increase was not statistically significant (independent t test for equality of means, p > 0.05).

Table 2. Body weight gain and relative liver weights (mg/g body weight) after a single dose of 50 µg/kg 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in bank voles (Myodes glareolus) and field voles (Microtus agrestis) at 96 h compared to controlsa
 ControlTCDD 50 µg/kgl
Myodes glareolusMicrotus agrestisMyodes glareolusMicrotus agrestis
  • a

    Values are means ± SD.

Body weight (g)18.07 ± 1.1218.43 ± 2.4730.97 ± 5.3632.13 ± 5.5519.29 ± 2.8617.15 ± 2.5227.66 ± 3.5928.54 ± 3.10
Body weight gain %2.45−1.334.85−0.273.420.74−4.83−0.04
Liver weight (mg/g bw)66.69 ± 15.4161.33 ± 8.1053.06 ± 7.0156.02 ± 8.1473.19 ± 6.7872.04 ± 9.6365.73 ± 8.9660.80 ± 7.38

CYP1A

In both vole species, the gene expression of CYP1A1 increased at doses of 5 and 50 µg/kg, whereas the lower doses (0.05 and 0.5 µg/kg) did not seem to have an effect on expression levels (Fig. 1A). Both genders of field voles tended to show a slightly more pronounced expression, with the difference peaking at the highest dose of TCDD tested (50 µg/kg), although the difference between the species was not statistically significant. Female C57BL/6 mice expressed predictably a dose-dependent increase in CYP1A1 mRNA at levels approximately 10 times higher than those in voles and showing a significant induction already at 0.05 µg/kg (one-way ANOVA followed by Tukey's honestly significant difference test, p < 0,05).

thumbnail image

Figure 1. Relative amount of CYP1A1 (A) and CYP2A5 (B) mRNA in bank voles, field voles, and C57BL/6 mice after different doses of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), expressed as mean value (± SE). Males (right panel) and females (left panel). Note the logarithmic scale. The statistical significance (one-way analysis of variance followed by Tukey's honestly significant difference test) between the species is indicated as follows: *p < 0.05; **p < 0.01; ***p < 0.001.

Download figure to PowerPoint

Similar to gene expression, CYP1A-associated mono-oxygenase activity measured by EROD assay exhibited a dose-dependent increase in bank and field voles (Fig. 2A). The increase sustained for the entire 96-h observation period (Fig. 3A). In general, within both species males and females responded similarly to TCDD exposure, although occasional differences reaching statistical significance (p < 0.05) were observed in EROD activity. Interspecies differences were detected in both experiments; especially in the time-course study bank voles exhibited 30 to 50% higher levels compared with field voles. In the dose–response experiment the interspecies differences were less distinctive in males. However, bank voles seemed to respond in a more pronounced way to higher doses.

thumbnail image

Figure 2. Dose–response of ethoxyresorufin-O-deethylase (EROD) (A), penthoxyresorufin-O-depenthylase (PROD) (B), 7-ethoxycoumarin-O-deethylase (ECOD) (C), and coumarin-7-hydroxylase (COH) (D) activities for bank vole and field vole males (left panel), females (right panel), and mouse (C57BI/6J) females (right panel) after different doses of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) expressed as mean value (± SD). The statistical significance (independent t test for equality of means/one-way analysis of variance followed by Tukey's honestly significant difference test) between vole species is indicated as follows: *p < 0.05; **p < 0.01; ***p < 0.001.

Download figure to PowerPoint

thumbnail image

Figure 3. Time-response curves of ethoxyresorufin-O-deethylase (EROD) (A), penthoxyresorufin-O-depenthylase (PROD) (B), 7-ethoxycoumarin-O-deethylase (ECOD) (C), and coumarin-7-hydroxylase (COH) (D) activities for bank vole and field vole males (left panel) and females (right panel) at a single dose of 50 µg/kg expressed as mean value (± SD). The statistical significance (independent t test for equality of means) is indicated as follows: *p < 0.05; **p < 0.01; ***p < 0.001.

Download figure to PowerPoint

CYP2A

A surprisingly wide difference was found in the basal expression levels of CYP2A mRNA bank voles showing approximately 100-fold higher expression compared with those of field voles (Fig. 1B). At the two highest doses the expression was induced in a similar manner in both species. In female C57BL/6 mice there were higher expression levels CYP2A5 in field voles, but notably lower levels in bank voles.

The interspecies differences occurred in both basal expression of CYP2A and the activity of CYP2A-dependent COH, although the difference was reversed. The COH activities were clearly induced by 5 and 50 µg/kg TCDD in field voles, but showed no sign of induction in bank voles and in C57BL/6 mice (Fig. 2D, 3D).

Penthoxyresorufin-O-depenthylase and ECOD activity

Penthoxyresorufin-O-depenthylase activity was enhanced by the three highest doses of TCDD in bank voles displaying a somewhat greater response (Fig. 2B, 3B). Although ECOD activity was also induced by these three doses of TCDD, the outcome was gender-specific (Fig. 2C, 3C). For males, both the dose–response and time-course of the induction of enzyme activity were very similar in the two vole species, whereas for females, bank voles were clearly more responsive than field voles.

Aryl hydrocarbon receptor proteins

Hepatic samples from the two vole species generated distinct patterns of bands at a region corresponding to the expected size of the AhR (Fig. 4). In control field voles, two bands with apparent molecular masses of ca. 98 and 115 kDa were found. Control bank voles also exhibited two bands, but these were about 100 and 110 kDa in size. The relative intensities of the bands varied individually; in general, the upper band tended to be predominant in field voles and the lower one in bank voles. Interestingly, TCDD treatment seemed to affect only the intensity of the upper band (Fig. 5). In both species, a similar pattern emerged with a drop on day 1 followed by a trend to recovery on day 4. The decrease reached significance in field vole males and bank vole females.

thumbnail image

Figure 4. A representative western blot for the aryl hydrocarbon receptor (AhR) of liver homogenates from field and bank voles. For comparison, liver homogenates from two rat strains (H/W and L-E) with differential AhRs were run. MWM = molecular weight marker; fv = field vole; bv = bank vole; m = male; f = female; C = control.

Download figure to PowerPoint

thumbnail image

Figure 5. Pixel intensities (arbitrary units) in the putative aryl hydrocarbon receptor (AhR) upper band in field voles (upper panel) and bank voles (lower panel). The apparent molecular mass of the protein product was ca. 115 or 110 kDa for field and bank voles, respectively, mean ± SD. Columns with nonidentical letters differ significantly (p ≤ 0.05) from one another (one-way analysis of variance [ANOVA] or Kruskal–Wallis nonparametric ANOVA followed by Student–Newman–Keuls post-hoc test). TCDD = 2,3,7,8-tetrachlorodibenzo-p-dioxin.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

In the present study, we assessed the gene expression and activity of certain xenobiotic-metabolizing enzymes in two wild vole species exposed to a single dose of TCDD. One of the most sensitive responses mediated by the AhR is the induction of CYP1A family in the liver, especially CYP1A1 and CYP1A2, and the dose-dependent induction of CYP1A1 by TCDD exposure is well documented 19, 20. It has been considered an early signal of environmental exposure, and has widely been used as an indicator of exposure to dioxins or PAH compounds 21–24. Both species, bank and field voles, exhibited a dose-dependent induction of CYP1A-, CYP2B-, and CYP2A-associated enzyme activities as measured by fluorometric assays for EROD, PROD, and ECOD, respectively. In bank and field voles the basal levels of CYP1A-associated EROD activities seem to be similar or higher compared with those in common laboratory animals. Based on previous publications, the rat, mouse, and guinea pig expressed lower EROD activity, approximately 50, 60, and 90 pmol/mg/min, respectively, than voles, ca. 150 pmol/mg/min 25–27. However, both bank and field voles showed a clearly lower response to TCDD exposure. At the dose of 5 µg/kg, liver microsomal EROD activity was less than 300 pmol/mg/min, whereas, for example, male Sprague–Dawley rats exhibited EROD activity of more than 4500 pmol/mg/min 27. The TCDD-sensitive C57BL/6 mice expressed EROD activity of approximately 3,500 pmol/mg/min at 3 µg/kg and TCDD-resistant DBA mice approximately 1,500 pmol/mg/min at 10 µg/kg 26. Even at the highest dose of TCDD (50 µg/kg), EROD activity did not increase above 500 pmol/mg/min in voles in the present study, whereas, for example, C57BL/6 mice showed an activity of more than 2,200 pmol/mg/min 25.

In accordance with the modest inducibility of EROD activities in these two wild vole species, CYP1A1 was also induced by TCDD exposure only at the dose of 5 µg/kg TCDD and above, although in C57BL/6 mice CYP1A1 expression was significantly induced at the lowest dose of 0.05 µg/kg, and the expression level was approximately an order of magnitude higher than in either vole species. The interspecies and interstrain differences in CYP1A1 induction by TCDD may partly be explained by the binding affinity to AhR. In the study by Weber et al. 26, TCDD-sensitive C57BL/6J mice showed significantly enhanced EROD activity at 0.03 µg/kg TCDD, whereas in less sensitive DBA/2J mice with a low-affinity binding isoform of the AhR the induction required the dose of 10 µg/kg. Another finding suggestive of somewhat lower AhR functionality in these two vole species compared with more common laboratory animals was the meager impact of 50 µg/kg TCDD on body weight and liver size 96 h after exposure. In laboratory rats treated with an identical dose of TCDD, a clear hepatic hypertrophy is typically found at 96 h, and in TCDD-sensitive rat strains body weight loss has become substantial by that timepoint 28.

The divergence between C56BL/6 and DBA/2 mice in binding affinity of TCDD to the AhR is chiefly because of a single amino acid difference in the ligand-binding domain of the AhR. At position 375, the C57BL/6 strain possesses Ala, whereas DBA/2 has Val 29. In addition to mice, the primary structure of the AhR ligand-binding domain plays a crucial role in TCDD sensitivity in birds. Birds are endowed with two AhRs, AhR1 and AhR2, of which AhR1 probably is the dominant subtype 30. Among bird species, AhR binding affinity correlates with TCDD susceptibility, and two amino acids corresponding to Ile324 and Ser380 in the AhR1 of the highly TCDD-sensitive chicken (LD50 0.18 µg/kg by egg injection) are critical in this respect 31. Interestingly, the latter position (380) is equivalent to amino acid 375 in mouse AhR.

In light of the present CYP induction profile data, the observed difference in AhR size between the two vole species is of particular interest. Two bands were recorded by western blot from both species, but we cannot be sure at present whether they both are genuine isoforms of the AhR or whether only one of them represents the full-length AhR. The fact that TCDD rapidly (on day 1) reduced the expression level of the larger protein product would tend to favor the view that this would be the actual AhR, because a similar phenomenon has been reported to occur in the case of rat AhR after an identical dose of TCDD 32. The AhR protein isoforms emanating from splice variants have been established to exist in rats 28. The present findings warrant cloning of the AhR cDNA from these vole species to resolve this uncertainty. Moreover, in vitro studies using cells transfected with the vole AhRs will aid in assessing their functional properties.

Overall, the CYP-associated EROD, PROD, and ECOD activities were higher in bank voles than in field voles. However, the putative CYP2A-catalyzed COH showed a dose-dependent increment in field voles, while bank voles (and C57BL/6 mice) showed practically no sign of COH induction. A likely explanation could be different feeding habits of the species. The bank vole is a more generalized feeder and feeds mainly on seeds, berries, and green vegetation, but also on insects and other invertebrates, while the field vole is more specialized for feeding only on green parts of vegetation. They might have, therefore, evolved to respond differently against plant defense and thus other xenobiotics as well. Previous studies with generalist and specialist herbivore woodrat (Neotoma) species revealed a similar pattern, that is, higher constitutive CYP1A and CYP2B associated activities in the generalist species as compared with the specialist species 33, 34.

The lack of COH induction was a somewhat surprising finding in view of the fact that bank voles living in an old sawmill area highly contaminated by PCDD/Fs showed slightly increased COH activity (∼260 pmol/mg/min and 200 pmol/mg/min for males and females, respectively) 10. The levels of PCDD/Fs (analyzed in muscle tissue) in bank and field voles from this sawmill area were 240 and 25 pg WHO-TEQ/g fat, respectively, and the levels in bank and field voles from the unpolluted control area were 24 and <12 (limit of quantitation) pg WHO-TEQ/g fat, respectively 11. The PCDD/F levels of voles in the present study have not been analyzed, but the estimated body burdens of the administered TCDD, assuming 80% systemic bioavailability after oral dosing 4, are about 40 µg/kg bw at the highest dose level, which is equivalent to about 400 ng TCDD/g fat (assuming 10% fat concentration). Thus, the TCDD body burden was maximally much higher in the voles of the present study than in voles living in the contaminated sawmill area. In the sawmill area the exposure consists of a mixture of chemicals (mainly chlorophenols and PCDD/Fs), suggesting that chemicals other than TCDD might be responsible for the enzyme induction recorded. On the other hand, recent studies indicate that several members of the CYP2A family, the murine CYP2A5 included, are controlled by AhR, for which TCDD is the most potent ligand 9. At the mRNA level, the results of CYP2A expression were reversed; bank voles showed high basal mRNA levels, while the expression was rather low in field voles. Mice COH activity is known to be catalyzed by the CYP2A5 gene product, which is not necessarily the case in vole species.

The factors contributing to inter- and intraspecies variation in sensitivity to environmental chemicals include sex and age of an individual, but also external environmental factors, such as diet. In wildlife, the concentration of chemicals and the rate of xenobiotic metabolism can thereby vary among the population or within the individual under fluctuating conditions. Our previous study 11 showed that the two vole species living in the same contaminated area had substantially different levels of PCDD/Fs (see above), and the question arose as to whether this could be explained fully by differences in the diet or are there also differences in the induction pattern of xenobiotic-metabolizing enzymes. Studies with pine voles (Microtus pinetorum) showed that the population exposed to the organochloride insecticide endrin over several years developed inheritable endrin resistance 35, 36 that was linked with an increased rate of metabolism and a more efficient elimination of endrin in the resistant pine vole population as compared with a sensitive pine vole population originating from an area with no history of endrin application 37.

In the present study, the interspecies differences in the basal levels of CYP2A expression and COH induction might indicate different background exposure, although it is unlikely because of close proximity of the catching areas and the lack of known sources of exposure. Moreover, basal levels of CYP1A1 expression and EROD activity are fairly similar, indicating that the exposure to AhR ligands such as halogenated hydrocarbons and PAHs would not notably differ between species. Based on the present results on wild species it seems that the basic characteristics of the AhR-controlled CYP1A response have been preserved, although sensitivity of induction response is, not surprisingly, different from that of common laboratory rodents. Our findings also suggest that AhR receptor structures differ between the two vole species, which could at least partly explain the observed differences in induction profiles, especially the drastic differences between two vole species in the putative CYP2A-associated basal expression and induction pattern. Our studies advocate the role of environmental factors, including diet, in modifying basal activities and induction responses of xenobiotic metabolism in voles, but obviously these observations are difficult to ascertain in wild species and would therefore require long-term studies in more controlled conditions.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

The authors thank R. Tauriainen, P. Tyni, and A. Moilanen for excellent technical assistance. The present study was supported by grants from the Thule Institute, University of Oulu, and the Tauno Tönning Foundation, University of Oulu.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  • 1
    Loonen H, van de Guchte C, Parsons JR, de Voogt P, Govers HAJ. 1996. Ecological hazard assessment of dioxins: Hazards to organisms at different levels of aquatic food webs (fish-eating birds and mammals, fish and invertebrates). Sci Total Environ 182: 93103.
  • 2
    Korhonen M, Verta M, Lehtoranta J, Kiviranta H, Vartiainen T. 2001. Concentrations of polychlorinated dibenzo-p-dioxins and furans in fish downstream from a Ky-5 manufacturing. Chemosphere 43: 587593.
  • 3
    Pohjanvirta R, Tuomisto J. 1994. Short-term toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin in laboratory animals: Effects, mechanisms, and animal models. Pharmacol Rev 46: 483549.
  • 4
    Van den Berg M, De Jongh J, Poiger H, Olson JR. 1994. The toxicokinetics and metabolism of polychlorinated dibenzo-p-dioxins (PCDDs) and dibenzofurans (PCDFs) and their relevance for toxicity. Crit Rev Toxicol 24: 174.
  • 5
    Mimura J, Fujii-Kuriyama Y. 2003. Functional role of AhR in the expression of toxic effects by TCDD. BBA-Gen Subjects 1619: 263268.
  • 6
    Okey AB. 2007. An aryl hydrocarbon receptor odyssey to the shores of toxicology: The Deichmann Lecture, International Congress of Toxicology-XI. Toxicol Sci 98: 538.
  • 7
    Pohjanvirta R, Korkalainen M, Moffat ID, Boutros PC, Okey AB. 2011. Role of the AHR and its structure in TCDD toxicity. In R Pohjanvirta, ed, The AH Receptor in Biology and Toxicology. John Wiley & Sons, Hoboken, NJ, USA.
  • 8
    Denison MS, Nagy SR. 2003. Activation of the aryl hydrocarbon receptor by structurally diverse exogenous and endogenous chemicals. Annu Rev Pharmacol Toxicol 43: 309334.
  • 9
    Arpiainen S, Raffalli-Mathieu F, Lang MA, Pelkonen O, Hakkola J. 2005. Regulation of the Cyp2a5 gene involves an aryl hydrocarbon receptor-dependent pathway. Mol Pharmacol 67: 13251333.
  • 10
    Murtomaa M, Viitala P, Hokkanen J, Pelkonen O, Rautio A. 2010. Xenobiotic metabolism of bank vole (Myodes glareolus) exposed to PCDDs. Environ Toxicol Pharmacol 29: 1923.
  • 11
    Murtomaa M, Tervaniemi O, Parviainen J, Ruokojärvi P, Tuukkanen J, Viluksela M. 2007. Dioxin exposure in contaminated sawmill area: The use of molar teeth and bone of bank vole (Clethrionomys glareolus) and field vole (Microtus agrestis) as biomarkers. Chemosphere 68: 951957.
  • 12
    Pohjanvirta R. 2009. Transgenic mouse lines expressing rat AH receptor variants — A new animal model for research on AH receptor function and dioxin toxicity mechanisms. Toxicol Appl Pharmacol 236: 166182.
  • 13
    Burke MD, Prough RA, Mayer RT. 1977. Characteristics of a microsomal cytochrome P-448-mediated reaction. Ethoxyresorufin O-de-ethylation. Drug Metab Dispos 5: 18.
  • 14
    Aitio A. 1978. A simple and sensitive assay of 7-ethoxycoumarin deethylation. Anal Biochem 85: 488491.
  • 15
    Raunio H, Syngelmä T, Pasanen M, Juvonen R, Honkakoski P, Kairaluoma MA, Sotaniemi E, Lang MA, Pelkonen O. 1988. Immunochemical and catalytical studies on hepatic coumarin 7-hydroxylase in man, rat, and mouse. Biochem Pharmacol 37: 38893895.
  • 16
    Raunio H, Valtonen J, Honkakoski P, Lang MA, Ståhlberg M, Kairaluoma MA, Rautio A, Pasanen M, Pelkonen O. 1990. Immunochemical detection of human liver cytochrome P450 forms related to phenobarbital-inducible forms in the mouse. Biochem Pharmacol 40: 25032509.
  • 17
    Greenlee WF, Poland A. 1978. An improved assay of 7-ethoxycoumarin O-deethylase activity: Induction of hepatic enzyme activity in C57BL/6J and DBA/2J mice by phenobarbital, 3-methylcholanthrene and 2,3,7,8-tetrachlorodibenzo-p-dioxin. J Pharmacol Exp Ther 205: 596605.
  • 18
    Pohjanvirta R, Viluksela M, Tuomisto JT, Unkila M, Karasinska J, Franc M, Holowenko M, Giannone JV, Harper PA, Tuomisto J, Okey AB. 1999. Physicochemical differences in the AH receptors of the most TCDD-susceptible and the most TCDD-resistant rat strains. Toxicol Appl Pharmacol 155: 8295.
  • 19
    Tritscher AM, Goldstein JA, Portier CJ, McCoy Z, Clark GC, Lucier GW. 1992. Dose-response relationships for chronic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin in a rat tumor promotion model: Quantification and immunolocalization of CYP1A1 and CYP1A2 in the liver. Cancer Res 52: 34363442.
  • 20
    Walker NJ, Portier CJ, Lax SF, Crofts FG, Li Y, Lucier GW, Sutter TR. 1999. Characterization of the dose-response of CYP1B1, CYP1A1, and CYP1A2 in the liver of female Sprague-Dawley rats following chronic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol Appl Pharmacol 154: 279286.
  • 21
    Bhatia A, Tobil F, Lepschy G, Werk X, Mazzucco K. 1994. Biomonitoring of pollution: The hepatic cytochrome P-450 enzyme system in the feral mouse Apodemus flavicollis as indicator. Chemosphere 28: 15251537.
  • 22
    Arinc E, Sen A, Bozcaarmutlu A. 2000. Cytochrome P4501A and associated mixed-function oxidase induction in fish as a biomarker for toxic carcinogenic pollutants in the aquatic environment. Pure Appl Chem 72: 985994.
  • 23
    van den Brink NW, de Ruiter-Dijkman EM, Broekhuizen S, Reijnders PJH, Bosveld ATC. 2000. Polychlorinated biphenyls pattern analysis: Potential nondestructive biomarker in vertebrates for exposure to cytochrome P450-inducing organochlorines. Environ Toxicol Chem 19: 575581.
  • 24
    Rodriguez-Cea A, Del Rosario Fernandez De La Campa M, Sanz-Medel A. 2004. Brown trout as a sentinel organism for organic pollution in the field using catalytic and immunochemical assays of cytochrome P-450 1A. J Environ Monit 6: 368373.
  • 25
    Hakansson H, Johansson L, Manzoor E, Ahlborg UG. 1994. Effect of 2,3,7,8-tetrachlorodibenzoy-p-dioxin on the hepatic 7-ethoxyresorufin O-deethylase activity in four rodent species. Eur J Pharmacol 270: 279284.
  • 26
    Weber LW, Lebofsky M, Stahl BU, Smith S, Rozman KK. 1995. Correlation between toxicity and effects on intermediary metabolism in 2,3,7,8-tetrachlorodibenzo-p-dioxin-treated male C57BL/6J and DBA/2J mice. Toxicol Appl Pharmacol 131: 155162.
  • 27
    Viluksela M, Raasmaja A, Lebofsky M, Stahl BU, Rozman KK. 2004. Tissue-specific effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) on the activity of 5′-deiodinases I and II in rats. Toxicol Lett 147: 133142.
  • 28
    Pohjanvirta R, Kulju T, Morselt AF, Tuominen R, Juvonen R, Rozman K, Mannisto P, Collan Y, Sainio EL, Tuomisto J. 1989. Target tissue morphology and serum biochemistry following 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) exposure in a TCDD-susceptible and a TCDD-resistant rat strain. Fundam Appl Toxicol 12: 698712.
  • 29
    Poland A, Palen D, Glover E. 1994. Analysis of the four alleles of the murine aryl hydrocarbon receptor. Mol Pharmacol 46: 915921.
  • 30
    Yasui T, Kim EY, Iwata H, Franks DG, Karchner SI, Hahn ME, Tanabe S. 2007. Functional characterization and evolutionary history of two aryl hydrocarbon receptor isoforms (AhR1 and AhR2) from avian species. Tox Sci 99: 101117.
  • 31
    Head JA, Hahn ME, Kennedy SW. 2008. Key amino acids in the aryl hydrocarbon receptor predict dioxin sensitivity in avian species. Environ Sci Technol 42: 75357541.
  • 32
    Franc M, Pohjanvirta R, Tuomisto J, Okey AB. 2001. In vivo up-regulation of aryl hydrocarbon receptor expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in a dioxin-resistant rat model. Biochem Pharmacol 62: 15651578.
  • 33
    Haley SL, Lamb JG, Franklin MR, Constance JE, Dearing MD. 2007. Xenobiotic metabolism of plant secondary compounds in oak (Quercus agrifolia) by specialist and generalist woodrat herbivores, genus Neotoma. J Chem Ecol 33: 21112122.
  • 34
    Haley SL, Lamb JG, Franklin MR, Constance JE, Denise Dearing M. 2007. Xenobiotic metabolism of plant secondary compounds in juniper (Juniperus monosperma) by specialist and generalist woodrat herbivores, genus Neotoma. Comp Biochem Physiol C 146: 552560.
  • 35
    Webb RE, Horsfall F Jr. 1967. Endrin resistance in the pine mouse. Science 156: 1762.
  • 36
    Webb RE, Hartgrove RW, Randolph WC, Petrella VJ, Horsfall F Jr. 1973. Toxicity studies in endrin-susceptible and resistant strains of pine mice. Toxicol Appl Pharmacol 25: 4247.
  • 37
    Petrella VJ, Fox JP, Webb RE. 1975. Endrin metabolism in endrin-susceptible and -resistant strains of pine mice. Toxicol Appl Pharmacol 34: 283291.