SEARCH

SEARCH BY CITATION

Keywords:

  • Progesterone;
  • Fathead minnow;
  • Endocrine disruption;
  • Concentrated animal feeding operations;
  • Steroid hormone

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

High concentrations (375 ng/L) of the steroid hormone progesterone (P4) were measured in snowmelt runoff associated with large livestock-feeding operations in Wisconsin. To gain insight into the potential endocrine-disrupting effects of P4 in fish, experiments were conducted to evaluate the effects of short-term exposure to environmentally relevant concentrations of P4 on reproduction and embryonic development in the fathead minnow (Pimephales promelas). For the reproduction assay, groups of reproductively mature fish were exposed for 21 d to nominal concentrations of 0, 10, 100, and 1,000 ng/L P4 in a flow-through system, and various key reproductive endpoints (e.g., egg number, fertilization success) were quantified throughout the exposure period. The embryonic development assay consisted of incubating fathead minnow eggs in static culture to quantify the effects of P4 on early development and hatching success. Progesterone caused dose-dependent decreases in fecundity and fertility and significantly reduced gonadosomatic index and vitellogenin gene expression in females. There were no effects of P4 on early embryonic development or hatching success. Progesterone may be a significant endocrine-disrupting chemical in fish. Environ. Toxicol. Chem. 2012;31:851–856. © 2012 SETAC


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Steroid hormones originating from wastewater treatment plants and agricultural operations contaminate surface waters and drinking water supplies throughout the world 1–3. Livestock-feeding operations are a significant source of steroid hormones in the environment 4. In the United States alone, more than 500 million tons of animal manure is produced annually from concentrated animal-feeding operations 1. Both natural and synthetic steroids, as well as their metabolites, have been detected in association with these facilities 2–6.

In a recent field investigation of the steroid hormones associated with bovine dairy and beef operations in Wisconsin, researchers from the Wisconsin State Laboratory of Hygiene detected progesterone (P4) in spring runoff events at concentrations as high as 375 ng/L 7. Progesterone and other natural and synthetic progestins (norethindrone, megesterol acetate, and others) have previously been measured in surface waters at concentrations ranging from 5 to 199 ng/L and originate primarily from human wastewater treatment plants and concentrated animal-feeding operations (CAFOs) 8–10. Despite the fact that progestins are key regulators of reproduction in fish and other vertebrates 11–15, very few studies have been conducted to determine whether this class of steroid can act as an endocrine-disrupting chemical (EDC). Progesterone itself is not considered to be a biologically active fish steroid. It is, however, a key intermediate in the biosynthesis of several active fish steroids, including androgens (testosterone and 11-ketotestosterone), cortisol, estradiol-17β (E2), and 17α,20β-dihydroxyprogesterone (17α,20β-P) 11.

The present study was performed to evaluate the effects of continuous, environmentally relevant P4 exposure on the fecundity and fertility of fathead minnows using the short-term reproduction assay developed by Ankley et al. 16, as modified by Thorpe et al. 17. Given the important role that progestins play in regulating fish reproductive processes and recent data showing that synthetic progestins can inhibit reproduction in fish 18, 19, we hypothesized that exposure to exogenous P4 would disrupt reproduction in the fathead minnow. To obtain insights into the mechanism of action of P4, hepatic vitellogenin mRNA levels, secondary sexual characteristics, and ovarian cortisol levels were measured in the exposed fish. In addition, to assess further the possible environmental impact of P4 on feral fish populations, newly fertilized fathead minnow eggs were incubated in various doses of P4 to document the effects of P4 exposure on early embryonic development and hatching success.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Chemicals

Progesterone was purchased from Steraloids, Stock solutions of 0.00 (control), 0.15, 1.50, and 15.00 mg/ml P4 were prepared in 70% ethanol and stored at 4°C. These concentrated stock solutions were then diluted with distilled water to the concentrations that allowed for delivery of nominal concentrations at the tank level in the exposure system. Ethanol concentrations were identical in all stocks. The diluted stock solutions were held less than 24 h at room temperature. All other reagents and chemicals were obtained from Sigma-Aldrich, except where indicated below.

Fish

Five-month-old adult fathead minnows were obtained from the Wisconsin State Laboratory of Hygiene and maintained in large groups in a flow-through system at 25 ± 1°C under a 16:8-h, light:dark photoperiod. Fish were fed frozen adult brine shrimp (Brine Shrimp Direct) ad libitum twice daily during a 30-d acclimation period and a 15-d pre-exposure period and throughout the 21-d P4 exposure. During the pre-exposure period, all fish were assessed for reproductive maturity based on the presence of key secondary sexual characteristics (e.g., fat pad, coloration, presence of nuptial tubercles, and ovipositor) and fecundity estimates (see below).

Exposure system and chemical analyses

A flow-through exposure system similar to that described by Ankley et al. 16 was used in the present study. A four-channel, model 07523-90 peristaltic pump (Cole Parmer) delivered the control (ethanol vehicle) and three P4 stock solutions through size L/S 13 Masterflex Norprene tubing (Cole Parmer) to four glass dilution chambers at a rate of 0.5 ml/min. Heated (25 ± 1°C), carbon-filtered water from the city of Madison, Wisconsin, USA, was added to the dilution chambers at a flow rate of 1.5 L/min, which diluted the P4 stock solutions to the target P4 delivery concentrations of 0, 10, 100, and 1,000 ng/L. The water then flowed from each dilution chamber to six replicate 7-L exposure tanks (tank water volume was 6 L). The flow rate into each system tank was 250 ml/min (2.5 tank turnovers per hour). Each dilution chamber and all 24 aquaria in the system were constantly aerated. Each exposure tank contained a 110 mm × 90 mm × 70 mm spawning tile made by cutting a PVC pipe in half lengthwise, the tiles resting on a glass tray (110 mm long × 90 mm wide × 25 mm deep) to collect eggs that did not adhere to the tile. The top of the tray was covered with a metal screen to prevent the fish from eating the eggs that fell into the tray 17.

Target P4 concentrations were confirmed in a preliminary one-week trial by measuring the P4 concentrations in three randomly sampled exposure tanks within each treatment using high-performance liquid chromatography mass spectrometry/mass spectrometry (Wisconsin State Laboratory of Hygiene ESS Organic Chemistry Method 1690; MDL = 1.0 ng/L 7). The measured concentrations of P4 in the 0, 10, 100, and 1,000 ng/L tanks were <MDL, 15.4 ± 7.1, 111.3 ± 23.3, and 987 ± 10.5 ng/L, respectively (mean ± SEM, n = 3). The tanks were aerated and contained spawning apparatus but had no animals. Ethanol vehicle concentrations in the fish tanks were 0.000005% (v/v). Water samples were taken weekly during the 21-d exposure to determine dosing concentrations, but they were lost. However, the same stock solutions and procedures were used in both the preliminary dosing trial and the experimental exposure period; therefore, the reported nominal concentrations are accurate.

Short-term reproduction assay

The short-term reproduction assay consisted of a 15-d pre-exposure period. During this time, fecundity and fertility data were collected daily from 40 groups of fish. Each group consisted of two females and one male. The 40 spawning groups were formed randomly. At the end of the 15-d pre-exposure period, the 24 reproductive groups that showed the most consistent spawning and egg production were selected for the three-week P4 exposure phase of the assay. These 24 groups were allocated to one of four treatments (0, 10, 100, and 1,000 ng/L P4). To prevent bias in egg production by treatment at the start of the exposure, the groups were allocated to their treatments based on their pre-exposure fecundity such that the mean egg production per female-day was balanced among the treatments. For example, the four groups that showed the highest fecundity during the pre-exposure were randomly allocated among the four treatments and so on.

Data on fecundity and fertility were collected daily. Fecundity was defined as the total egg production (eggs attached to the spawning tile, eggs attached to the screen, and eggs found in the tray). The eggs were assessed for fertilization by observing embryonic development under a dissecting microscope (e.g., the presence of a cytoplasmic cap, perivitelline space, developing embryo). Eggs found in the tray apparatus that had succumbed to pathogens (fungus and/or bacteria) for which fertilization was indiscernible were recorded as unfertilized (see Discussion for rationale).

After the 21-d exposure, all fish were euthanized in buffered Finquel (MS-222; Argent Chemical Laboratories). Each fish (male and female) was weighed and scored for the presence of secondary sexual characteristics (e.g., coloring, presence and size of tubercles, and ovipositor). Blood was collected from the caudal vein with heparanized capillary tubes. The gonads were collected and weighed to determine the gonadosomatic index (GSI), then frozen in liquid nitrogen. Female gonads were analyzed for ovarian cortisol content. Livers were collected from the male fish and one randomly selected female from each tank and were then frozen in liquid nitrogen for subsequent vitellogenin (Vtg) mRNA expression.

Embryonic development assay

Fertilized eggs from the control fish were collected from the spawning tiles. Embryos at the same developmental stage (stage 9 or 10) were placed individually into the wells of a 48-well microplate and incubated at 27°C in 500 µl of egg water (60 µg/L salt solution and 300 µg/L methylene blue) containing nominal concentrations of 0, 10, 100, or 1,000 ng/L P4 (n = 12). The developing embryos were observed daily for 5 d, or until hatch, and ranked as 1 = normal, 2 = slightly deformed (discoloration, early signs of necrotic tissue, pericardial edema, cloudy perivitenille space), 3 = severely deformed (expansive necrotic tissue, abnormal development, slowed/erratic blood circulation or heart rate, extreme edema), 4 = dead.

Vitellogenin mRNA analysis

Total RNA was isolated from individual adult livers by using a Qiagen RNeasy Mini Kit according to the manufacturer's protocol. The quality of the RNA was assessed and quantified spectrophotometrically with absorbance measurements at 260 nm with a Molecular Devices Spectramax M5e reader. A subset of samples was chosen for analysis of structural integrity of 28S and 18S rRNA by gel electrophoresis. The cDNA was produced from 1 µg of each RNA sample using Promega's oligo(dT) and random hexamer primers with ImProm-II Reverse Transcriptase, following the manufacturer's protocol. Vitellogenin mRNA analysis was performed using the method of Lattier et al. 20, with modifications. Briefly, quantitative real-time polymerase chain reaction (PCR) was performed using the Light Cycler (Roche Applied Science), with 1 µl of each cDNA sample, 1× DyNAmo Capillary SYBR Green, and 0.5 mM of either vitellogenin or Universal 18S (Ambion) primers, according to the manufacturer's instructions (DyNAmo Capillary SYBR Green qPCR Kit; New England Biolabs). Vitellogenin oligonucleotide primers were synthesized by Integrated DNA Technologies and were in the 5′ to 3′ direction: forward tgacaagccaacagcaagag, reverse ttagccgccataggaatgtg. Real-time quantitative PCR cycling parameters were as follows: 95°C 10 min, followed by 40 cycles of 95°C for 10 s, 60°C for 20 s, and 72°C for 20 s, and a single fluorescent data acquisition for each cycle. After amplification, a melting curve analysis ranging from 57 to 98°C was completed on each run. All data were normalized to 18S expression and calibrated to the standard within each run. 18S and Vtg standards were serial dilutions of a purified PCR product. Gel electrophoresis and thermal denaturation (melt-curve analysis) were used to confirm specific product formation.

Ovarian cortisol concentrations

Ovaries were extracted with ether according to the method of Barry et al. 21, with the exception that recoveries were not estimated using radiolabelled cortisol (it was assumed that all extraction efficiencies were identical and thus differences in ovarian cortisol levels among the treatment groups could be compared). Cortisol was measured by enzyme-linked immunoassay according to Barry et al. 22. The enzyme-linked immunoassay was validated by verifying that serial dilutions of fathead minnow ovarian extracts inhibited the binding of cortisol in parallel with cortisol standards (data not shown).

Data analysis

Data are presented as mean values ± standard errors of the mean (SEM, n = sample size). All data were analyzed with the MIXED procedure in SAS, followed by Dunnett's pairwise comparisons and contrast analysis. Best-fit comparisons of equal and unequal variance models were made using the log-likelihood ratio test. Based on the log-likelihood ratio test results, the most appropriate model (model of equal or unequal variance) was used for the analysis of each particular data set. Significance was set at p ≤ 0.05.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Progesterone exposure significantly decreased fecundity in the 100 ng/L and 1,000 ng/L P4 treatment groups (Fig. 1A). The significant inhibitory effects of P4 on egg production became apparent in all treatments 7 to 11 d after the start of the exposure (Fig. 1B). Over the 21-d period, 87% of the eggs laid in the 1,000 ng/L treatment were laid before day 8, with 62% of the eggs laid on day 2 (Fig. 1B). There was a single mortality, a female in the 10 ng/L treatment that died on day 18. Fecundity data for this tank were treated on a prorated basis (calculation of mean egg production per female per day was reduced by 3 d).

thumbnail image

Figure 1. (A) Effects of progesterone on cumulative fecundity per female during a 21-d experiment. Data are mean values per female (± 21-d standard error) in each treatment group (n = 6). Asterisk denotes significant difference from control. (B) Effects of progesterone on fathead minnow egg production per female reproductive day. Fecundity estimates included the eggs found on the bottom of the spawning tiles plus eggs found in a collection tray under the tiles. Data are mean values ± SEM (n = 6) of eggs per female reproductive day during a 21-d reproduction assay. Asterisks indicate egg productions values significantly different from control.

Download figure to PowerPoint

Progesterone effects on fertilization success (percent fertilization) were analyzed in three groups, including eggs laid on the spawning tiles, dropped eggs (defined as eggs found in or on the tray/screen apparatus), and total eggs (tile and dropped eggs). Exposure to P4 caused a significant decrease in fertilization success in the 1,000 ng/L treatment for eggs laid directly on the spawning tile. No significant treatment effect was evident regarding dropped eggs, but a significant decrease in fertilization success was present in the 10 ng/L P4 treatment when fertilization success of the eggs on the tile and tray were analyzed together (Fig. 2). Progesterone exposure had no effect on any of the endpoints used to assess embryonic development (survival, hatching success, developmental abnormalities, etc.; data not shown).

thumbnail image

Figure 2. Effects of progesterone on mean egg fertililization. Data are presented as mean percent of fertilized eggs ± SEM for the control (n = 5), 10 ng/L treatment (n = 4), 100 ng/L treatment (n = 5), and 1,000 ng/L treatment (n = 3). Asterisks indicate mean fertilization values significantly different from control within their groups (tile, tray, or tile and tray).

Download figure to PowerPoint

Across all treatments, approximately 27% of the spawned eggs were dropped eggs. The percentage of dropped eggs in the 0, 10, 100, and 1,000 ng/L treatment groups were 27.22, 20.38, 30.42, and 21.15%, respectively (data not shown). These differences were not significant. However, including dropped eggs in fecundity estimates increased those estimates and reduced the variance between reproductive groups.

Exposure to 1,000 ng/L of P4 significantly increased the GSI of females relative to controls (Fig. 3A). Progesterone exposure had no effect on male GSI (Fig. 3B). There were no effects of P4 exposure on male or female secondary sexual characteristics. No ovi–testes were observed at the gross morphological level in any fish. Progesterone significantly inhibited Vtg mRNA expression in females in the 10 and 100 ng/L treatment groups (Fig. 4). Progesterone had no effect on Vtg mRNA expression in males (Fig. 4). There was no effect of P4 exposure on ovarian cortisol concentrations (p = 0.54; n = 6, except in the 10 ng/L treatment, in which n = 5; data not shown). The average ovarian cortisol concentration was 190 ng/g of tissue.

thumbnail image

Figure 3. Effects of progesterone exposure on female (A) and male (B) fathead minnow gonadosomatic index (GSI). Data are mean GSI values ± SEM (n = 6 males and females, except n = 5 in 10 ng/L female group). Asterisk indicates a mean GSI value significantly different from control.

Download figure to PowerPoint

thumbnail image

Figure 4. Effects of progesterone exposure on hepatic vitellogenin (Vtg) mRNA expression in female and male fathead minnows following a 21-d exposure. Data are mean ± SEM (n = 6 males and females, except n = 5 in 10 ng/L female group). Asterisks indicate Vtg mRNA values significantly different from control within sex.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

The observation that environmentally relevant concentrations of P4 caused a significant dose-dependent decrease in fathead minnow fecundity indicates that exogenous P4 is an endocrine-active chemical that can have negative impacts on native fish populations downstream from P4 point sources, such as wastewater treatment plants and concentrated animal feeding operations. The effects of P4 were most apparent after 7 to 11 d of exposure. Approximately 62% of eggs produced in the 1,000 ng/L treatment throughout the exposure period were produced by day 3. After day 8, there was a sharp decrease in spawning events in all treatment groups. These data suggest that sustained exposure is likely required for P4 to exert its deleterious effects on fecundity (a minimum of 48 h in the present study).

Fertilization success was assessed in three groups (tile eggs, dropped eggs, and the two previous groups taken together). Progesterone caused a significant decrease in fertilization success for eggs laid directly on the spawning tiles in the 1,000 ng/L treatment group (Fig. 3). Murack et al. 23 recently reported that a one-week exposure of male fathead minnows to P4 caused a significant inhibition of sperm motility at P4 concentrations greater than 300 ng/L. The observation that fertilization success was significantly decreased in the 1,000 ng/L treatment could be a function of P4 effects on male reproductive capacity (decreased sperm motility). No significant difference in fertilization success was observed when analyzing solely the fertilization success of dropped eggs, but when eggs laid on the spawning tile and dropped eggs were analyzed as a group a significant difference in fertilization success in the 10 ng/L treatment was observed (Fig. 2). A major caveat to interpreting these results is that dropped eggs spend some period of time before collection lying in detritus from morning feedings and animal excreta. This is an important factor, because many of these eggs will succumb to pathogens (bacteria or fungus) before being assessed for successful fertilization. As stated in Materials and Methods, eggs that had succumbed to pathogens were recorded as unfertilized, but this does not necessarily mean that they were not successfully fertilized initially and were later overcome by pathogens. The significant decrease in fertilization success observed in analyzing the eggs laid on the tile and dropped eggs as a single group is misleading, insofar as it is likely a function of the less than optimal microenvironment in which eggs exist prior to viewing and not physiological effects caused by P4 exposure. Furthermore, comparisons between the fertilization success of eggs laid on the spawning tile and the fertilization success of dropped eggs are not valid given the completely different environments in which the eggs develop prior to viewing. Hence, the most pertinent and biologically relevant result regarding fertilization success is the significant decrease in fertilization success of eggs laid on the spawning tile in the 1,000 ng/L treatment.

With regard to the potential for chronic exposure, it has been reported that sustained levels of P4 can enter aquatic environments from wastewater treatment plants with concentrations in the range of 5 to 199 ng/L 8. In addition, during a prolonged rain event, P4 could continuously be washed into aquatic environments from concentrated animal feeding operations at concentrations as high as 375 ng/L 7. Given these high levels and the ubiquitous presence of P4 in the environment and its effects on fish reproduction, we conclude that P4 is a significant EDC that warrants more attention from investigators and managers.

The mechanism by which P4 inhibited reproduction in the fathead minnow is not known. Progesterone itself is not generally considered to be an important reproductive steroid in fish, although it has been shown to have some binding affinity for the progestin receptors (e.g., mαPR) that mediate gamete maturation and sperm motility 24–27 and thus could potentially have direct effects on fathead minnow reproduction. Progesterone is a key intermediate in biosynthetic pathways that lead to the production of several important fish reproductive steroids, including androgens, estrogens, cortisol, and other progestins 11–15. It was hypothesized, therefore, that P4 acts primarily at one or more levels of the hypothalamic–pituitary–gonadal axis after being converted into one or more of these biologically active fish reproductive steroids.

Neither masculinized females nor signs of increased or decreased masculinization in males were observed in the present study, suggesting that P4 was probably not converted to a terminal androgen. Nor is it likely, based on this observation, that P4 was exerting its effects on fecundity through androgenic signaling pathways, a mechanism by which certain synthetic progestins (levonorgestrel and norethindrone) have been proposed to reduce fecundity in the fathead minnow 18, 19. The observed inhibitory effects of P4 on Vtg mRNA expression in females and the lack of Vtg gene induction in males constitute evidence that P4 probably is not converted into an estrogen such as E2. Indeed, there was a significant inhibition of Vtg mRNA expression in the females exposed to 10 and 100 ng/L of P4, suggesting that P4 can directly or indirectly interfere with normal estrogen signaling pathways or estrogen production. It is not certain why Vtg expression was reduced at 10 and 100 ng/L, but not at 1,000 ng/L, although many examples of nonmonotonic dose–response curves can be found in the literature. Often, higher doses can exert pharmacological rather than physiological effects, which might be the case here.

With regard to cortisol, it is well established that ovarian steroid levels reflect circulating concentrations 28–30, so the absence of a change in cortisol concentration in the ovaries of the P4-exposed females suggests that P4 was not converted into this corticosteroid, which is a known inhibitor of reproduction in fish 31, 32. Ovarian cortisol levels were measured instead of circulating levels to avoid complications associated with acute stress-induced cortisol production 28–30.

The fact that exposed females laid fewer eggs and had higher GSIs than control fish suggests that the primary effect of P4 on fathead minnow reproduction was the inhibition of spawning and not oocyte recrudescence per se. A full histological analysis of both female and male gonads would help to elucidate the mechanism of action responsible for the decreases in fecundity observed here. However, 17α,20β-P is the key steroidal mediator of final gamete maturation, ovulation, and spawning in most teleosts, including the fathead minnow 11–15, 27, 33–36. This steroid is readily synthesized from P4, and it is reasonable to postulate that the observed effects of P4 on fathead minnow fecundity in the present study were mediated through the 17α,20β-P pathway. Although additional research is required before definitive conclusions can be drawn, including measuring the circulating levels of 17α,20β-P in P4-exposed fish and full histological examination of gonads, the current data suggest that the primary mechanism by which P4 inhibits spawning in fathead minnows is via interference with the synthesis or actions of 17α,20β-P.

The use of the egg tray apparatus under the spawning tiles was an important modification to the 21-d reproduction assay that increased fecundity estimates by 27% and homogenized variance between treatment groups, thereby improving the power of statistical analyses. This modification also permits screening of chemicals that might reduce egg adhesion to the spawning tile or alter egg-laying behaviors, two endpoints that would otherwise be interpreted incorrectly as decreased fecundity if operating under the original suggested guidelines for the fish short-term reproduction 21-d assay. Although the use of the tray apparatus is an essential addition with regard to quantifying fecundity in fish reproduction assays, care must be taken when interpreting fertilization data for the reasons discussed above.

In conclusion, environmentally relevant concentrations of P4 inhibited fecundity in the fathead minnow but had no observable effects on embryonic development. Reductions in egg production, in general, were seen in all treatments after one week of P4 exposure, but only the 100 and 1,000 ng/L treatments were significant. In addition, P4 exposure significantly reduced fertilization success of eggs laid on the spawning substrate in the 1,000 ng/L treatment. These data suggest that P4 is an endocrine-active compound of concern, having the capacity to affect the reproduction of fathead minnows deleteriously. Additional research is required to understand more fully the impact of exogenous P4 on fish reproduction. For example, measuring the circulating levels of various steroid hormones in the blood of P4-exposed fish (especially17α,20β-P) would provide insights into mechanisms of action. Additional dose–response and depuration experiments could be used to determine the minimum dose and exposure duration required for P4 to exert its physiological effects. Finally, investigations of exposures to steroid mixtures are required to understand the full impact of hormones associated with livestock-feeding operations on downstream fish populations in a more ecologically relevant context.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES

Although the research described in the present study has been funded wholly or in part by the U.S. Environmental Protection Agency (U.S. EPA) through grant/cooperative agreement (R833421; to J.D.C. Hemming), it has not been subjected to the U.S. EPA's required peer and policy review and therefore does not necessarily reflect the views of the Agency, and no official endorsement should be inferred. The authors thank M.D. Kahl, K.M. Jensen, D.L. Villenueve, and others at the U.S. EPA Mid-Continental Ecology Division, Duluth, MN, for their help in designing our exposure system and for their training in the fish short-term reproduction assay. In addition, the authors thank D. West and M. Lasecki for their contributions to the present study. We also thank P. Crump from the University of Wisconsin—Madison for his aid with the statistical analyses. Finally, we thank W. Karasov and the Karasov laboratory group for valuable comments on earlier versions of the manuscript.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  • 1
    U.S. Environmental Protection Agency. 1998. Endocrine disruption screening and testing advisory committee final report. Washington, DC.
  • 2
    Combalbert S, Hernandez-Raquet G. 2010. Occurrence, fate, and biodegradation of estrogens in sewage and manure. Appl Microbiol Biotechnol 86: 16711692.
  • 3
    Schiffer B, Daxenberger A, Meyer K, Meyer HH. 2001. The fate of trenbolone acetate and melengestrol acetate after application as growth promoters in cattle: Environmental studies. Environ Health Perspect 109: 11451151.
  • 4
    Lange IG, Daxenberger A, Schiffer B, Witters H, Ibarreta D, Meyer H. 2002. Sex hormones originating from different livestock production systems: Fate and potential disrupting activity in the environment. Anal Chim Acta 473: 2737.
  • 5
    Durhan EJ, Lambright CS, Makynen EA, Lazorchak J, Hartig PC, Wilson VS, Gray LE, Ankley GT. 2005. Identification of metabolites of trenbolone acetate in androgenic runoff from a beef feedlot. Environ Health Perspect 114: 6568.
  • 6
    Soto AM, Calabro JM, Prechtl NV, Yau AY, Orlando EF, Daxenberger A, Kolok AS, Guillette LJ, le Bizec B, Lange IG, Sonnenschein C. 2004. Androgenic and estrogenic activity in water bodies receiving cattle feedlot effluent in Eastern Nebraska, USA. Environ Health Perspect 112: 346352.
  • 7
    Havens SM, Hedman CJ, Hemming JDC, Mieritz MG, Shafer MM, Schauer JJ. 2010. Stability, preservation and quantification of hormones and estrogenic and androgenic activities in surface water runoff. Environ Toxicol Chem 29: 24812490.
  • 8
    Kolpin DW, Furlong ET, Meyer MT, Thurman EM, Zaugg SD, Barber LB, Buxton HT. 2002. Pharmaceuticals, hormones, and other organic wastewater contaminants in U.S. streams, 1999–2000: A national reconnaissance. Environ Sci Technol 36: 12021211.
  • 9
    Kolodziej EP, Sedlak DL. 2007. Rangeland grazing as a source of steroid hormones to surface waters. Environ Sci Technol 41: 35143520.
  • 10
    Chang H, Wan Y, Wu S, Fan Z, Hu J. 2011. Occurrence of androgens and progestogens in wastewater treatment plants and receiving river waters: Comparison to estrogens. Water Res 45: 732740.
  • 11
    Nagahama Y. 1994. Endocrine regulation of gametogenesis in fish. Int J Dev Biol 38: 217229.
  • 12
    Nagahama Y, Yamashita M. 2008. Regulation of oocyte maturation in fish. Development 50: S195S219.
  • 13
    Miura C, Higashino T, Miura T. 2007. A progestin and an estrogen regulate early stages of oogenesis in fish. Biol Reprod 77: 822828.
  • 14
    Scott AP, Sumpter JP, Stacey N. 2010. The role of the maturation-inducing steroid, 17,20β-dihydroxypregn-4-en-3-one, in male fishes: A review. J Fish Biol 76: 183224.
  • 15
    Tubbs C, Pace M, Thomas P. 2010. Expression and gonadotropin regulation of membrane progestin receptor alpha in Atlantic croaker (Micropogonias undulatus) gonads: Role in gamete maturation. Gen Comp Endocrinol 165: 144154.
  • 16
    Ankley G, Jensen K, Kahl M, Korte J, Makynen E. 2001. Description and evaluation of a short-term reproduction test with the fathead minnow (Pimephales promelas). Environ Toxicol Chem 20: 12761290.
  • 17
    Thorpe KL, Benstead R, Hutchinson TH, Tyler CR. 2007. An optimised experimental test procedure for measuring chemical effects on reproduction in the fathead minnow, Pimephales promelas. Aquat Toxicol 81: 9098.
  • 18
    Zeilinger J, Steger-Hartmann T, Maser E, Goller S, Vonk R, Länge R. 2009. Effects of synthetic gestagents on fish reproduction. Environ Toxicol Chem 28: 26632670.
  • 19
    Paulos P, Runnalls TJ, Nallani G, La Point T, Scott AP, Sumpter JP, Huggett DB. 2010. Reproductive responses in fathead minnow and Japanese medaka following exposure to a synthetic progestin, norethindrone. Aquat Toxicol 99: 256262.
  • 20
    Lattier DL, Reddy TV, Gordon DA, Lazorchak JM, Smith ME, Williams DE, Wiechman B, Flick RW, Miracle AL, Toth GP. 2002. 17α-Ethynylestradiol-induced vitellogenin gene transcription quantified in livers of adult males, larvae, and gills of fathead minnows (Pimephales promelas). Environ Toxicol Chem 21: 23852393.
  • 21
    Barry TP, Ochiai M, Malison JA. 1995. In vitro effects of ACTH on interrenal corticosteroidogenesis during early larval development in rainbow trout. Gen Comp Endocrinol 99: 382387.
  • 22
    Barry TP, Lapp AF, Kayes TB, Malison JA. 1993. Validation of a microtitre plate ELISA for measuring cortisol in fish and comparison of stress responses of rainbow trout (Oncorhynchus mykiss) and lake trout (Salvelinus namaycush). Aquaculture 117: 351363.
  • 23
    Murack PJ, Parrish J, Barry TP. 2011. Effects of progesterone on sperm motility in fathead minnow (Pimephales promelas). Aquat Toxicol 104: 121125.
  • 24
    Zhu Y, Rice CD, Pang Y, Pace M, Thomas P. 2003. Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes. Proc Natl Acad Sci U S A 100: 22312236.
  • 25
    Thomas P, Zhu Y, Pace M. 2002. Progestin membrane receptors involved in the meiotic maturation of teleost oocytes: A review with some new findings. Steroids 67: 511517.
  • 26
    Thomas P, Dressing G, Pang Y, Berg H, Tubbs C, Benninghoff A, Doughty K. 2006. Progestin, estrogen and androgen G-protein coupled receptors in fish gonads. Steroids 71: 310316.
  • 27
    Yaron Z. 1995. Endocrine control of gametogenesis and spawning induction in the carp. Aquaculture 129: 4973.
  • 28
    Hwang P-P, Wu S-M, Lin J-H, Wu L-S. 1992. Cortisol content of eggs and larvae of teleosts. Gen Comp Endocrinol 86: 189196.
  • 29
    Stratholt ML, Donaldson EM, Liley NR. 1997. Stress induced elevation of plasma cortisol in adult female coho salmon (Oncorhynchus kisutch), is reflected in egg cortisol content, but does not appear to affect early development. Aquaculture 158: 141153.
  • 30
    Tagawa M, Suzuki K, Specker JL. 2000. Incorporation and metabolism of cortisol in oocytes of tilapia (Oreochromis mossambicus). J Exp Zool 287: 485492.
  • 31
    Carragher JF, Sumpter JP, Pottinger TG, Pickering AD. 1989. The deleterious effects of cortisol implantation on reproductive function in two species of trout, Salmo trutta L. and Salmo gairdneri Richardson. Gen Comp Endocrinol 76: 310321.
  • 32
    Pankhurst NW, Van Der Kraak G. 2000. Evidence that acute stress inhibits ovarian steroidogenesis in rainbow trout in vivo, through the action of cortisol. Gen Comp Endocrinol 117: 225237.
  • 33
    Dulka JG, Stacey NE, Sorensen PW, Kraak GJVD. 1987. A steroid sex pheromone synchronizes male–female spawning readiness in goldfish. Nature 325: 251253.
  • 34
    Stacey N, Sorensen P. 2005. Reproductive Pheromones. In Sloman KA, Wilson RW, Balshine S, eds, Fish Physiology, Vol 24: Behavior and Physiology of Fish. Academic Press, New York, NY, USA, pp 359412.
  • 35
    Lister AL, Van Der Kraak GJ. 2009. Regulation of prostaglandin synthesis in ovaries of sexually-mature zebrafish (Danio rerio). Mol Reprod Dev 76: 10641075.
  • 36
    Appelt CW, Sorensen PW. 2007. Female goldfish signal spawning readiness by altering when and where they release a urinary pheromone. Anim Behav 74: 13291338.