SEARCH

SEARCH BY CITATION

Keywords:

  • Perfluorooctane sulfonate;
  • Reporter gene assay;
  • H295R steroidogenesis assay;
  • Zebrafish embryo;
  • Endocrine disruptor

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

Perfluorooctane sulfonate (PFOS) is a widespread and persistent chemical in the environment. We investigated the endocrine-disrupting effects of PFOS using a combination of in vitro and in vivo assays. Reporter gene assays were used to detect receptor-mediated (anti-)estrogenic, (anti-)androgenic, and (anti-)thyroid hormone activities. The effect of PFOS on steroidogenesis was assessed both at hormone levels in the supernatant and at expression levels of hormone-induced genes in the H295R cell. A zebrafish-based short-term screening method was developed to detect the effect of PFOS on endocrine function in vivo. The results indicate that PFOS can act as an estrogen receptor agonist and thyroid hormone receptor antagonist. Exposure to PFOS decreased supernatant testosterone (T), increased estradiol (E2) concentrations in H295R cell medium and altered the expression of several genes involved in steroidogenesis. In addition, PFOS increased early thyroid development gene (hhex and pax8) expression in a concentration-dependent manner, decreased steroidogenic enzyme gene (CYP17, CYP19a, CYP19b) expression, and changed the expression pattern of estrogen receptor production genes (esr1, esr2b) after 500 µg/L PFOS treatment in zebrafish embryos. These results indicate that PFOS has the ability to act as an endocrine disruptor both in vitro and in vivo by disrupting the function of nuclear hormone receptors, interfering with steroidogenesis, and altering the expression of endocrine-related genes in zebrafish embryo. Environ. Toxicol. Chem. 2013;32:353–360. © 2012 SETAC


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

Perfluorinated compounds (PFCs) are synthetic fully fluorinated organic compounds that have been widely used for more than 60 years as surfactants in industrial, commercial, and household applications 1, 2. They have been identified in various environmental sectors, including air, soil, river water 3, dust 4, and even remote polar areas 5. Perfluorooctane sulfonate (PFOS) is a stable degradation product or metabolite, or both, of many PFCs. An increasing number of studies report high levels of PFOS in the environment, as well as in human samples such as blood, tissues, and breast milk 6–8. This compound may accumulate through the food chain. It is well absorbed orally and slowly eliminated from the human body, with a half-life of 8.7 years in humans 9. The widespread distribution and persistence of this compound in humans and the environment have generated great concern about potential health impacts.

Exposure to PFOS is known to cause multiple adverse health outcomes, including developmental toxicity, immunotoxicity, and hepatotoxicity 10, 11. There is growing evidence that PFOS may disrupt the endocrine system 12, 13. In addition, PFOS and other PFCs have been shown to induce estrogen-dependent vitellogenin (VTG) production in primary-cultured tilapia hepatocytes 14. Using juvenile rainbow trout in vivo, structure–activity relationship analysis, and estrogen receptor (ER)-dependent transcriptional activation assay, several PFCs including PFOS were shown to be weak environmental xenoestrogens 15. Decreased serum and testicular interstitial fluid testosterone levels and increased serum estradiol levels were noted in PFOS-exposed adult male CD rats 16. Plasma androgens and estrogens were also altered in PFOS-treated fathead minnows 17. Serum thyroxine (T4) and triiodothyronine (T3) were reduced by PFCs in animal studies 18, 19. A recent study on the general adult population in the United States has suggested that higher concentrations of serum PFOS are associated with thyroid disease 20. Therefore, further characterization of the endocrine-disrupting effects of PFCs is required for assessing potential health risks.

The growing concern over endocrine-disrupting chemicals (EDCs) has emphasized the need for a battery of screening assays that can address the potential effects on human health. The most recognized way by which EDCs disrupt the physiological process is through interaction with nuclear hormone receptors (NRs). Meanwhile, chemicals can exert their effects via other mechanisms; they can affect the steroidogenic genes, which would probably disrupt production of hormones. Reporter gene assay has been established as a powerful tool for testing receptor agonists and antagonists among chemicals. The H295R cell line can express most of the key enzymes and functional proteins in the steroidogenesis pathway 21. This cell line has been shown to be a potential in vitro model for screening adverse effects of chemicals on steroidogenesis 22. The results from in vitro studies should be verified by in vivo studies. The zebrafish embryo has become a systematic, sensitive, and easily operated model system for assessing chemicals that function as endocrine disrupters. Some zebrafish genes such as CYP19a, CYP19a, and Esr1 are well-known biomarker genes responsive to xenobiotics 23, 24. Therefore, a combined in vitro and in vivo approach is a useful way to gain a complete understanding of the activities of endocrine disrupters.

To investigate the endocrine disruption potencies of PFOS, a combination of in vitro and in vivo assays was employed in the present study. Reporter gene assays were used to detect receptor-mediated (anti-)estrogenic, (anti-)androgenic, and (anti-)thyroid hormone activities of PFOS. The steroidogenic effects of PFOS were measured at both the hormone and gene levels in the human adrenocortical carcinoma cell line H295R. Additionally, a zebrafish-based short-term screening method was developed to detect the potential effect of PFOS on endocrine function in vivo. Our research focused on a detailed characterization of PFOS in an attempt to determine the endocrine-disrupting effects of this chemical.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

Chemicals

Forskolin, prochloraz, and PFOS were purchased from Sigma. The purities of all chemicals were ≥ 98%. Stock solutions of these chemicals were prepared in dimethylsulfoxide (DMSO) at a concentration of 0.1M and stored at –20°C. They were diluted to desired concentrations in culture medium immediately before use. The final concentration of DMSO in the culture medium did not exceed 0.1% (v/v).

Cell line and plasmids

African green monkey kidney cell line CV-1 and the H295R human adrenocortical carcinoma cell line were obtained from Cell Resource Center (IBMS, CAMS/PUMC, Beijing, China). The MDA-kb2 cell line was purchased from the American Type Culture Collection. The luciferase reporter plasmids pERE-TATA-Luc+ including three copies of estrogen-responsive element and rERα/pCI containing rat ERα cDNA were used in the ER reporter gene assay. The thyroid hormone receptor β (TRβ) expression plasmid pGal4-L-TRβ and the Gal4-responsive luciferase reporter plasmid pUAS-tk-Luc were used in the TR reporter gene assay. Details of plasmids were previously described 25. The plasmid phRL-tk, which was used as an internal control for transfection efficiency and the cytotoxicity of PFOS, was purchased from Promega.

Cell culture and MTT assay

The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was performed to detect the cytotoxicity of the tested chemical. CV-1 cells were maintained in Dulbecco's modified Eagles medium (DMEM) with 10% fetal bovine serum (Gibco, Invitrogen), 100 U/ml penicillin (Sigma), and 100 µg/ml streptomycin (Sigma) at 37°C, 5% CO2. The MDA-kb2 cell line was maintained at 37°C without CO2 in Leibovitz's L-15 medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin (Sigma), 100 µg/ml streptomycin (Sigma), and 0.25 µg/ml amphotericin B (Sigma). The H295R cells were maintained in DMEM/F12 medium supplemented with 1.2 g/L Na2CO3, 2.5% Nu-serum I (BD Biosciences), 1% Insulin-transferrin-sodium selenite (ITS) + Premix (BD Biosciences), and 100 U/ml penicillin (Sigma), 100 µg/ml streptomycin (Sigma) in a 37°C, 5% CO2 incubator. The CV-1 cells, MDA-kb2 cells, and H295R cells were collected and plated at a density of 1 × 104 cells/100 µl in each well of 96-well plates for MTT assays. After 24 h, cells were treated with vehicle or various concentrations of the tested chemical. These cells were incubated at 37°C for 24 h. Then 25 µl of MTT (5 mg/ml in phosphate-buffered saline; Sigma-Aldrich) was added to the culture medium in each well and cells were incubated continuously at 37°C for another 4 h. Finally culture, media (including MTT solutions) were replaced with 150 µl DMSO. Plates were gently shaken for 10 min, and absorbance at 570 nm was measured using an EL808 Bio-Tek plate reader.

Reporter gene assays

For ER and TR reporter gene assays, CV-1 cells were placed in 48-well microtiter plates at a density of 0.5 × 105 cells per well in the phenol red-free DMEM medium containing 10% charcoal–dextran-stripped fetal bovine serum (Sigma) and incubated for 12 h. Then 0.5 µg of pERE-TATA-Luc + , 0.2 µg of rERα/pCI, and 0.1 µg of phRL-tk (ER reporter gene assay) or 0.25 µg pUAS-tk-luc, 0.1 µg pGal4-L-TR, and 0.05 µg of phRL-tk (TR reporter gene assay) using 2.5 µg Sofast (Sunma) transfection reagent were added into each well. After another 12-h incubation, for agonistic activity tests, cells were treated with various concentrations of PFOS, estradiol (E2; 10−11–10−7 M), or T3 (10−11–10−6 M; positive control), or 0.1% DMSO (negative control); for antagonistic activity, cells were treated with various concentrations of PFOS with 1 × 10−9 M E2 or 5 × 10−9 M T3. The DMSO concentrations in each well never exceeded 0.1% (v/v). The MDA-kb2 cell line used in the androgen receptor (AR) reporter gene assay was plated at a density of 1 × 104 cells/well in 100 µl of medium in 96-well microplates. After the cells were attached (4–6 h later), they were treated with different concentrations of PFOS with or without 1 × 10−9 M dihydrotestosterone (DHT), different concentrations of 5α-DHT (10−12–10−7 M; positive control), or 0.1% DMSO (negative control). The CV-1 and MDA-kb2 cells were harvested after the 24-h treatment. After being rinsed three times with phosphate-buffered saline, these cells were lysed with 1× passive lysis buffer (Promega). The cells were analyzed immediately using a 96-well plate luminometer (Berthold Detection System). The amounts of luciferase and Renilla luciferase were measured with the luciferase reporter assay system kit (Promega). Three independent experiments with triplicate wells were run for each treatment. The relative transcriptional activity was converted to fold induction above the corresponding vehicle control value (n-fold).

H295R steroidogenesis assay

The H295R cells were cultured for a minimum of five passages using new NCI-H295R batches prior to exposure to the tested chemical The cells were grown at a density of 3 × 105 cells/ml in 1 ml vol/well in 24-well plates and allowed to settle down for 24 h. Culture medium was removed and new medium containing different concentrations (3 × 10−9–3 × 10−7 M) of PFOS was added. Cells treated with only DMSO (0.1%) were set as solvent control (SC). Model inducer forskolin and model inhibitor prochloraz treatments were set as positive control. After the 48-h incubation, the medium was removed and stored at –70°C until testosterone (T) and E2 assays. Frozen medium was extracted with diethyl ether before hormone measurement. Hormone levels were measured using radioimmunoassay kits (Beijing North Institute of Biological Technology). Detection limits for E2 and T were 5 to 4,000 pg/ml and 0.1 to 20 ng/ml, respectively. The mean intra- and interassay coefficients of variation for two hormones in standard curves were all between 2 and 6%. Total protein content per well was assayed using the BCA Protein Assay Reagent (Biyuntian) to adjust E2 and T levels. The relative evaluations were conducted on hormone data normalized to the SC values. For relative increase evaluation, results were expressed as fold change relative to the SC. For relative decrease evaluation, results were expressed as the percentage of change relative to the SC.

To measure the expression of genes involved in steroidogenesis using quantitative real-time polymerase chain reaction (Q-RT-PCR), H295R cells were grown at a density of 1 × 106 cells/ml in 2 ml vol/well in six-well plates and treated the same as before. After the exposure period, total RNA was isolated from cells harvested from each single well using Trizol reagent following the manufacturer's protocol. Each exposure was repeated at least three times. Three RNA replicates for each treatment were isolated from three different wells. First-strand complementary DNA (cDNA) was synthesized using 500 ng RNA of each sample in a total volume of 10 µl reaction mixture containing 5× PrimeScript RT Master Mix for 37°C 15 min, 85°C for 5 s, and 4°C for 10 min (TaKaRa). The modulation of 10 major genes involved in the synthesis of steroid hormones (CYP11A, CYP11B2, CYP17, CYP19, CYP21, 17βHSD1, 17βHSD4, 3βHSD2, HMGR, and StAR) after exposure was investigated using Q-RT-PCR. The PCR conditions, including sense and antisense primers, have been described by Hilscherova et al. 26. See Table 1 for primer sequences. All oligonucleotide primers were synthesized by Invitrogen. The cDNA samples were quantified on the ABI 7300 System in a total volume of 20 µl of reaction mixture containing 2 µl of cDNA product, 10 µl of SYBR mix,7.2 µl of nuclease-free distilled water, and 0.4 µl of each primer (10 µmol/L). The Q-RT-PCR was performed in sterile 96-well PCR plates. Amplification began with a reincubation at 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 63°C for 30 s, and extension at 72°C for 10 s. The 2–ΔΔCt method was used to calculate the relative abundance. The β-actin mRNA was used as the internal control for each sample and the Ct value for each sample was normalized against that of β-actin mRNA. All data were analyzed as fold induction compared to the control. Gene expression was measured at least in triplicate for each treatment.

Table 1. Primer sequences of the genes tested in the H295R cell and zebrafish study
Gene nameSequence of the primers (5′–3′)Accession no.
ForwardReverse
H295RCYP11AGAGATGGCACGCAACCTGAAGCTTAGTGTCTCCTTGATGCTGGCNM_000781
CYP11B2TCCAGGTGTGTTCAGTAGTTCCGAAGCCATCTCTGAGGTCTGTGNM_000498
CYP17AGCCGCACACCAACTATCAGTCACCGATGCTGGAGTCAACNM_000102
CYP19AGGTGCTATTGGTCATCTGCTCTGGTGGAATCGGGTCTTTATGGNM_000103
CYP21CGTGGTGCTGACCCGACTGGGCTGCATCTTGAGGATGACACNM_000500
17βHSD1CTCCCTCTGACCAGCAACCTGTGTCTCCCACGCAATCTCNM_000413
17βHSD4TGCGGGATCACGGATGACTCGCCACCATTCTCCTCACAACTCNM_000414
3βHSD2TGCCAGTCTTCATCTACACCAGTTCCAGAGGCTCTTCTTCGTGNM_000198
HMGRTGCTTGCCGAGCCTAATGAAAGAGAGCGTTCGTGGGTCCATCNM_000859
StARGTCCCACCCTGCCTCTGAAGCATACTCTAAACACGAACCCCACCNM_000349
ZebrafishCYP17GACAGTCCTCCGCACATCTGCATGATGGTGGTTGTTCAAY281362
CYP19aCTATTCTGGTGGCTCTGCTGTCTGTTGTTGGTTTGCGGGATGAF226620
CYP19bGGCAGTCTCTGGAGGATGACCAGTGTTCTCGAAGTTCTCCAAY780257
esr1CAGGACCAGCCCGATTCCTTAGGGTACATGGGTGAGAGTTTGNM_152959
esr2bCGCTCGGCATGGACAACCCCATGCGGTGGAGAGTAATAAH86848
hhexGGTAAGCCTCTGCTGTGGTCTCTTCTCCAGCTCGATGGTTNM_130934
pax8GAAGATCGCGGAGTACAAGCCTGCACTTTAGTACGGATGAAF072549
β-actinCGAGCAGGAGATGGGAACCCAACGGAAACGCTCATTGCAF057040

Zebrafish embryo assay

Wild-type adult male and female zebrafish (Danio rerio), obtained from the Model Animal Center of Nanjing University, were maintained on a 14:10-h light–dark cycle at 28°C under semistatic conditions with charcoal-filtered water. Spawning was induced in the morning when the light was turned on. Fertilized eggs were collected 30 min later and examined under the microscope. Only those that had developed normally were selected. Embryos were incubated with embryo medium (0.137 M NaCl, 5.4 mM KCl, 0.25 mM Na2HPO4, 0.44 mM KH2PO4, 1.3 mM CaCl2, 1.0 mM MgSO4, and 4.2 mM NaHCO3) in Petri dishes for subsequent experiments. Zebrafish embryos at 4 h post fertilization (hpf) were exposed to 100 µg/L (2.0 × 10−7 M), 200 µg/L (4.0 × 10−7 M), and 500 µg/L (1.0 × 10−6 M) PFOS and 0.001% DMSO (control). Embryo medium was replaced every day. The embryos' survivals and the stage of embryonic development were recorded daily. They were collected at 120 hpf, quick-frozen, and stored at –70°C until further analysis (40 embryos/pool, three independent embryo pools/treatment).

Whole embryos were extracted using Trizol reagent. Total RNA was resuspended in 20 µl of diethyl pyro-carbonate–treated water and stored at –70°C until use. cDNA synthesis and Q-RT-PCR were performed as mentioned before. Primers specific for CYP17, CYP19a, CYP19b, esr1, esr2b, hhex, pax8, and β-actin were designed on cDNA sequences encoding zebrafish in GenBank (Table 1). The housekeeping gene β-actin was selected because of its consistent expression in zebrafish. The 2–ΔΔCt method was used to calculate the relative abundance. All data were statistically analyzed as fold inductions compared to DMSO control.

Statistical analyses

To compare the statistical significance of PFOS treatments on transcriptional activity, hormone production, and gene expression to those observed in the SC, the relative increase/decrease ratios were analyzed. Data were tested for homogeneity of variance and normality first, and then analyzed by analysis of variance followed by Dunnet's test using SPSS 17.0. The level of significance was set at p < 0.05.

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

Hormone receptor activities of PFOS

The cytotoxic concentrations of PFOS were determined by MTT assay before receptor assays were performed. Exposure to PFOS (3 × 10−9–3 × 10−7 M) did not affect the viability and proliferation of CV-1 and MDA-kb2 cells, with or without E2, DHT, and T3 (Supplemental Data, Fig. S1). The cytotoxicity of the chemical was assessed by the expression of Renilla luciferse produced by the plasmid phRL-tk, which was cotransfected to the cells throughout the transfection assay. There was no significant difference between the tested group and the vehicle control group in the expression of Renilla luciferase.

In the present study, the concentrations at which E2, DHT, and T3 could induce luciferase activities were the same amounts that we have reported previously 25. The maximal ER activity induced by E2 was 15.8-fold of vehicle control at a concentration of 10−7 M. For DHT, luciferase activity was significantly increased at 10−10 M. The maximal induction by DHT was 9.9-fold of vehicle control, which was achieved at a concentration of 10−7 M. The maximal induction, of 211.5-fold, was induced by T3 at a concentration of 10−7 M.

Estrogenic activity of PFOS is shown in Figure 1A. PFOS had no effect on reporter gene expression compared to E2 alone, whereas cotreatment of PFOS with 1 × 10−9 E2 produced additive effects. This compound induced estrogenic activity in a concentration-dependent manner ranging from 3 × 10−9 M to 3 × 10−7 M. The maximal induction of greater than 12-fold of vehicle control was achieved at a concentration of 3 × 10−7 M PFOS. These data indicate that PFOS acted additively to activate ERα.

thumbnail image

Figure 1. (A) Estrogenic activity of perfluorooctane sulfonate (PFOS) in the ERα reporter gene assay using CV-1 cells that were transfected with pERE-TATA-Luc and rERα/pCI. Cells were treated with tested compound in the concentrations from 3 × 10−9 M to 3 × 10−7 M with 1 × 10−9 M E2. (B) Anti-thyroid hormone activity of PFOS in TR-mediated reporter gene assay with CV-1 cells transiently transfected with pUAS-tk-luc and pGal4-L-TR. Cells were treated with 3 × 10−9 M to 3 × 10−7 M of PFOS with 5 × 10−9 M T3. Data are presented as mean fold induction compared to vehicle control. Values are mean ± standard error of at least three independent experiments. Asterisks indicate significant differences at p < 0.05.

Download figure to PowerPoint

No detectable androgenic and antiandrogenic activity in MDA-kb2 cells was found at the tested concentration of PFOS. The cells showed no TR agonistic activity in the TR reporter gene assay. The inhibitory effect of TR was tested by incubating cells with 5 × 10−9 M T3, as shown in Figure 1B. PFOS suppressed the expression of luciferase at concentrations of 1 × 10−7 M and 3 × 10−7 M.

H295R steroidogenesis assay

The H295R cells were exposed to PFOS for 48 h. This chemical induced E2 production and reduced T production in a concentration-dependent manner (Fig. 2). Levels of E2 were significantly increased, by 1.7-, 2.1-, and 2.2-fold, in the supernatant of H295R cells exposed to 3 × 10−8 M, 1 × 10−7 M, and 3 × 10−7 M PFOS, respectively (all p < 0.05). At 1 × 10−7 M and 3 × 10−7 M PFOS exposure, T levels were significantly decreased, to 76.8 and 68.9% of the control (both p < 0.05).

thumbnail image

Figure 2. The effects of perfluorooctane sulfonate (PFOS) on hormone production in H295R cells. For relative increase or decrease evaluations, results of PFOS treatment hormone data are expressed as fold or % change relative to solvent control (SC; 0.1% dimethylsulfoxide) values, respectively. The level of significance was set at *p < 0.05. T = testosterone; E2 = estradiol.

Download figure to PowerPoint

Expression levels of 10 steroidogenic genes were measured using Q-RT-PCR. Statistically significant differences were found among the treatment groups and the control for most of the genes measured (Fig. 3). The expression pattern of the 10 steroidogenic genes was altered after PFOS exposure. Expression levels of HMGR, StAR, CYP11A, CYP19, 3βHSD2, and CYP11B2 were elevated to 2.5-, 1.6-, 1.9-, 2.2-, and 1.67-fold, respectively, at the concentrations tested. For CYP17, 17βHSD1, and CYP21, the relative responses were suppressed to 41.8, 69.2, and 86.7%, respectively, of the controls at 3 × 10−7 M PFOS. Expression of CYP21 mRNA was downregulated by 58.4% at 3 × 10−8 M PFOS exposure. PFOS inhibited 17βHSD4 expression only at a concentration of 3 × 10−9 M.

thumbnail image

Figure 3. The effects of perfluorooctane sulfonate (PFOS) on steroidogenic gene expression in H295R cells. The expression levels of 10 steroidogenic genes were determined by quantitative real-time polymerase chain reaction (Q-RT-PCR). Quantification was performed on three independent experiments. Data are expressed as fold of dimethylsulfoxide-treated cells (control). Significant differences between treatment group and the corresponding control group are indicated by *p < 0.05.

Download figure to PowerPoint

Zebrafish embryo assay

A zebrafish-based short-term screening method was developed to detect the potential disruptive effects of chemicals on endocrine function. Total RNA of zebrafish embryos was isolated at the stage of 120 hpf following in vivo PFOS exposures. We investigated the effects of PFOS on marker genes related to the endocrine system. Exposure to PFOS did not affect hatching and larval survival rates in zebrafish embryos. No significant lethal and developmental abnormality was observed during the whole exposure time when the treatment groups were compared to the control.

Genes related to estrogen receptor production (esr1 and esr2b), early thyroid development (hhex and pax8), and steroidogenic enzyme synthesis (CYP17, CYP19a, and CYP19b) were quantified by Q-RT-PCR (Fig. 4). Exposure to PFOS led to an increase in the expression level of esr1 but a decrease in the expression of esr2b. These differences were significant at the high concentration of PFOS (500 µg/L; p < 0.05). An apparent concentration-dependent increase of hhex and pax8 expression was observed after PFOS treatment. Such expressions were upregulated to 7.6-fold and 16.2-fold, respectively, at the highest concentration of PFOS. Suppression of CYP17, CYP19a, and CYP19b was found at PFOS levels of 200 and 500 µg/L. In brief, short-term exposure to PFOS at low concentrations induced combined endocrine-disruptive effects in zebrafish embryos.

thumbnail image

Figure 4. The effects of perfluorooctane sulfonate (PFOS) on gene expression in zebrafish embryos. Zebrafish embryos at 4 h postfertilization (hpf) were exposed to 100 µg/L (2.0 × 10−7 M), 200 µg/L (4.0 × 10−7 M) and 500 µg/L (1.0 × 10−6 M) PFOS and 0.001% dimethylsulfoxide (DMSO; control). The expression levels of genes were determined by quantitative real-time polymerase chain reaction (Q-RT-PCR). Quantification was performed on three independent experiments. Data are expressed as fold of DMSO-treated embryos (control). Significant differences between treatment group and the corresponding control group are indicated by *p < 0.05.

Download figure to PowerPoint

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

The PFCs are of great environmental concern because of their widespread distribution and persistence. There is an urgent need to determine the endocrine-disrupting effects of these chemicals. The objective of the present study was to evaluate the role of PFOS in disrupting the endocrine system. A combination of in vitro and in vivo assays was used to explore the endocrine-disruptive activities of PFOS.

In the present study, we characterized the potential effects of PFOS on ER, AR, and TR functions using CV-1 cells and the MDA-kb2 cell line. The results revealed that the tested compound exhibited not only additive effect on estrogen function via ERα but also anti-thyroid hormone activity via TRβ. Activation of E2-mediated Luciferase expression was significantly increased by PFOS in a concentration-dependent manner. Several in vitro and in vivo studies have shown that some PFCs are weakly estrogenic compounds. Liu et al. observed a dose-dependent induction of the estrogen-responsive biomarker protein VTG in PFOS-treated cells, and the estrogenic effect of PFCs was mediated by the estrogen receptor pathway in primary cultured tilapia hepatocytes 14. Benninghoff et al. also found that PFOS significantly enhanced human ERα-dependent transcriptional activation 15. The structural characteristics of PFCs indicated that 8 to 10 fluorinated carbons and a carboxylic acid end group were optimal for maximal VTG induction. These reports support our current findings that certain PFCs might mimic estrogenic capacity or impact estrogenic activity.

To date, only a few studies have explored the effects of PFCs on thyroid hormone regulation. Exposure to PFOS caused a reduction in serum T4 and T3 in rats and mice 18, and a decrease in serum T3 and estradiol levels in monkeys 27. However, the mechanism of thyroid disruption still needs to be explored. We established a TR-mediated reporter gene assay to screen PFCs that affect the T3-induced transcriptional activation of TR. The results indicated that PFOS is capable of disrupting the thyroid system, probably through interaction with TR. Thyroid hormone imbalance may influence brain development and affect behavior.

In addition to receptor-mediation capacity, PFCs have also been shown to alter hormone production by affecting steroidogenic tissue in reproductive organs 16, 17, 28. To explore the mechanism of steroidogenesis disruption by PFOS, concentrations of two steroid hormones (T and E2) in the culture medium and relative responses of 10 genes involved in the steroidogenic pathway were measured in H295R cells. The PFOS could increase E2 production up to twofold and decrease the T level to 70% of the control in a concentration-dependent manner. Disruption of steroidgenesis could result from one of several mechanisms including inhibition of steroidogenic gene expression. Expression patterns including significantly increased expression of 3βHSD2, CYP11B2, and CYP19 and significantly decreased expression of CYP17 and 17βHSD4 were observed after PFOS treatment in our study. The HMGR, StAR, and CYP11A expressions were not markedly altered. This may be due to the basal mRNA abundance of HMGR, StAR, and CYP11A 22. In the present study, PFOS inhibited the conversion of progesterone to testosterone through inhibition of CYP17. Increased expression of 3βHSD2 and CYP11B2 could lead to an excess of aldosterone, which indicates that PFCs could affect aldosterone synthesis. The CYP19 is a crucial steroidogenic enzyme in the conversion of T to E2. In the present study, PFOS exposure stimulated CYP19 expression in H295R cells by 1.8- and 2.1-fold at 3 × 10−8 M and 3 × 10−7 M PFOS, respectively. Synthesis of T and E2 were altered by PFOS exposure. The induction of CYP19 gene expression may be a possible mechanism for the increase in E2 and the decrease in T production. There were some cases in which the results of hormone production and CYP19 gene expression were consistent with each other 29. Kraugerud et al. found that PFOS caused a numerically higher level of E2 followed by a concentration–response relationship, and E2 was significantly elevated at 600 µM PFOS 30. These results were consistent with our finding that PFOS induced E2 production. The inconsistent results in hormone induction fold may be due to the differences in method detection limits for the hormone assays. No significant changes in HMGR and CYP11A gene expression were found in their results. These genes were upregulated at 3 × 10−7 M PFOS in our study. The non-concentration–response manner of steriodogenic genes expression induced by PFOS should be taken into account. The production of steroids is a complex process. Small changes in expression of these genes may lead to large effects on steroid production due to their important roles in the steroidogenesis pathway. We hypothesize that PFOS may modulate the endocrine system by acting as a direct or indirect stimulator or inhibitor of the gene coding for enzymes in steroidogenesis.

The short-term zebrafish embryo exposure assay was intended to evaluate the in vivo effects of PFOS on endocrine system development and function. In addition, mRNA levels of genes related to ER production, early thyroid development, and steroidogenic enzyme synthesis were quantified. In the present study, waterborne PFOS altered gene expression profiles of esr1 and esr2b in zebrafish embryos. It has been shown in RT-PCR studies that all three ERs (esr1 [ERα], esr2b [ERβ1], and esr2a [ERβ2]) are expressed at 5 d postfertilization 31. Zebrafish esr1 is orthologous to human ERα, and esr2b is an ortholog of human ERβ 32. Esr1 is a well-known biomarker gene that is responsive to estrogen. Treatment with E2 has been shown to increase the expression of esr1 by approximately fourfold 23. The altered mRNA levels of esr1 and esr2b might indicate the estrogenic effects of PFOS. This result was consistent with those of previously published studies suggesting estrogen-like properties of PFOS in aquatic animals. A dose-dependent induction of VTG was observed in PFOS-treated primary cultured hepatocytes in freshwater male tilapia 14. The EDCs, especially thyroid-disrupting compounds, can affect either the morphogenesis or the function of the thyroid gland. In the present study, an apparent concentration-dependent increase in hhex and pax8 was observed after PFOS treatment. These two genes are the main transcription factors that are essential for thyroid morphogenesis and development 33. These results were consistent with a previous report showing that PFOS-treated zebrafish embryos exhibited developmental toxicity and altered thyroid-related gene expression 34. Genes regulating steroidogenesis including cyp19a, cyp19b, and cyp17 were also evaluated. These genes are potential molecular biomarkers for EDC screening. Expression of CYP17, CYP19a, and CYP19b decreased in the PFOS group. Ankley et al. 17 and Shi et al. 34 found that PFOS exposure reduced aromatase activity and gene expression, which is consistent with our findings. The inconsistent gene expression of CYP between H295R cells and zebrafish might be due to the different steroidogenic pathways in these two systems 35. The disturbed endocrine function caused by PFOS might be regulated by an internal feedback mechanism in zebrafish.

In summary, our results demonstrated that waterborne exposure of PFOS altered gene expression profiles of zebrafish embryos. The gene expression patterns of ER production, early thyroid development, and steroidogenic enzyme synthesis suggested that PFOS causes endocrine disruption in vivo. Results from in vitro assays such as reporter gene assays that characterized the activation or suppression of hormone receptors by PFOS could also provide a predictive direction for in vivo research. Future work is necessary on long-term exposure to PFOS at an environmentally relevant concentration. Large-scale genome and protein screening for PFOS-induced responses would likely provide more information to explore the mechanisms of the endocrine disruption.

The present study confirmed that PFOS can have multiple effects on the endocrine system through interfering with nuclear receptor, disrupting steroidogenesis, and affecting the normal gene expression patterns related to the endocrine system in vitro and in vivo. In the future, in vitro and in vivo studies should consider not only the mechanisms of PFCs' function alone but also the mixed effects of these chemicals.

SUPPLEMENTAL DATA

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

Fig. S1. The cytotoxicity of perfluorooctane sulfonate (PFOS) examined in MTT assay. CV-1 cells were treated with dimethylsulfoxide (DMSO) or various concentrations (3× 10−9 M, 1 × 10−8 M, 3 × 10−8 M, 1 × 10−7 M, 3 × 10−7 M) of PFOS alone (A) or with 1 × 10−9 M E2 (B) or with 5 × 10−9 M T3 (C) for 24 h. MDA-kb2 cells were treated with DMSO or various concentrations (3 × 10−9 M, 1 × 10−8 M, 3 × 10−8 M, 1 × 10−7 M, 3 × 10−7 M) of PFOS alone (D) or with 1 × 10−9 M DHT (E) for 24 h. Then 25 µl MTT was added to each well and continuously incubated at 37°C for 4 h. The MTT solutions were replaced with 150 µl DMSO. Absorbance was measured at 570 nm. Values were means ± standard deviation of six reduplicate wells. (5 MB PDF)

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

The present study was supported by the National Basic Research Program of China (973 Program), grant 2009CB941703; the Key Project of the National Natural Science Foundation of China, grant 30930079; a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD); and Scientific Innovation Research of the Graduate College in Jiangsu Province, grant CXZZ11_0739. The authors declare no conflict of interest with the study or preparation of the manuscript.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information
  • 1
    Renner R. 2001. Growing concern over perfluorinated chemicals. Environ Sci Technol 35: 154160.
  • 2
    Jensen AA, Leffers H. 2008. Emerging endocrine disrupters: Perfluoroalkylated substances. Int J Androl 31: 161169.
  • 3
    Ericson I, Domingo JL, Nadal M, Bigas E, Llebaria X, van Bavel B, Lindström G. 2009. Levels of perfluorinated chemicals in municipal drinking water from Catalonia, Spain: Public health implications. Arch Environ Contam Toxicol 57: 631638.
  • 4
    Strynar MJ, Lindstrom AB. 2008. Perfluorinated compounds in house dust from Ohio and North Carolina. USA. Environ Sci Technol 42: 37513756.
  • 5
    Letcher RJ, Bustnes JO, Dietz R, Jenssen BM, Jørgensen EH, Sonne C, Verreault J, Vijayan MM, Gabrielsen GW. 2010. Exposure and effects assessment of persistent organohalogen contaminants in Arctic wildlife and fish. Sci Total Environ 408: 29953043.
  • 6
    Vestergren R, Cousins IT. 2009. Tracking the pathways of human exposure to perfluorocarboxylates. Environ Sci Technol 43: 55655575.
  • 7
    Houde M, Martin JW, Letcher RJ, Solomon KR, Muir DC. 2006. Biological monitoring of polyfluoroalkyl substances: A review. Environ Sci Technol 40: 34633473.
  • 8
    Calafat AM, Kuklenyik Z, Reidy JA, Caudill SP, Tully JS, Needham LL. 2007. Serum concentrations of 11 polyfluoroalkyl compounds in the U.S. population: Data from the National Health and Nutrition Examination Survey. Environ Sci Technol 41: 22372242.
  • 9
    Olsen GW, Burris JM, Ehresman DJ, Froehlich JW, Seacat AM, Butenhoff JL, Zobel LR. 2007. Half-life of serum elimination of perfluorooctanesulfonate, perfluorohexanesulfonate, and perfluorooctanoate in retired fluorochemical production workers. Environ Health Perspect 115: 12981305.
  • 10
    Lau C, Anitole K, Hodes C, Lai D, Pfahles-Hutchens A, Seed J. 2007. Perfluoroalkyl acids: A review of monitoring and toxicological findings. Toxicol Sci 99: 366394.
  • 11
    Rosen MB, Lau C, Corton JC. 2009. Does exposure to perfluoroalkyl acids present a risk to human health?. Toxicol Sci 111: 13.
  • 12
    Johansson N, Fredriksson A, Eriksson P. 2008. Neonatal exposure to perfluorooctane sulfonate (PFOS) and perfluorooctanoic acid (PFOA) causes neurobehavioural defects in adult mice. Neurotoxicology 29: 160169.
  • 13
    Wang M, Chen J, Lin K, Chen Y, Hu W, Tanguay RL, Huang C, Dong Q. 2011. Chronic zebrafish PFOS exposure alters sex ratio and maternal related effects in F1 offspring. Environ Toxicol Chem 30: 20732080.
  • 14
    Liu C, Du Y, Zhou B. 2007. Evaluation of estrogenic activities and mechanism of action of perfluorinated chemicals determined by vitellogenin induction in primary cultured tilapia hepatocytes. Aquat Toxicol 85: 267277.
  • 15
    Benninghoff AD, Bisson WH, Koch DC, Ehresman DJ, Kolluri SK, Williams DE. 2011. Estrogen-like activity of perfluoroalkyl acids in vivo and interaction with human and rainbow trout estrogen receptors in vitro. Toxicol Sci 120: 4258.
  • 16
    Biegel LB, Liu RC, Hurtt ME, Cook JC. 1995. Effects of ammonium perfluorooctanoate on Leydig cell function: In vitro, in vivo, and ex vivo studies. Toxicol Appl Pharmacol 134: 1825.
  • 17
    Ankley GT, Kuehl DW, Kahl MD, Jensen KM, Linnum A, Leino RL, Villeneuvet DA. 2005. Reproductive and developmental toxicity and bioconcentration of perfluorooctanesulfonate in a partial life-cycle test with the fathead minnow (Pimephales promelas). Environ Toxicol Chem 24: 23162324.
  • 18
    Thibodeaux JR, Hanson RG, Rogers JM, Grey BE, Barbee BD, Richards JH, Butenhoff JL, Stevenson LA, Lau C. 2003. Exposure to perfluorooctane sulfonate during pregnancy in rat and mouse. I. Maternal and prenatal evaluations. Toxicol Sci 74: 369381.
  • 19
    Luebker DJ, York RG, Hansen KJ, Moore JA, Butenhoff JL. 2005. Neonatal mortality from in utero exposure to perfluorooctanesulfonate (PFOS) in Sprague-Dawley rats: Dose-response, and biochemical and pharmacokinetic parameters. Toxicology 215: 149169.
  • 20
    Melzer D, Rice N, Depledge MH, Henley WE, Galloway TS. 2010. Association between serum perfluorooctanoic acid (PFOA) and thyroid disease in the U.S. National Health and Nutrition Examination Survey. Environ Health Perspect 118: 686692.
  • 21
    Gazdar AF, Oie HK, Shackleton CH, Chen TR, Triche TJ, Myers CE, Chrousos GP, Brennan MF, Stein CA, La Rocca RV. 1990. Establishment and characterization of a human adrenocortical carcinoma cell line that expresses multiple pathways of steroid biosynthesis. Cancer Res 50: 54885496.
  • 22
    Zhang X, Yu RM, Jones PD, Lam GK, Newsted JL, Gracia T, Hecker M, Hilscherova K, Sanderson T, Wu RS, Giesy JP. 2005. Quantitative RT-PCR methods for evaluating toxicant-induced effects on steroidogenesis using the H295R cell line. Environ Sci Technol 39: 27772785.
  • 23
    Lam SH, Lee SG, Lin CY, Thomsen JS, Fu PY, Murthy KR, Li H, Govindarajan KR, Nick LC, Bourque G, Gong Z, Lufkin T, Liu ET, Mathavan S. 2011. Molecular conservation of estrogen-response associated with cell cycle regulation, hormonal carcinogenesis, and cancer in zebrafish and human cancer cell lines. BMC Med Genomics 4: 41.
  • 24
    Wang J, Shi X, Du Y, Zhou B. 2011. Effects of xenoestrogens on the expression of vitellogenin (vtg) and cytochrome P450 aromatase (cyp19a and b) genes in zebrafish (Danio rerio) larvae. J Environ Sci Health A Tox Hazard Subst Environ Eng 46: 960967.
  • 25
    Du G, Shen O, Sun H, Fei J, Lu C, Song L, Xia Y, Wang S, Wang X. 2010. Assessing hormone receptor activities of pyrethroid insecticides and their metabolites in reporter gene assays. Toxicol Sci 116: 5866.
  • 26
    Hilscherova K, Jones PD, Gracia T, Newsted JL, Zhang X, Sanderson JT, Yu RM, Wu RS, Giesy JP. 2004. Assessment of the effects of chemicals on the expression of ten steroidogenic genes in the H295R cell line using real-time PCR. Toxicol Sci 81: 7889.
  • 27
    Seacat AM, Thomford PJ, Hansen KJ, Olsen GW, Case MT, Butenhoff JL. 2002. Subchronic toxicity studies on perfluorooctanesulfonate potassium salt in cynomolgus monkeys. Toxicol Sci 68: 249264.
  • 28
    Shi Z, Zhang H, Liu Y, Xu M, Dai J. 2007. Alterations in gene expression and testosterone synthesis in the testes of male rats exposed to perfluorododecanoic acid. Toxicol Sci 98: 206215.
  • 29
    Kraugerud M, Zimmer KE, Dahl E, Berg V, Olsaker I, Farstad W, Ropstad E, Verhaegen S. 2010. Three structurally different polychlorinated biphenyl congeners (Pcb 118 (153): and 126) affect hormone production and gene expression in the human H295R in vitro model. J Toxicol Environ Health A 73: 11221132.
  • 30
    Kraugerud M, Zimmer KE, Ropstad E, Verhaegen S. 2011. Perfluorinated compounds differentially affect steroidogenesis and viability in the human adrenocortical carcinoma (H295R) in vitro cell assay. Toxicol Lett 205: 6268.
  • 31
    Chandrasekar G, Archer A, Gustafsson JA, Andersson Lendahl M. 2010. Levels of 17beta-estradiol receptors expressed in embryonic and adult zebrafish following in vivo treatment of natural or synthetic ligands. PLoS One 5: e9678.
  • 32
    Bardet PL, Horard B, Robinson-Rechavi M, Laudet V, Vanacker JM. 2002. Characterization of oestrogen receptors in zebrafish (Danio rerio). J Mol Endocrinol 28: 153163.
  • 33
    Wendl T, Lun K, Mione M, Favor J, Brand M, Wilson SW, Rohr KB. 2002. Pax2.1 is required for the development of thyroid follicles in zebrafish. Development 129: 37513760.
  • 34
    Shi X, Du Y, Lam PK, Wu RS, Zhou B. 2008. Developmental toxicity and alteration of gene expression in zebrafish embryos exposed to PFOS. Toxicol Appl Pharmacol 230: 2332.
  • 35
    Ma Y, Han J, Guo Y, Lam PK, Wu RS, Giesy JP, Zhang X, Zhou B. 2012. Disruption of endocrine function in in vitro H295R cell-based and in in vivo assay in zebrafish by 2,4-dichlorophenol. Aquat Toxicol 106–107: 173181.

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. SUPPLEMENTAL DATA
  8. Acknowledgements
  9. REFERENCES
  10. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
etc_2034_sm_SupplFigS1.pdf4917KSupplementary Figure S1
etc_2034_sm_SupplFigLegend.doc34KSupplementary Figure Legend

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.