SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

MYC is a potent oncogene involved in ∼70% of human cancers, inducing tumorigenesis with high penetrance and short latency in experimental transgenic models. Accordingly, MYC is recognized as a major driver of T-cell acute lymphoblastic leukemia (T-ALL) in human and zebrafish/mouse models, and uncovering the context by which MYC-mediated malignant transformation initiates and develops remains a considerable challenge. Because MYC is a very complex oncogene, highly dependent on the microenvironment and cell-intrinsic context, we generated transgenic mice (tgMycspo) in which ectopic Myc activation occurs sporadically (<10−6 thymocytes) within otherwise normal thymic environment, thereby mimicking the unicellular context in which oncogenic alterations initiate human tumors. We show that while Myc+ clones in tgMycspo mice develop and initially proliferate in thymus and the periphery, no tumor or clonal expansion progress in aging mice (n = 130), suggesting an unexpectedly low ability of Myc to initiate efficient tumorigenesis. Furthermore, to determine the relevance of this observation in human pathogenesis we analyzed a human T-ALL case at diagnosis and relapse using the molecular stigmata of V(D)J recombination as markers of malignant progression; we similarly demonstrate that despite the occurrence of TAL1 and MYC translocations in early thymocyte ontogeny, subsequent oncogenic alterations were required to drive oncogenesis. Altogether, our data suggest that although central to T-ALL, MYC overexpression per se is inefficient in triggering the cascade of events leading to malignant transformation. © 2013 Wiley Periodicals, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

T-cell acute lymphoblastic leukemias (T-ALL) are malignant proliferations of thymocytes that represent 10–15% of pediatric and 25% of adult ALL. Although the outcome of pediatric ALLs, which are mainly of B-cell origin, has improved to ∼80–85% survival of the cases over the past decade partly due to a better stratification of the malignant entities, the clinical picture of T-ALL remains dark. T-ALL patients often present with a high tumor load accompanied by a rapid disease progression, and about 30% of cases relapse within the first 2 years following diagnosis. Over the past decade, it has become clear that T-ALLs constitute a heterogeneous group of diseases resulting from complex combinations of gene aberrations. Consequently, the accurate definition of functional subtypes is currently a major challenge for the rationalization of therapeutic stratification. To date, the deregulation of at least 30 distinct oncogenes and tumor suppressors (TS) has been reported in T-ALL, through a large diversity of genomic aberrations including chromosomal translocations, deletions, amplifications, point mutations, and epigenetic deregulations (Meijerink, 2010; Zhang et al., 2012). Some of the oncogenes (e.g., LYL1, TLX1/HOX11, and TAL1) appear to be mutually exclusive and delineate distinct subgroups of prognostic significance, correlating with various stages of thymocyte developmental arrest (immature/DN, intermediate/pre-αβ, and mature/TCRαβ+, respectively) (Asnafi et al., 2003; Ferrando and Look, 2003; Soulier et al., 2005). By contrast, other deregulations, such as loss of CDKN2A/p14ARF (Fasseu et al., 2007), or constitutive NOTCH1 activation (Weng et al., 2004), are found in a large proportion of cases and irrespective of subgroups, revealing a more universal role for these alterations in T-ALL pathogenesis. Most of the deregulations, in any case, are found in various combinations, suggesting the occurrence of multiple oncogenic cooperation pathways. This “multi-genomic alteration” model of T-ALL pathogenesis is supported by transgenic models mimicking the ectopic expression of a given oncogene, in which the low penetrance and long latency of tumor development reflects the selective pressure for the acquisition of additional, complementary genomic alterations (Sharma et al., 2007). In humans, accumulating genomic studies (Zhang et al., 2012) indicate that the original figure of 5–8 genomic alterations per tumor sample issued from a-CGH studies is largely underestimating the actual number of functional genetic lesions potentially involved in T-ALL initiation and/or maintenance. Accordingly, one of the current challenges is to better understand the kinetics of genomic mutations appearance, how those lesions are related together to promote leukemia development, and define those required for T-ALL maintenance.

Within the diverse and complex oncogenic networks involved, NOTCH1 and AKT pathways are recurrently hyper-activated in T-ALL (Weng et al., 2004; Gutierrez et al., 2009). Interestingly, both major oncogenic axes converge towards the up-regulation of MYC, which now emerges as a potential critical hub in T-ALL leukemogenesis (Palomero et al., 2006; Weng et al., 2006 ; Sharma et al., 2007; Bonnet et al., 2011). Many animal models in which MYC is directly or indirectly activated in the T-cell lineage have confirmed the powerful oncogenic potential of MYC in leukemic initiation (Langenau et al., 2003; Smith et al., 2006; Guo et al., 2008; Li et al., 2008). However, these models involved massive MYC deregulation in all developing thymocytes, failing to reproduce the unicellular “sporadic” feature of human oncogenic alteration. To mimic this sporadic scheme, we designed a transgenic mouse model (tgMycspo) where Myc is expressed following an infrequent V(D)J recombination reaction. In this transgenic model, the few T-cells overexpressing Myc undergo preferential lymphoproliferation, but fail to develop leukemia even upon long-term follow-ups, suggesting that Myc alone is insufficient to drive efficient leukemogenesis. To determine the relevance of this observation in human T-ALL, we performed a detailed molecular analysis of a human T-ALL blast harboring a MYC/TCR translocation, and partially retraced the kinetics of gene alterations acquisition. In line with the tgMycspo data, our results show that even the cooperation of TAL1 and MYC oncogenes is insufficient to induce leukaemogenesis. Altogether, our data add to the accumulating evidence that individually, most of the major oncogenic mutations constitute in fact very inefficient drivers of leukemogenesis, evolving in a slow/protracted process of Darwinian-like selection/counter selection.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Patient

Description of patient T-ALL #28 is reported in supplementary text. Informed consent was obtained from the patient or relatives in accordance with the Declaration of Helsinki, with Institutional Review Board approval of La Timone Hospital (Marseille).

PCR Amplification

Oligonucleotides were supplied by Sigma-Aldrich and their sequences are reported in Supporting Information Table S1.

Long-range ligation-mediated PCR (LRLM-PCR)

DNA from patient T-ALL #28 was prepared from peripheral blood (PB) samples collected at diagnosis and relapse. 333 ng of PB DNA at diagnosis were digested twice (1 hr+12 hr) with 2x15U of the appropriate restriction enzyme (DraI, EcoRV, PvuI, SmaI, SspI, StuI), phenol-chloroform extracted and ligated with 1 µl of double strand adapter (60 µM). The ligation products were diluted in 70 µl final volume of TE, and 1 µl was used for PCR amplification. Manual hot-start double nested PCR (Ampliwax PCR gems, Applied Biosystems, CA) was performed using the Expand long Template PCR with buffer 1 (Roche, Switzerland) in the following conditions: 95°C 3 min, 7 cycles (95°C 30 sec, 72°C 12 min), 32 cycles (95°C 30 sec, 66°C 12 min), 68°C 12 min; 1 µl of primary PCR was used for nested PCR with the same conditions (except for 20 cycles instead of 32). Sequencing was performed on the bands of interest with or without a prior cloning step (PGEM-T Easy Vector System, Promega, WI). The following database and tools were used for alignment and breakpoint localization: NCBI Blastn (http://www.ncbi.nlm.nih.gov/BLAST/), UCSC genome browser (http://genome.ucsc.edu/cgi-bin/hgGateway); Ensembl Human genome browser (http://www.ensembl.org/Homo_sapiens/); Vector NTI 10.0 sequence analysis software (Informax, Invitrogen, CA).

Fluctuation-PCR (F-PCR)

The estimation of the frequency by F-PCR has been previously described (Roulland et al., 2006). Typically, 10 reactions were performed in parallel using 300 ng of DNA (per reaction) which corresponds to around 5×104 cells. In the fluctuation range at most one target molecule is present per PCR replicate, and if so will give rise to a detectable amplicon. Consequently, two separate bands are necessarily amplified from two distinct cells. The detection threshold of the assay is depending on the number of replicates performed with a constant amount of DNA per replicate. The frequency of the event is then calculated from the number of positive amplicons using a Poisson assumption. Genomic DNA was purified using the QIAamp DNA blood minikit (QIAGEN). Primers used to amplify by nested PCR the coding joint resulting from the V(D)J recombined transgene are reported in Table S1. Nested PCR were performed using GoTaq polymerase (Promega) in 50 µl of GoTaq bufferX1. The primary PCR was carried out with 300 ng of genomic DNA and the following PCR program was used: 95°C 3 min, 30 cycles (94°C 30 sec, 60°C 30 sec, 72°C 1 min), 72°C 5 min; 2 µl of primary PCR was used for nested PCR with the same conditions (except for 20 cycles instead of 30).

Reverse transcription-PCR (RT-PCR)

RNA was extracted using RNAeasy mini kit (QIAGEN) and cDNA was synthesized using High-capacity cDNA reverse transcription kit (Applied Biosystems). To detect the presence of spliced Flag-Myc mRNA in TgMycspo mice the transgenic Myc cDNA was amplified by nested PCR using primers Flag1 and Myc3, then for the secondary PCR, primers Flag2 and Myc3 were used. Nested PCR were performed using FailSafe Taq polymerase (Epicentre) in 30 µl of FailSafe PCR1X premix G; 3 µl of primary PCR was used for secondary PCR. The following PCR program was applied: 94°C 3 min, 35 cycles (94°C 20 sec, 58°C 30 sec, 68°C 40 sec), 68°C 5 min.

PCR products of interest were purified using SV gel and PCR Clean-Up System (PROMEGA). DNA sequencing was performed by Eurofins MWG operon.

Array Comparative Genomic Hybridization (aCGH) Analysis

Pan-genomic high-density 244K oligonucleotide arrays (Agilent Technologies; www.chem.agilent.com/) were used as described previously (Clappier et al., 2007), and analyzed using the CGH Analytics 3.2 software (Agilent Technologies).

Generation of tgMycspo and tgCtrlspo Constructs and Mice

Genomic sequences of mouse Myc exon 2 (containing the ATG start codon) and exon 3 (containing the stop codon), each including part of the intronic sequences comprising the splice sites, were amplified by PCR using primer pairs 5′MYCE2BamH1/3′MYCE2Mlu1 and 5′MYCE3/3′MYCE3Sal1, respectively. A Flag epitope was added at the 5′ side of Myc exon 2, while Myc exon 3 was flanked in 3′ by an IRES-H2BGFP fusion gene (Prinz et al., 2006), followed by a SV40 polyA sequence. The Myc exon 3-IRES-H2BGFP module was cloned in inverse orientation compared to Myc exon 2, and was bordered by a 12RSS and a 23RSS from Dβ1 and Vβ14 mouse gene segments, respectively. The configuration of the RSS pair (same orientation) leads to a recombination by inversion. Upstream to Flag-Myc exon 2 was inserted the CMV promoter while downstream to Myc exon 3-IRES-H2BGFP module was cloned the IGH intronic enhancer (Eµ). The tgMycspo construct was bordered by two chicken β-globin HS4 insulators aimed to restrict the influence of the insertion sites (Guglielmi et al., 2005) and was cloned into the pcDNA3.1(+) vector. The tgCtrlspo construct was similar to tgMycspo except that it doesn't contain the Flag-MYC exon 2 module. Linearised tgMycspo or tgCtrlspo constructs were microinjected into B6/DBA2 pronuclei, implanted in pseudopregnant females, and the littermates screened by PCR (using primers 701 and 702) for the presence of the transgene. Two transgenic lines named TgMycspo #1 and TgMycspo #2 were established, as well as 5 control transgenic lines (TgCtrlspo #1 to #5). All mice were bred and maintained in specific-pathogen-free conditions in the CIML animal facility in accordance with institutional guidelines.

Ex vivo Recombination Assays

Hela cells were maintained in Dulbeccos's Modified Eagle's medium (DMEM) supplemented with 50 µg/ml streptomycin, 50 IU penicillin and 10% FCS. Using lipofectamine 2000 (Invitrogen), Hela cells were transiently transfected with MIE-Myc or sporadic constructs (tgMycSpoor tgCtrlspo) in absence or presence of vectors expressing full-length mouse RAG1 and RAG2. 24H post-transfection, Myc expression was monitored by western blot using anti-FLAG M2 (SIGMA ref: F1804) and anti-mouse HRP (Tebu Bio ref: sc2005) antibodies, in the other hand GFP expression and cell size were monitored by flow cytometry using a FACSCalibur flow cytometer. MIE-Myc was obtained by cloning Myc cDNA flanked at its 5' side with a Flag epitope into the retroviral vector pMSCV-ires-EGFP (MIE).

Immunofluorescence (IF) Staining

Spleens were snap-frozen in Tissue-Tek OCT compound (Sakura Finetek Europe). 8 µm cryostat tissue sections were successively incubated in 2% BSA for 30 min, then with APC anti-CD3 (BD Pharmingen ref: 553066) for 1 H at room temperature. After 3 washes, sections were incubated 20 min at room temperature in 0.5% Triton X-100; then endogenous Biotin was blocked using the Biotin Blocking System (Dako) according to the manufacturer procedure. Afterward, sections were labeled overnight at 4°C with primary antibodies chicken anti-GFP (Avés Labs Inc ref: GFP-1020) and anti-Flag-BioM2 (Sigma ref:F9291) then they were successively incubated for 1 hr at room temperature with, first, mouse-anti-chicken Alexa FITC antibody (Southern biotechnology associates ref: 8340-02) and (Streptavidin A555; invitrogen ref: S32355), secondly with rabbit anti-FITC antibody (Invitrogen ref: ANZ0202). The CD3 labeling step was skipped, when nuclei were stained with the fluorescent probe Topro3 (Invitrogen Molecular Probes) 1 µM during 15 min. Washes and immunolabeling were performed with 1X PBS; 0.5% saponin. Slides were mounted in ProLong Gold antifade reagent (Invitrogen) and observed with a Zeiss LSM 510 confocal microscope (Carl Zeiss, Jena,Germany).

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

“Sporadic” Myc Activation Fails to Drive Leukemogenesis in Mice

In most mouse models used to investigate lymphoid neoplasia, the oncogene of interest is under the control of a promoter (or enhancer) that triggers the expression of the transgene in all the cells of a given lineage and/or of a particular differentiation stage, triggering massive synchronous polyclonal proliferation in a perturbed microenvironment. In contrast, during the initial steps of tumorigenesis, the oncogenic activation is generally mediated by a somatic alteration occurring in a single cell (e.g., a chromosomal translocation), which will evolve and develop in the setting of an otherwise normal thymus. To mimic this sporadic initiating event, we designed a Myc transgenic mouse model (tgMycSpo) whereby MYC expression is dependent on transgene (Myc-exon 3/GFP) inversion by V(D)J recombination (Fig. 1A). We also designed a control construct identical to tgMycSpo except that it lacks Myc exon 2 (tgCtrlspo) and thus encodes a non-functional Myc (Fig. 1B). As for V(D)J-mediated translocations in human T-ALL, transgenic expression in tgMycSpo and tgCtrlspo will be a rare, sporadic event (due to the relative inefficiency of inversion of the chosen flanking recombination signal sequences), restricted to the appropriate lymphoid lineage (tissue specific), and occurring in appropriate developmental stages (RAG1/2+); moreover, for each recombination event, the RAG recombinase produces an imprecise and unique junction (the so-called coding joint, CJ) which harbors addition or deletion of nucleotides, and can be used as a clonotypic marker to track the development of a clone issued from a single cell.

image

Figure 1. Sporadic Myc and control constructs. A: Schematic depiction of tgMycSpo construct and its activation by RAG1/RAG2. The tgMycspo construct is bordered by two chicken β-globin HS4 insulators (I); 12RSS Dβ1 and 23 RSS Vβ14 are represented by white and black triangle respectively. Upon RAG1/RAG2 recombination by inversion, the Myc exonIII-ires-H2B-GFP module is in the correct orientation for transcription. Translation of the recombined transgene generates FLAG-Myc and H2B-GFP fusion proteins. RAG recombination produces signal and coding joints; horizontal arrows indicate the position of primers used to amplify the coding joint by fluctuation PCR. B: Depiction of the tgCtrlSpo construct. In absence of Myc ExonII a non-functional crippled Myc protein is produced without affecting H2B-GFP. C: FACS analysis of HeLa cells transfected with tgMycSpo construct in absence or presence of RAG1 and RAG2 expression vectors. D, E: HeLa transfected with RAG1/2 vectors and tgMycSpo or tgCtrlSpo construct were analyzed by FACS (D) or by western blot (E). NT, non transfected Hela cells; MIE-Myc, Hela cells transfected with the retroviral MIE-Myc construct expressing Myc constitutively.

Download figure to PowerPoint

We first tested the ability of our tgMycSpo construct to produce functional Myc upon recombination using ex vivo recombination assays (Marculescu et al., 2002). HeLa cells were co-transfected with the tgMycSpo construct with or without RAG1/2 expressing vectors. FACS analysis performed 24H post-transfection revealed that only RAG1/2+ co-transfections expressed GFP (Fig. 1C), demonstrating the occurrence of RAG1/2-dependent recombination. Co-transfection assays performed with either tgCtrlspo or tgMycSpo gave rise to similar level of GFP+ cells (Fig. 1D) indicating akin efficiency of RAG1/2-mediated inversion for the two constructs. Moreover, GFP+ cells transfected with tgMycSpo (but not with tgCtrlspo) displayed a modest but consistent increase in cell-size, a typical feature of ectopic MYC expression (Meyer and Penn, 2008) (Fig. 1C, see also Supporting Information Fig. S1). Finally western blot analysis of transfected cells, in presence of RAG1/2, confirmed the production of Flag-Myc proteins (Fig. 1E).

We next generated transgenic lines with the full construct (tgMycSpo), and the control construct (tgCtrlspo). Two tgMycSpo and five tgCtrlspo lines were obtained from independent founders and established. All transgenic mice developed normally and displayed normal lymphoid tissues at birth and early age.

To monitor the occurrence and frequency of transgene recombination, 3- to 6-month-old mice were sacrificed, and thymus, spleen, and bone marrow (BM) were screened for the presence of CJ by a sensitive fluctuation PCR (F-PCR) assay (Fig. 2A and Table 1). In the 2 tgMycSpo lines, we found that ∼3–10 out of a million cells harbored a V(D)J recombined transgene in T-cells. Hence, the Mycspo system recapitulated to a good extent the rare event of chromosomal translocation. Nested RT-PCR and immunofluorescence assays confirmed the presence of Flag-Myc spliced transcript (Fig. 2B) and proteins (Fig. 2C) at low frequency in T-cells. Notably, as tgMycspo is also recombined and expressed in B-cells (Supporting Information Fig. S2), it could constitute a pertinent model for B-lineage cancer. Interestingly, tgMycspo data sharply contrasted with the one obtained in all tested tgCtrlspo mouse lines, in which inversions were never observed by F-PCR (Table 1). Although we cannot exclude that the transgene could be potentially influenced by chromatin in a particular transgenic line, it seems unlikely that this would systematically occur in both tgMycSpo lines, but in none of the 5 tgCtrlspo control lines. As the inversion potential is strictly identical in tgMycSpo and tgCtrlspo constructs (Fig. 1D), this suggests that the ectopic expression of Myc in tgMycSpo triggered a >10–100 fold increase in Myc+ cell representation in the thymus, BM and spleen, compared to controls, implying an advantage in cell proliferation and/or survival in presence of functional Myc. Sequencing of F-PCR amplicons from 3-month old tgMycSpo mice revealed that several Myc+ clones simultaneously developed, with in some instances the early emergence of the same clone in several tissues (Table 2). 130 TgMycSpo mice were next monitored over time for clinical symptoms of neoplasia. BM progenitors transduced with Myc-expressing retroviral vector (MIE-Myc) were also transplanted into lethally irradiated recipients, as in vivo control of Myc oncogenic potential. As expected, transplanted mice developed myeloid tumorigenesis within around 11 weeks with 100% penetrance (not shown). In striking contrast, none of the TgMycSpo mice developed any sign of tumor, or of developing tumor in tissues upon sacrifice and examination (66 mice were older than 1 year and among them, 33 were at least 2 years old). Even more, the frequency of Myc+ cells tended to decrease in older mice (spleen of 1 year old mice: frequency ∼ 1 × 10−5; n = 5) compared to younger ones (spleen of mice aged up to 2 months: frequency ∼ 2.6 × 10−5; n = 7).

image

Figure 2. Sporadic transgenic MYC mouse model. A: Genomic DNA analysis of tgMycSpo mice by F-PCR. In a typical F-PCR assay, 10 replicates of nested PCR performed with 300 ng of genomic DNA (per reaction) were loaded on agarose gel (top, left). Then, using the numbers of positive PCR, the frequency of cells harboring a recombined transgene is calculated (top, right). PCR products can also be gel-purified and sequenced (bottom). Here is shown the coding joint sequence of PCR product n°10 (above is indicated unprocessed flanking sequences of 12RSS and 23RSS). B: Nested RT-PCR products from spleens of 2 month-old TgMycspo and WT mice were separated by agarose electrophoresis and the corresponding ethidium bromide-stained gel is shown. The 824 bp band corresponding to the spliced Flag-Myc cDNA is indicated; DNA from this band was eluted and sequenced in order to confirm its identity. Flag1, Flag2 and Myc3 primers used for the nested RT-PCR are indicated by arrows numbered 1, 2, and 3, respectively. C: Representative multicolor IF staining of tgMycSpo spleens. GFP, Flag-MYC, and either nuclei /Topro3 (top panel) or CD3 (bottom panel) were labeled. IF staining were performed using spleen of mouse#130 (5 months, recombination frequency = 2 x 10−5) and mouse#129 (5 months, recombination frequency = 4x10−5), top and bottom panels respectively. White arrows point the localization of GFP+Flag-Myc+ cells.

Download figure to PowerPoint

Table 1. Frequencies of Cells Carrying a V(D)J-Recombined Transgene
MiceOrgansPositive PCR product (mean)aFrequencyb
  1. a

    Mean value of 3 F-PCR assays.

  2. b

    In absence of positive PCR, the value 1 positive PCR product/30 replicates was used to calculate the frequency which was then further divided by 2. Pools of 5 mice (less than 6 months of age) were used for each experiment and F-PCR assays were repeated 3 times. Each of the 10 nested PCR was performed with 300 ng of purified genomic DNA from indicated organs. The formula used to calculate the frequency is f = -[LN(1-(nb of positive amplicon/nb of replicates))]/nb of cells per replicate.

tgMycspo #1Bone marrow2/104.5.10−6
Thymus4.3/101.1.10−5
spleen2.3/105.3.10−6
tgMycspo #2Bone marrow1.3/102.9.10−6
Thymus2.7/106.2.10−6
spleen4/101.10−5
tgCtrlspo #1Bone marrow0/10<3.4.10−7
Thymus0/10<3.4.10−7
spleen0/10<3.4.10−7
tgCtrlspo #2Bone marrow0/10<3.4.10−7
Thymus0/10<3.4.10−7
spleen0/10<3.4.10−7
tgCtrlspo #3Bone marrow0/10<3.4.10−7
Thymus0/10<3.4.10−7
spleen0/10<3.4.10−7
tgCtrlspo #4Bone marrow0/10<3.4.10−7
Thymus0/10<3.4.10−7
spleen0/10<3.4.10−7
tgCtrlspo #5Bone marrow0/10<3.4.10−7
Thymus0/10<3.4.10−7
spleen0/10<3.4.10−7
Table 2. Analysis of Clonality of Cells Harboring a Recombined TgMycspo Transgene
MiceCloneOrganSequence of coding joint
12 RSS coding sequenceNucleotides insertions23 RSS coding sequence
 WTTTCACTAGTGATTCCC AGACAATCGAATTCC
  1. Three 3 month-old TgMycspo mice were sacrificed, then genomic DNA from spleen, bone marrow, thymus and blood were analyzed by F-PCR assays and all CJ amplicons were sequenced. Clones 1 and 3 from mice TgMycspo #1.1 and 1.2 respectively, were detected several times.

TgMycspo #1.11SpleenTTCACTAGTG (−6)GACCCT(−4) AATCGAATTCC
1TTCACTAGTG (−6)GACCCT(−4) AATCGAATTCC
2TTCACTAGTGATTCCCG(−1) GACAATCGAATTCC
3TTCACTAGTGATT (−3)GAGGGCTAGACAATCGAATTCC
4TTCACTAGTGAT (−4)CCTTAGACAATCGAATTCC
1Bone MarrowTTCACTAGTG (−6)GACCCT(−4) AATCGAATTCC
5TTCACTAGTGA (−5)CT(−6) TCGAATTCC
6ThymusTTCACTAGTGA (−5)CCAGACAATCGAATTCC
7TTCACTAGTG (−6)TTT(−5) ATCGAATTCC
8TTCACTAGTGATTCCCGACGGG(−2) ACAATCGAATTCC
9TTCACTAGTGATT (−3) (−1) GACAATCGAATTCC
10BloodTTCACTAGTGATTCC (−1)CGGGCAGG(−1) GACAATCGAATTCC
TgMycspo #1.21SpleenTTCACTAGTGAT (−4)AGC(−3) CAATCGAATTCC
2TTCACTAGTGAT (−4) (−2) ACAATCGAATTCC
3TTCACTAGTGATTC (−2) (−4) AATCGAATTCC
4T (−15)C(−7) CGAATTCC
5Bone MarrowTTCACTAGTGATTC (−2)GCT(−3) CAATCGAATTCC
6TTCACTAGTGATTCCCTC(−4) AATCGAATTCC
3ThymusTTCACTAGTGATTC (−2) (−4) AATCGAATTCC
7TTCACTAGTGA (−5)A(−2) ACAATCGAATTCC
8TTCACTAGTGATTC (−2) (−8) GAATTCC
TgMycspo #1.31SpleenTTCACTAGTGATT (−3)TAGACAATCGAATTCC
2TTCACTAGTGATT (−3)CT(−1) GACAATCGAATTCC
3TTCACTAGTGATT (−3)AATG(−1) GACAATCGAATTCC
4TTCACTAGTGATTC (−2)GGAGACAATCGAATTCC
5Bone MarrowTTCACTAGTGAT (−4)C(−5) ATCGAATTCC
6TTCACTAGTGATTCCC (−9) AATTCC
7ThymusTTCACTAGTG (−6)ATCG(−1) GACAATCGAATTCC
8BloodTTCACTAGTGATTCC (−1)CGGGCAGG(−3) CAATCGAATTCC

Altogether our data indicate that the ectopic expression of the CMV-Myc transgene initially provides a survival or proliferative advantage. However, this selective advantage provides as such only a limited oncogenic potential to the few cells harboring Myc, and fails to drive efficient tumorigenesis. This suggests an unexpectedly low ability of Myc to enhance genomic mutation rates and thus to affect the acquisition of complementary oncogenic mutations.

Kinetics of Translocation-Acquisition in a Human T-ALL Sample

To further investigate the hypothesis of the low oncogenic potential of MYC upregulation, and test the relevance of our TgMycSpo mouse observations, we next sought to define the dynamics of MYC-mediated oncogenesis in a human T-ALL case. Among the many genetic events paving T-ALL oncogenesis, only few allow distinctive positioning in T-cell ontogeny. V(D)J recombination is a highly regulated event occurring throughout thymocyte development, during which precise gene segment rearrangements occur according to a defined hierarchical order. As such, V(D)J rearrangements represent valuable indicators of the stage of developmental arrest in malignant clones (Asnafi et al., 2003), but also of the developmental stage at which V(D)J-mediated alterations (translocations, deletions) occurred.

We identified a T-ALL case (#28, briefly described in Supporting Information text) presenting the interesting advantage of harboring two TCR translocations: a t(1;14)(p32;q11) and a t(7;8)(q34;q24) (Bonnet et al., 2011); both translocations were found by FISH in all tumor cells analyzed. This double-genomic alteration provided the opportunity to investigate the kinetics of the two translocations. The cryptic t(7;8)(q34;q24) involved the MYC and TCRβ loci; furthermore breakpoint identification clearly revealed the occurrence of a typical V(D)J-mediated “type 2” translocation mechanism resulting from a repair mistake during an attempted Dβ1 to Jβ2.7 rearrangement (Bonnet et al., 2011) (Fig. 3A). To further outline the stage of t(1;14)(p32;q11) acquisition in the malignant development of this T-ALL case, we cloned the translocation breakpoints of the leukemic blasts. FISH mapping revealed that the t(1;14)(p32;q11) corresponded to a rare but recurrent TAL1/TCRδ translocation (Supporting Information Fig. S3). Our cytogenetic mapping was precise enough to allow a direct molecular approach. A long-range ligation-mediated PCR (LRLM-PCR) strategy was performed using a set of four primers (Supporting Information Fig. S4); cloning/sequencing of the der(1) and der(14) breakpoints revealed the occurrence of another type 2 V(D)J-mediated translocation, resulting from a repair mistake during a failed Dδ3 to Jδ2 rearrangement (Fig. 3B). As Dδ-Jδ rearrangements span in normal thymocytes from the CD34+CD1a- to the CD34+CD1a+ DN stages of differentiation (Dik et al., 2005), this allowed a likely timing of t(1;14) in this window of T-cell differentiation. As normal Dβ-Jβ rearrangements take place at DN stage (CD34+CD1a+), the occurrence of the t(7;8) translocation overlaps with the timing of t(1;14). Thus, both translocation events likely occurred during DN stages, just before the onset of the Vβ to DJβ rearrangement (CD4 ISP). The der(1) chromosome juxtaposed TAL1 ∼5kb upstream of the TCRδ enhancer (Eδ), and ∼80kb of the TCRα enhancer (Eα), at a propitious orientation, distance and timing for their sequential activation of TAL1. Similarly, the t(7;8)(q34;q24) gave rise to a der(8) chromosome juxtaposing MYC ∼180 kb upstream from the TCRβ enhancer (Eβ), also corresponding to a favorable orientation and timing for its ectopic expression from DN (CD34+CD1a+) throughout the late differentiation stages. Furthermore, the usage of the Jβ2.7 gene segment as the fusion partner in the der(8) is also favorable to relieve MYC expression from a putative transcription repressor (Marculescu et al., 2003). Most importantly, this strongly suggests that the T-cell in which t(1;14)(p32;q11) and t(7;8)(q34;q24) occurred, congruently expressed TAL1 and MYC proto-oncogenes from the DN (CD34+CD1a+) stage of differentiation onward. Considering that the leukemic blasts of this patient displayed a “late cortical” TCRαβ+ phenotype [based on both immunophenotypic criteria and baseline pTα and RAG1 expression as assessed by RQ-PCR as previously described (Asnafi et al., 2003) (not shown)], the stage of TAL1 and MYC oncogenic activation (DN) was thus clearly uncoupled from the stage of maturation arrest (SPCD8).

image

Figure 3. Molecular characterization of V(D)J-mediated translocations. A,B: Sequences of the breakpoints (left) and schematic representation of the V(D)J-mediated process leading to the two “type 2” translocations (right): (A) t(7;8)(q34;q24); (B) t(1;14)(p32;q11). RAG-mediated breaks on chromosome 7 and 14 are indicated by plain vertical arrows; breaks on chromosome 8 and 1 were generated by an unknown process and are indicated by a zigzag arrow. Chromosomal breakpoint positions on 8q24 and 1p32 breakpoints are indicated in brackets and numbered according to coordinate system position (http://genome.ucsc.edu/cgi-bin/hgGateway). Homology to germline sequences are indicated by vertical bars. N regions are indicated in bold characters. 12-RSS and 23-RSS surrounding the D and J segments from the TCRβ and/or TCRαδ are underlined.

Download figure to PowerPoint

TAL1/MYC Cooperation Is Not Sufficient to Give Rise to the Aggressive Leukemic Transformation

The DN to DP transition corresponds to a crucial checkpoint in normal T cell ontogeny, during which selected thymocytes expressing a productive TCRβ chain associated to pTα undergo extensive cell proliferation. This step is then followed by TCRα rearrangements, which independently provide a unique and distinct Vα-Jα combination for each cell issued from the expanded TCRβ/pTα clone. Since the leukemic clone acquired both translocations at DN stages, but the maturation block occurred at the late cortical stage, we reasoned that blasts should be monoclonal for all rearrangements antecedent to DP proliferation (TCRβ/γ/δ, including the translocations), but polyclonal for those posterior to this expansion (TCRα). Accordingly, both translocations and TCRβ/γ rearrangements, including the functional Vβ20.1Dβ1Jβ1.3 rearrangement (Fig. 4A), were uniformly found by multiplex PCR or LM-PCR in diagnosis and relapse samples. In apparent contradiction with our initial reasoning, however, we also identified a unique and identical functional Vα6Jα38 transcript by multiplex PCR (Fig. 4A). Analysis of aCGH dataset (Bonnet et al., 2011) confirmed the monoclonal status of TCR rearrangements at the αδ locus in virtually all cells: Vα6Jα38 on one allele, and type 2 translocation-induced Dδ2Jδ2 deletion on the other (Fig. 4B). Most importantly, this unique rearrangement was present both at diagnosis and relapse, indicating that the relapse did not initiate from a distinct MYC/TAL precursor subclone (Mullighan et al., 2009; Clappier et al., 2011). In most human tumors and transgenic mouse models, the progressive acquisition of monoclonality during tumor development reflects the latency required for the acquisition of complementary oncogenic mutations (Sharma et al., 2007). We thus considered the possibility that TAL1/MYC cooperation was not sufficient for (aggressive) transformation, and that a third, transforming mutation might have occurred in one of the TCRαβ+ cells after the onset of TCRα rearrangement (Fig. 4C).

image

Figure 4. Kinetics analysis of stepwise T-ALL development in patient #28. A: Sequences of functional Vβ(D)Jβ rearrangement (top) and functional VαJα rearrangement (bottom). B: Identification of TCRαδ rearrangements and translocations by aCGH analysis. The aCGH profile is reported to scale on the TCRαδ locus showing a monoallelic deletion spanning from Vα7 (indicated by the black1/green2 dot border) to Jα43/35 (indicated by the green7/black8 dot border), and a biallelic deletion spanning from Dδ1/2 (indicated by the green3/green4 dot border) to Jδ4/3 (indicated by the green5/green6 dot border), and confirming the occurrence of a monoclonal blast carrying a Vα6Jα38 rearrangement on one allele and a type 2 translocation involving a attempted Dδ2Dδ3 to Jδ2 rearrangement on the other. C: Stages of human T-cell development in the thymus (top). DN, double negative CD4-CD8-; ISP, immature simple positive CD4+; DP, double positive CD4+CD8+; SP, simple positive CD4+ or CD8+. Schematic representation of the kinetic of translocations during T-ALL #28 development (bottom). t(1;14) and t(7;8) took place at DN stages (before TCRβ selection); T-ALL #28 blasts were SPCD8 and monoclonal for TCRαβ suggesting that at least a third genomic mutation occurred after TCRα rearrangement step.

Download figure to PowerPoint

The Identification of Eight Additional Aberrations/Oncogene Deregulations in the Leukemic Blasts Reveals a Complex Oncogenic Network

TAL1 and LMO1/2 are frequently found co-deregulated in human T-ALL samples (Ferrando et al., 2002; Ferrando et al., 2004), and have shown cooperative oncogenic effects in mouse (Larson et al., 1996; Aplan et al., 1997; Herblot et al., 2000) as well as in MYC transgenic Zebrafish models (Langenau et al., 2005). LMO1 and LMO2 transcripts in T-ALL #28 blasts were thus quantified by RQ-PCR and compared to our previously published series (Dik et al., 2007). Indeed, the sample displayed a modest but significant increase of LMO2 (but not of LMO1) expression, comparable to the expression levels of some T-ALLs cases with t(11;14)(p13;q11) LMO2/TCRδ translocation (Dik et al., 2007). Even if modest (the percentage of LMO2 expression relative to Abelson was 28%), the ectopic expression of LMO2 in the circulating leukemic blasts was unambiguous, as LMO2 is normally barely detectable (∼1–2%) at late stages of thymocyte differentiation (TCRαβ+) (Dik et al., 2007). LMO2 ectopic expression in T-ALL is generally due either to translocations or to the deletion of a 5′ negative regulatory element (NRE) through the del(11)(p12p13) (Van Vlierberghe et al., 2006), but a fraction of cases remains unexplained to date. As no further translocation was expected in this clone, we screened for 11p13 alterations by a-CGH. No alteration was detectable at the 11p13 region (not shown), indicating that LMO2 ectopic expression was not resulting from NRE deletion. We next surveyed the whole genome for potential additional chromosomal aberrations. Unexpectedly, the fine a-CGH analysis revealed the presence of up to 7 additional chromosomal alterations in the patient's samples, some classically involved in, and some new to T-ALL oncogenesis. Among classical T-ALL alterations, 9p21 is the most frequent [∼100% T-ALL when excluding the most immature (Fasseu et al., 2007)], and bi-allelic deletion of CDKN2A/2B locus was indeed observed in our patient sample (Fig. 5A). Another alteration recently reported as relatively frequent in T-ALL (up to 8% cases) is a short 4q25 deletion, situated 5' of the Lymphoid Enhancer Factor 1 (LEF1) gene (Mullighan et al., 2007; Gutierrez et al., 2010; Le Noir et al., 2012). A ∼150 kb monoallelic deletion was located in this region (Fig. 5B), and comprised the 5' part of the LEF1 gene. LEF1 is part of the TCF1/β−catenin transcriptional complex linked to the MYC/cyclin activation pathway, and has been shown to be a downstream target of NOTCH1 (Spaulding et al., 2007), but virtually nothing is known to date on the functional implications of the 4q25 deletions in leukemogenesis (Petropoulos et al., 2008). As previously described (Bonnet et al., 2011), this T-ALL case also harbored a PTEN deletion (10q23). PTEN is a well known tumor suppressor gene in many cancer types; deletions as well as inactivating mutations of PTEN have been reported in 8 to 28% of T-ALL cases (Palomero et al., 2007; Gutierrez et al., 2009; Jotta et al., 2010; Bonnet et al., 2011).

image

Figure 5. Chromosomal alterations of T-ALL #28 revealed by pan-genomic aCGH analysis. A–E: aCGH profiles of chromosomes 9, 4, 19, 8, 5, 6. Arrows indicate the region harboring an anomaly and which is zoomed on the right. The chromosome localization is indicated as well as the corresponding gene(s) gain/loss by the deletion/amplification (black box), except for the large 9p21 deletions where only the classical CDKN2A/2B gene is indicated out of many other genes. As previously published, T-ALL #28 contains also a deletion at the 10q23 region (comprising PTEN locus) which was mono-allelic at diagnosis and bi-allelic at relapse (Bonnet et al., 2011).

Download figure to PowerPoint

The other four alterations revealed by our aCGH are new to T-ALL (Figs. 5C–5F): a 70kb duplication of the 19q13 region (including genes coding for ERCC2, KLC3 and iASPP), and monoallelic deletions of 8q12 (a ∼150 kb region directly 5' of the TOX gene), 5q12 (a ∼80 kb region of the Mimitin/NDUFA12L gene) and 6p22 (a ∼20 kb region comprising 4 (1H3D/2AD/2BP/4B) out of a cluster of 32 histones). Although the consequences of such gene amplification/haplo-insufficiencies remain to be functionally determined, most appear as suitable candidates for leukemogenesis (see supplementary discussion).

Altogether, the plethora of alterations (a total of 10) found in this case and their apparent functional relationship with MYC reinforce the notion that a combination of multiple (and potentially seemingly redundant) alterations shutting off the many build-in cellular escape pathways might be necessary either simultaneously or sequentially to initiate and/or maintain (aggressive) T-ALL leukemogenesis.

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

MYC is a potent oncogene that is involved in numerous distinct types of solid and hematologic cancers (Pelengaris et al., 2002). Because the MYC locus is rarely altered directly in T-ALL, the oncogenic role of MYC has long been marginalized in this neoplasm. Since then, several key studies have shown that MYC transcription is up-regulated by NOTCH1 (Palomero et al., 2006; Weng et al., 2006; Sharma et al., 2007), and that MYC protein is stabilized by PTEN loss/AKT activation (Bonnet et al., 2011). As NOTCH1 and AKT signaling pathways are hyper-activated in >50% and 47% T-ALL cases, respectively (Weng et al., 2004; Gutierrez et al., 2009), MYC deregulation likely occurs in a majority of patient's tumors. Accordingly, MYC is now envisioned as a major driver of T-ALL oncogenesis, and uncovering the context by which MYC drives and/or maintain leukemogenesis remains an important challenge. To address this issue, we questioned here the kinetics and dynamics of MYC-mediated oncogenesis in mouse and human models.

Various transgenic mouse models have formerly established that ectopic MYC expression leads to tumorigenesis (including T-ALL) with very high penetrance; in addition, the relatively short latency observed compared to other oncogenes attributed a very strong oncogenic potential to MYC (Langenau et al., 2003; Smith et al., 2006; Dang, 2012). With regard to human kinetics of oncogenesis, this potential must however be balanced by the fact that in the transgenic models employed, all the cells of the targeted tissues (for example developing T-cells) over-expressed the MYC transgene. The probability that a cell acquires cooperating oncogenic mutations is thus incomparably higher than when only one cell harbors the initial lesion. Furthermore, in the absence of normal (T-) cells, a large modification is imposed to the thymic and peripheral microenvironments, including changes concerning the actors of the immune surveillance. To circumvent this issue, we generated mice in which ectopic Myc activation occurs sporadically in developing thymocytes at frequencies of ∼10−5 (TgMycSpo), a range similar to what was previously reported for oncogene/TCR translocations in thymus from healthy individuals (Marculescu et al., 2002; Dik et al., 2007; Fischer et al., 2007; Dadi et al., 2012). In sharp contrast to full Myc transgenic models, none of the 130 TgMycSpo mice followed for more than 1.5 years developed signs of neoplasia and/or enlargement of secondary lymphoid tissues including thymus. We show that following an initial modest but recurrent increase in frequency at young age (3–6 months) potentially due to the permissive proliferation setting during early thymic proliferation burst, tgMyc+ clones initially spread in various tissues are not maintained over time and tend to decrease with ageing. This is in full agreement with the multi-genomic alteration model of tumorigenesis, and indicates that as such, MYC oncogenic potential is too low/not sufficient to efficiently and unfailingly drive the cascade of events leading to leukemogenesis (alternatively, we cannot formally exclude that MYC-mediated oncogenesis might be more or less potent according to the stage of MYC activation). To better define the dynamics of MYC oncogenesis in man, we next exploited the hierarchy of V(D)J recombination events to unravel the kinetics of some of the early events in a double-translocated (TCR/MYC and TCR/TAL1) T-ALL case. In line with our TgMYCSpo mice data, we demonstrate that activation of both TAL1 and MYC oncogenes is uncoupled with, and insufficient for the onset of leukemia.

We conclude that the probability that a MYC+ cell (or expanded clone) acquires the complementary mutation(s) necessary for leukemia onset is extremely low and/or extremely slow (potentially following the pace of random “Darwinian-like” mutagenesis). This is in line with the recurrent findings of low levels of various major oncogenic mutations (type A or type B) in thymus from healthy individuals (Marculescu et al., 2002; Dik et al., 2007; Fischer et al., 2007; Dadi et al., 2012). Moreover, despite a potent role of MYC in genomic instability, notably through replicative stress (Dominguez-Sola et al., 2007) or induction of reactive oxygene species (Vafa et al., 2002), our data suggest that transcriptional up-regulation of MYC is unable to impose a mutator phenotype which by increasing mutation rates would have facilitated the emergence of leukemic clones (Loeb, 2011).

What are the cooperating genomic mutations that MYC requires to initiate and/or maintain leukemogenesis? MYC is at the crossroads of diverse biological pathways; notably it is involved in cell growth and cell cycle progression. However, in counterbalance of these pro-proliferation functions, MYC also promotes apoptosis through the P53/P14ARF and BIM pathways (Dang et al., 2005; Meyer and Penn, 2008). Investigations on Burkitt's lymphoma, the paradigm of MYC in human hemopathies, have taught us that MYC oncogenesis requires the combination of at least three events: (1) sustained upregulation of MYC expression; (2) inhibition of MYC protein degradation; and (3) disabling of MYC-induced pro-apoptotic pathway. Can this functional scenario of MYC-induced oncogenesis be transposed to T-ALL? In the T-ALL case reported here, we have identified four events which fulfill such oncogenic requirements, and could have synergized to lead to the aggressive clinical features observed: (1) t(7;8), allowing a dramatically high and sustained expression of MYC early on. (2) Loss of PTEN has recently been shown to allow the stabilization of the MYC protein through releasing the AKT-induced inhibition of GSK-3β, and thus preventing its phosphorylation flag to degradation (Supporting Information Fig. S5) (Bonnet et al., 2011). (3) Bi-allelic deletion of the CDKN2A/2B locus, allowing disruption of the P53-induced apoptosis pathway. Deletion of CDKN2A (encoding p16 and p14ARF proteins) and CDKN2B loci is the most common feature of T-ALL, and virtually every sample shows p14ARF inactivating mutations, methylation or deletion (Cayuela et al., 1996; Batova et al., 1997). As p14ARF is a downstream target of the MYC-induced apoptosis pathway (Dang et al., 2005), this quasi-systematic deletion constitutes a highly favorable ground for MYC oncogenesis in T-ALL. 4) Interestingly, we also observed a gain at the 19q13 chromosomal region containing iASPP, one of the most evolutionary conserved inhibitor of the P53-induced apoptosis pathway (Zhang et al., 2005; Bergamaschi et al., 2006). The apparent functional redundancy between iASPP upregulation and CDKN2A/2B deletion in shutting down P53-dependent apoptosis might reflect the critical requirement for the tumor to secure the many escape routes controlling the crucial P53 checkpoint. Alternatively, a weak oncogenic function acquired at one point of tumor development might allow long-term survival of a pre-leukemic clone, and be supplanted by a more potent one at later stages.

Finally, this functional scenario of MYC-induced oncogenesis might be applied to other T-ALL subsets, given that NOTCH1 mutations (instead of the rare TCR/MYC translocation) frequently provide sustained upregulation of MYC expression. Moreover, animal models of T-ALL involving Notch1 mutations or Pten deletion have demonstrated that MYC activation is mandatory to initiate leukemogenesis (Li et al., 2008; Guo et al., 2011; Gutierrez et al., 2011). Thus, transcriptional upregulation of MYC, although insufficient, might still be necessary for leukemia onset of a large fraction of T-ALL subsets.

ACKNOWLEDGMENTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

The authors would like to thank the Service des Animaux Transgéniques (SEAT, UPS44-CNRS, Villejuif) for the production of tgMycspo and tgCtrlspo lines. We also would like to thank Dr. Anton Langerak for critical reading of the manuscript.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information
  • Aplan PD, Jones CA, Chervinsky DS, Zhao X, Ellsworth M, Wu C, McGuire EA, Gross KW. 1997. An scl gene product lacking the transactivation domain induces bony abnormalities and cooperates with LMO1 to generate T-cell malignancies in transgenic mice. EMBO J 16:24082419.
  • Asnafi V, Beldjord K, Boulanger E, Comba B, Le Tutour P, Estienne MH, Davi F, Landman-Parker J, Quartier P, Buzyn A, Delabesse E, Valensi F, Macintyre E. 2003. Analysis of TCR, pT alpha, and RAG-1 in T-acute lymphoblastic leukemias improves understanding of early human T-lymphoid lineage commitment. Blood 101:26932703.
  • Batova A, Diccianni MB, Yu JC, Nobori T, Link MP, Pullen J, Yu AL. 1997. Frequent and selective methylation of p15 and deletion of both p15 and p16 in T-cell acute lymphoblastic leukemia. Cancer Res 57:832836.
  • Bergamaschi D, Samuels Y, Sullivan A, Zvelebil M, Breyssens H, Bisso A, Del Sal G, Syed N, Smith P, Gasco M, Crook T, Lu X. 2006. iASPP preferentially binds p53 proline-rich region and modulates apoptotic function of codon 72-polymorphic p53. Nat Genet 38:11331141.
  • Bonnet M, Loosveld M, Montpellier B, Navarro JM, Quilichini B, Picard C, Di Cristofaro J, Bagnis C, Fossat C, Hernandez L, Mamessier E, Roulland S, Morgado E, Formisano-Treziny C, Dik WA, Langerak AW, Prebet T, Vey N, Michel G, Gabert J, Soulier J, Macintyre EA, Asnafi V, Payet-Bornet D, Nadel B. 2011. Posttranscriptional deregulation of MYC via PTEN constitutes a major alternative pathway of MYC activation in T-cell acute lymphoblastic leukemia. Blood 117:66506659.
  • Cayuela JM, Madani A, Sanhes L, Stern MH, Sigaux F. 1996. Multiple tumor-suppressor gene 1 inactivation is the most frequent genetic alteration in T-cell acute lymphoblastic leukemia. Blood 87:21802186.
  • Clappier E, Cuccuini W, Kalota A, Crinquette A, Cayuela JM, Dik WA, Langerak AW, Montpellier B, Nadel B, Walrafen P, Delattre O, Aurias A, Leblanc T, Dombret H, Gewirtz AM, Baruchel A, Sigaux F, Soulier J. 2007. The C-MYB locus is involved in chromosomal translocation and genomic duplications in human T-cell acute leukemia (T-ALL), the translocation defining a new T-ALL subtype in very young children. Blood 110:12511261.
  • Clappier E, Gerby B, Sigaux F, Delord M, Touzri F, Hernandez L, Ballerini P, Baruchel A, Pflumio F, Soulier J. 2011. Clonal selection in xenografted human T cell acute lymphoblastic leukemia recapitulates gain of malignancy at relapse. J Exp Med 208:653661.
  • Dadi S, Le Noir S, Payet-Bornet D, Lhermitte L, Zacarias-Cabeza J, Bergeron J, Villarese P, Vachez E, Dik WA, Millien C, Radford I, Verhoeyen E, Cosset FL, Petit A, Ifrah N, Dombret H, Hermine O, Spicuglia S, Langerak AW, Macintyre EA, Nadel B, Ferrier P, Asnafi V. 2012. TLX homeodomain oncogenes mediate T cell maturation arrest in T-ALL via interaction with ETS1 and suppression of TCRalpha gene expression. Cancer Cell 21:563576.
  • Dang CV. 2012. MYC on the path to cancer. Cell 149:2235.
  • Dang CV, O'Donnell KA, Juopperi T. 2005. The great MYC escape in tumorigenesis. Cancer Cell 8:177178.
  • Dik WA, Nadel B, Przybylski GK, Asnafi V, Grabarczyk P, Navarro JM, Verhaaf B, Schmidt CA, Macintyre EA, van Dongen JJ, Langerak AW. 2007. Different chromosomal breakpoints impact the level of LMO2 expression in T-ALL. Blood 110:388392.
  • Dik WA, Pike-Overzet K, Weerkamp F, de Ridder D, de Haas EF, Baert MR, van der SP, Koster EE, Reinders MJ, van Dongen JJ, Langerak AW, Staal FJ. 2005. New insights on human T cell development by quantitative T cell receptor gene rearrangement studies and gene expression profiling. J Exp Med 201:17151723.
  • Dominguez-Sola D, Ying CY, Grandori C, Ruggiero L, Chen B, Li M, Galloway DA, Gu W, Gautier J, la-Favera R. 2007. Non-transcriptional control of DNA replication by c-Myc. Nature 448:445451.
  • Fasseu M, Aplan PD, Chopin M, Boissel N, Bories JC, Soulier J, von BH, Sigaux F, Regnault A. 2007. p16INK4A tumor suppressor gene expression and CD3epsilon deficiency but not pre-TCR deficiency inhibit TAL1-linked T-lineage leukemogenesis. Blood 110:26102619.
  • Ferrando AA, Herblot S, Palomero T, Hansen M, Hoang T, Fox EA, Look AT. 2004. Biallelic transcriptional activation of oncogenic transcription factors in T-cell acute lymphoblastic leukemia. Blood 103:19091911.
  • Ferrando AA, Look AT. 2003. Gene expression profiling in T-cell acute lymphoblastic leukemia. Semin Hematol 40:274280.
  • Ferrando AA, Neuberg DS, Staunton J, Loh ML, Huard C, Raimondi SC, Behm FG, Pui CH, Downing JR, Gilliland DG, Lander ES, Golub TR, Look AT. 2002. Gene expression signatures define novel oncogenic pathways in T cell acute lymphoblastic leukemia. Cancer Cell 1:7587.
  • Fischer S, Mann G, Konrad M, Metzler M, Ebetsberger G, Jones N, Nadel B, Bodamer O, Haas OA, Schmitt K, Panzer-Grumayer ER. 2007. Screening for leukemia- and clone-specific markers at birth in children with T-cell precursor ALL suggests a predominantly postnatal origin. Blood 110:30363038.
  • Guglielmi L, Truffinet V, Carrion C, Le Bert M, Cogne N, Cogne M, Denizot Y. 2005. The 5'HS4 insulator element is an efficient tool to analyse the transient expression of an Em mu-GFP vector in a transgenic mouse model. Transgenic Res 14:361364.
  • Guo W, Lasky JL, Chang CJ, Mosessian S, Lewis X, Xiao Y, Yeh JE, Chen JY, Iruela-Arispe ML, Varella-Garcia M, Wu H. 2008. Multi-genetic events collaboratively contribute to Pten-null leukaemia stem-cell formation. Nature 453:529533.
  • Guo W, Schubbert S, Chen JY, Valamehr B, Mosessian S, Shi H, Dang NH, Garcia C, Theodoro MF, Varella-Garcia M, Wu H. 2011. Suppression of leukemia development caused by PTEN loss. Proc Natl Acad Sci USA 108:14091414.
  • Gutierrez A, Grebliunaite R, Feng H, Kozakewich E, Zhu S, Guo F, Payne E, Mansour M, Dahlberg SE, Neuberg DS, Hertog J, Prochownik EV, Testa JR, Harris M, Kanki JP, Look AT. 2011. Pten mediates Myc oncogene dependence in a conditional zebrafish model of T cell acute lymphoblastic leukemia. J Exp Med 208:15951603.
  • Gutierrez A, Sanda T, Grebliunaite R, Carracedo A, Salmena L, Ahn Y, Dahlberg S, Neuberg D, Moreau LA, Winter SS, Larson R, Zhang J, Protopopov A, Chin L, Pandolfi PP, Silverman LB, Hunger SP, Sallan SE, Look AT. 2009. High frequency of PTEN, PI3K, and AKT abnormalities in T-cell acute lymphoblastic leukemia. Blood 114:647650.
  • Gutierrez A, Sanda T, Ma W, Zhang J, Grebliunaite R, Dahlberg S, Neuberg D, Protopopov A, Winter SS, Larson RS, Borowitz MJ, Silverman LB, Chin L, Hunger SP, Jamieson C, Sallan SE, Look AT. 2010. Inactivation of LEF1 in T-cell acute lymphoblastic leukemia. Blood 115:28452851.
  • Herblot S, Steff AM, Hugo P, Aplan PD, Hoang T. 2000. SCL and LMO1 alter thymocyte differentiation: inhibition of E2A-HEB function and pre-T alpha chain expression. Nat Immunol 1:138144.
  • Jotta PY, Ganazza MA, Silva A, Viana MB, da Silva MJ, Zambaldi LJ, Barata JT, Brandalise SR, Yunes JA. 2010. Negative prognostic impact of PTEN mutation in pediatric T-cell acute lymphoblastic leukemia. Leukemia 24:239242.
  • Langenau DM, Feng H, Berghmans S, Kanki JP, Kutok JL, Look AT. 2005. Cre/lox-regulated transgenic zebrafish model with conditional myc-induced T cell acute lymphoblastic leukemia. Proc Natl Acad Sci USA 102:60686073.
  • Langenau DM, Traver D, Ferrando AA, Kutok JL, Aster JC, Kanki JP, Lin S, Prochownik E, Trede NS, Zon LI, Look AT. 2003. Myc-induced T cell leukemia in transgenic zebrafish. Science 299:887890.
  • Larson RC, Lavenir I, Larson TA, Baer R, Warren AJ, Wadman I, Nottage K, Rabbitts TH. 1996. Protein dimerization between Lmo2 (Rbtn2) and Tal1 alters thymocyte development and potentiates T cell tumorigenesis in transgenic mice. EMBO J 15:10211027.
  • Le Noir S, Ben Abdelali R, Lelorch M, Bergeron J, Sungalee S, Payet-Bornet D, Villarese P, Petit A, Callens C, Lhermitte L, Baranger L, Radford-Weiss I, Gregoire MJ, Dombret H, Ifrah N, Spicuglia S, Romana S, Soulier J, Nadel B, Macintyre E, Asnafi V. 2012. Extensive molecular mapping of TCRalpha/delta- and TCRbeta-involved chromosomal translocations reveals distinct mechanisms of oncogene activation in T-ALL. Blood 120:32983309.
  • Li X, Gounari F, Protopopov A, Khazaie K, von Boehmer H. 2008. Oncogenesis of T-ALL and nonmalignant consequences of overexpressing intracellular NOTCH1. J Exp Med 205:28512861.
  • Loeb LA. 2011. Human cancers express mutator phenotypes: origin, consequences and targeting. Nat Rev Cancer 11:450457.
  • Marculescu R, Le T, Simon P, Jaeger U, Nadel B. 2002. V(D)J-mediated translocations in lymphoid neoplasms: A functional assessment of genomic instability by cryptic sites. J Exp Med 195:8598.
  • Marculescu R, Vanura K, Le T, Simon P, Jager U, Nadel B. 2003. Distinct t(7;9)(q34;q32) breakpoints in healthy individuals and individuals with T-ALL. Nat Genet 33:342344.
  • Meijerink JPP. 2010. Genetic rearrangements in relation to immunophenotype and outcome in T-cell acute lymphoblastic leukaemia. Best Practice Research Clinical Haematol 23:307318.
  • Meyer N, Penn LZ. 2008. Reflecting on 25 years with MYC. Nat Rev Cancer 8:976990.
  • Mullighan CG, Goorha S, Radtke I, Miller CB, Coustan-Smith E, Dalton JD, Girtman K, Mathew S, Ma J, Pounds SB, Su X, Pui CH, Relling MV, Evans WE, Shurtleff SA, Downing JR. 2007. Genome-wide analysis of genetic alterations in acute lymphoblastic leukaemia. Nature 446:758764.
  • Mullighan CG, Su X, Zhang J, Radtke I, Phillips LA, Miller CB, Ma J, Liu W, Cheng C, Schulman BA, Harvey RC, Chen IM, Clifford RJ, Carroll WL, Reaman G, Bowman WP, Devidas M, Gerhard DS, Yang W, Relling MV, Shurtleff SA, Campana D, Borowitz MJ, Pui CH, Smith M, Hunger SP, Willman CL, Downing JR. 2009. Deletion of IKZF1 and prognosis in acute lymphoblastic leukemia. N Engl J Med 360:470480.
  • Palomero T, Lim WK, Odom DT, Sulis ML, Real PJ, Margolin A, Barnes KC, O'Neil J, Neuberg D, Weng AP, Aster JC, Sigaux F, Soulier J, Look AT, Young RA, Califano A, Ferrando AA. 2006. NOTCH1 directly regulates c-MYC and activates a feed-forward-loop transcriptional network promoting leukemic cell growth. Proc Natl Acad Sci USA 103:1826118266.
  • Palomero T, Sulis ML, Cortina M, Real PJ, Barnes K, Ciofani M, Caparros E, Buteau J, Brown K, Perkins SL, Bhagat G, Agarwal AM, Basso G, Castillo M, Nagase S, Cordon-Cardo C, Parsons R, Zuniga-Pflucker JC, Dominguez M, Ferrando AA. 2007. Mutational loss of PTEN induces resistance to NOTCH1 inhibition in T-cell leukemia. Nat Med 13:12031210.
  • Pelengaris S, Khan M, Evan G. 2002. c-MYC: more than just a matter of life and death. Nat Rev Cancer 2:764776.
  • Petropoulos K, Arseni N, Schessl C, Stadler CR, Rawat VP, Deshpande AJ, Heilmeier B, Hiddemann W, Quintanilla-Martinez L, Bohlander SK, Feuring-Buske M, Buske C. 2008. A novel role for Lef-1, a central transcription mediator of Wnt signaling, in leukemogenesis. J Exp Med 205:515522.
  • Prinz I, Sansoni A, Kissenpfennig A, Ardouin L, Malissen M, Malissen B. 2006. Visualization of the earliest steps of gammadelta T cell development in the adult thymus. Nat Immunol 7:9951003.
  • Roulland S, Lebailly P, Lecluse Y, Heutte N, Nadel B, Gauduchon P. 2006. Long-term clonal persistence and evolution of t(14;18)-bearing B cells in healthy individuals. Leukemia 20:158162.
  • Sharma VM, Draheim KM, Kelliher MA. 2007. The Notch1/c-Myc pathway in T cell leukemia. Cell Cycle 6:927930.
  • Smith DP, Bath ML, Metcalf D, Harris AW, Cory S. 2006. MYC levels govern hernatopoietic tumor type and latency in transgenic mice. Blood 108:653661.
  • Soulier J, Clappier E, Cayuela JM, Regnault A, Garcia-Peydro M, Dombret H, Baruchel A, Toribio ML, Sigaux F. 2005. HOXA genes are included in genetic and biologic networks defining human acute T-cell leukemia (T-ALL). Blood 106:274286.
  • Spaulding C, Reschly EJ, Zagort DE, Yashiro-Ohtani Y, Beverly LJ, Capobianco A, Pear WS, Kee BL. 2007. Notch1 co-opts lymphoid enhancer factor 1 for survival of murine T-cell lymphomas. Blood 110:26502658.
  • Vafa O, Wade M, Kern S, Beeche M, Pandita TK, Hampton GM, Wahl GM. 2002. c-Myc can induce DNA damage, increase reactive oxygen species, and mitigate p53 function: A mechanism for oncogene-induced genetic instability. Mol Cell 9:10311044.
  • Van Vlierberghe P, van Grotel M, Beverloo HB, Lee C, Helgason T, Buijs-Gladdines J, Passier M, van Wering ER, Veerman AJ, Kamps WA, Meijerink JP, Pieters R. 2006. The cryptic chromosomal deletion del(11)(p12p13) as a new activation mechanism of LMO2 in pediatric T-cell acute lymphoblastic leukemia. Blood 108:35203529.
  • Weng AP, Ferrando AA, Lee W, Morris JP, Silverman LB, Sanchez-Irizarry C, Blacklow SC, Look AT, Aster JC. 2004. Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306:269271.
  • Weng AP, Millholland JM, Yashiro-Ohtani Y, Arcangeli ML, Lau A, Wai C, Del BC, Rodriguez CG, Sai H, Tobias J, Li Y, Wolfe MS, Shachaf C, Felsher D, Blacklow SC, Pear WS, Aster JC. 2006. c-Myc is an important direct target of Notch1 in T-cell acute lymphoblastic leukemia/lymphoma. Genes Dev 20:20962109.
  • Zhang J, Ding L, Holmfeldt L, Wu G, Heatley SL, Payne-Turner D, Easton J, Chen X, Wang J, Rusch M, Lu C, Chen SC, Wei L, Collins-Underwood JR, Ma J, Roberts KG, Pounds SB, Ulyanov A, Becksfort J, Gupta P, Huether R, Kriwacki RW, Parker M, McGoldrick DJ, Zhao D, Alford D, Espy S, Bobba KC, Song G, Pei D, Cheng C, Roberts S, Barbato MI, Campana D, Coustan-Smith E, Shurtleff SA, Raimondi SC, Kleppe M, Cools J, Shimano KA, Hermiston ML, Doulatov S, Eppert K, Laurenti E, Notta F, Dick JE, Basso G, Hunger SP, Loh ML, Devidas M, Wood B, Winter S, Dunsmore KP, Fulton RS, Fulton LL, Hong X, Harris CC, Dooling DJ, Ochoa K, Johnson KJ, Obenauer JC, Evans WE, Pui CH, Naeve CW, Ley TJ, Mardis ER, Wilson RK, Downing JR, Mullighan CG. 2012. The genetic basis of early T-cell precursor acute lymphoblastic leukaemia. Nature 481:157163.
  • Zhang X, Wang M, Zhou C, Chen S, Wang J. 2005. The expression of iASPP in acute leukemias. Leuk Res 29:179183.

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. ACKNOWLEDGMENTS
  8. REFERENCES
  9. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
gcc22117-sup-0001-suppInfo.doc52KSupporting Information
gcc22117-sup-0002-suppFig1.eps1124KSupporting Information Figure 1
gcc22117-sup-0003-suppFig2.eps2233KSupporting Information Figure 2
gcc22117-sup-0004-suppFig3.eps1959KSupporting Information Figure 3
gcc22117-sup-0005-suppFig4.eps870KSupporting Information Figure 4
gcc22117-sup-0006-suppFig5.tif16444KSupporting Information Figure 5
gcc22117-sup-0006-suppTab1.doc50KSupporting Information Table 1

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.