SEARCH

SEARCH BY CITATION

Keywords:

  • facial nuclei;
  • phagocytosis;
  • chemotaxis;
  • proliferation

Abstract

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Activated microglia are observed in various neurodegenerative diseases and are thought to be involved in the processes of neuronal cell death. Motoneuron damage in the facial nuclei after facial nerve avulsion is accelerated in presymptomatic transgenic rats expressing human mutant Cu2+/Zn2+ superoxide dismutase 1 (SOD1), compared with that in wild-type rats. To reveal the functional role of microglia in motoneuronal death, we investigated the microglial response after facial nerve avulsion in presymptomatic mutant SOD1H46R (mSOD1H46R) rats. At 3 days after avulsion, microglial clusters were observed in the facial nuclei of both wild-type and mSOD1H46R rats. The numbers of microglial clusters, proliferating microglia, and microglial attachments to motoneurons were significantly higher in mSOD1H46R rats, compared with those in wild-type rats. Immunopositive signals for the phagocytic marker ED1 were significantly stronger in mSOD1H46R rats, compared with that in wild-type rats, at 2 weeks after avulsion. Furthermore, primary microglia prepared from mSOD1H46R rats showed enhanced phagocytic activity, compared with that in wild-type rats. The expression of P2Y12 mRNA was higher in the facial nuclei of mSOD1H46R rats, compared with that in wild-type rats. A laser microdissection system revealed that the expression of ATF3 mRNA was higher in the motoneurons of mSOD1H46R rats, compared with that in wild-type rats, at 2 days after avulsion. These results indicate that microglial activation in response to early neuronal damage increased in mSOD1H46R rats and suggest that the enhanced activation of microglia may lead to an increase in the vulnerability of motoneurons after avulsion in mSOD1H46R rats. © 2012 Wiley Periodicals, Inc.


INTRODUCTION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Microglia are the inflammatory cells of the central nervous system and play an important role in immunoregulation by interacting with neurons, astrocytes, and other glial cells. Activated microglia are observed in injured brain and produce neuroprotective factors, which may play roles in the processes of tissue repair (Nakajima and Kohsaka,2001, 2004). In contrast, much evidence indicates that microglia influence the neurodegenerative process and disease progression in various neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS; Alexianu et al.,2001; Beers et al.,2006; Boillee et al.,2006b; Hall et al.,1998).

ALS is an adult-onset neurodegenerative disease that selectively affects motoneurons in the brain and spinal cord. Dominant mutations in the gene encoding the ubiquitously expressed Cu2+/Zn2+ superoxide dismutase 1 (SOD1) are one of the causative mutations of familial ALS (Aoki et al.,1993; Rosen,1993; Rosen et al.,1994). Transgenic (Tg) animals overexpressing the mutant form of human SOD1 develop a progressive motoneuron disease with many clinical and pathological features similar to those observed in ALS patients (Aoki et al.,2005). Several studies using mutant SOD1 (mSOD1) Tg mice have reported that mSOD1 expression not only in neurons but also in glial cells is necessary to induce motoneuron death (Clement et al.,2003; Lino et al.,2002; Pramatarova et al.,2001). Activated microglia are reportedly observed in the lumbar spinal cord of mSOD1 Tg mice before disease onset and the number of activated microglia increases during disease progression (Alexianu et al.,2001; Hall et al.,1998). Recent studies indicate that the expression of mSOD1 in microglia contributes to the progression of ALS (Beers et al.,2006). We recently reported that activated microglia cluster in an area adjacent to motoneurons and exhibit phagocytic features in the lumbar spinal cord of mSOD1H46R rats during the presymptomatic stage (Sanagi et al.,2010).

Peripheral nerve avulsion is characterized by the extensive loss of motoneurons in adult rats and is considered to be a good research tool for studying the mechanism of motoneuron degeneration. After avulsion, peroxynitrite-mediated oxidative damage and the perikaryal accumulation of phosphorylated neurofilaments have been reported in motoneurons (Martin et al.,1999). These pathological features have also been reported in the spinal motoneurons of ALS model animals and ALS patients (Boillee et al.,2006a; Bruijn etal.,2004). It has been shown that the loss of facial motoneurons after avulsion was exacerbated in mSOD1H46R and mSOD1G93A rats compared with their non-Tg littermates (Ikeda et al.,2005). These observations indicate that motoneuron degeneration as a result of facial nerve avulsion partly shares a common mechanism with the motoneuron degeneration seen in mSOD1 rats. Therefore, in this study, to understand the role of microglia in motoneuron degeneration, we examined the processes of neuronal damage and microglial activation after facial nerve avulsion in presymptomatic mSOD1H46R rats.

MATERIALS AND METHODS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Animal and Surgical Procedures

All the animal experiments were performed according to the guidelines for the Care and Use of Laboratory Animals approved by the National Institute of Neuroscience. Tg rats carrying H46R-mutated human SOD1 (mSOD1H46R rats) were provided by Dr. Masashi Aoki (Aoki et al.,2005). Tg rats were maintained as hemizygotes by mating Tg males with wild-type Sprague-Dawley females and were identified using polymerase chain reaction (PCR). The time of disease onset was identified by the onset of weight loss, reflecting denervation-induced muscle atrophy, as previously described (Nagai et al.,2001). The age of onset for mSOD1H46R rats is 171.7 days (Aoki et al.,2005).

The presymptomatic mSOD1H46R rats (39–40-day-old) were anesthetized with isoflurane and the right facial nerve was exposed. Using microhemostat forceps, the right proximal facial nerve was avulsed by gentle traction and was separated from the distal facial nerve as described elsewhere (Ruan et al.,1995).

Perfusion and Tissue Processing

Rats were deeply anesthetized with ether and were then perfused transcardially with phosphate buffered saline (PBS) followed by 4% paraformaldehyde in PBS. The fixed brains were removed and stored in 4% paraformaldehyde at 4°C for 24 h. The brainstems were cryoprotected for 48 h in 30% sucrose in PBS and embedded in OCT medium (Sakura Finetek Japan, Tokyo, Japan). Embedded tissues were rapidly frozen with dry ice and stored at −80°C until the preparation of 20-μm sections using a cryostat (CM-3000; Leica, Wetzlar, Germany), which were subsequently subjected to immunohistochemical analysis.

Nissl Staining and Motoneuron Cell Counting

Every tenth brainstem section (180-μm interval) was stained with 0.1% cresyl violet acetate (Wako, Osaka, Japan) for 30 min at room temperature. After three washes with PBS, the sections were dehydrated by passing through 70%, 80%, 90%, and 100% ethanol followed by xylene, then cover-slipped (Entellan® new; Merck, Darmstadt, Germany). The tissues were examined using light microscopy (ME600; Nikon, Tokyo, Japan), and the number of facial motoneurons with nuclei located in the facial nuclei was counted in four sections. The number of Nissl-stained motoneurons was expressed as a percentage of the number observed in the facial nuclei of the contralateral side.

3,3′-Diaminobemzidine tetrahydrochloride Staining and Motoneuron Cell Counting

Endogenous peroxidase activity was removed with a 20-min incubation period in 80% methanol containing 3% hydrogen peroxide. After three washes with PBS containing 0.3% Triton X-100 (PBST), background staining was blocked by incubating for 2 h in 1% bovine serum albumin (BSA; Sigma, St. Louis, MO) containing 0.3% Triton X-100 (1% BSA in PBST). Incubation with goat anti-choline acetyltransferase (ChAT; Millipore, Temecula, CA) primary antibody in 1% BSA in PBST (diluted 1:200) was carried out at 4°C overnight. The sections were then washed extensively with PBST and subjected to further incubation for 2 h with biotinylated anti-goat IgG secondary antibody (Vector Laboratories, Burlingame, CA) in 1% BSA in PBST (diluted 1:200) at 4°C. After three washes with PBS, the sections were placed in avidin–biotin-peroxidase complex solution (Vector Laboratories) for 1.5–3 h. After three washes, the bound antibody was visualized using 3,3′-diaminobemzidine tetrahydrochloride (DAB; Sigma). The sections were dehydrated by passing through 70%, 80%, 90%, and 100% ethanol followed by xylene, then cover-slipped (Entellan® new; Merck). The tissues were examined using light microscopy (ME600; Nikon), and the number of facial motoneurons with nuclei located in the facial nuclei was counted in each section. The number of ChAT-stained motoneurons was expressed as a percentage of the number observed in the facial nuclei of the contralateral side.

Immunohistochemical Staining

Tissue sections were permeabilized with PBST at room temperature for 30 min. After three washes with PBS, background staining was blocked by incubating for 2 h in 1% BSA in PBST, followed by incubation with the following primary antibodies in 1% BSA in PBST at 4°C overnight: rabbit anti-ionized calcium binding adaptor molecule 1 (Iba1; diluted 1:1,000; Imai et al.,1996), mouse anti-Ki67 (diluted 1:100; Novocastra, Newcastle, UK), mouse anti-ED1 (diluted 1:500; Serotec, Oxford, UK), rabbit anti-P2Y12 (diluted 1:100; provided by Dr. David Julius, Haynes et al.,2006), mouse anti-OX-42 (diluted 1:200; Millipore), and rabbit antiactivating transcription factor 3 (ATF3; diluted 1:500; Santa Cruz Biotechnology, Santa Cruz, CA). The sections were then washed extensively with PBS and subjected to further incubation for 2 h with the following secondary antibodies in 1% BSA in PBST at 4°C: Alexa Fluor 488-conjugated anti-goat or mouse IgG (diluted 1:1,000; Invitrogen, Carlsbad, CA) or Cy3-conjugated anti-rabbit IgG (diluted 1:200; Jackson ImmunoResearch, West Grove, PA). For fluorescent Nissl staining, the sections were incubated with green fluorescent Nissl stain (Invitrogen) at a dilution of 1:300 for 1 h, then counterstained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Dojindo, Kumamoto, Japan) to visualize the nuclei. After three washes, the sections were cover-slipped (Fluoromount™; Diagnostic BioSystems, Pleasanton, CA). The images shown in Fig. 1 were collected using a fluorescent microscope (AX70; Olympus, Tokyo, Japan). The images shown in Fig. 2A,C were collected using a confocal laser microscope (FV1000; Olympus), and 10 XY-images acquired at 1-μm z-step intervals were merged. In Figs. 2B, 3, 4, 6, and 7 a 1-μm-thick XY-image observed through a confocal laser microscope is shown.

thumbnail image

Figure 1. Motoneuron degeneration after avulsion was exacerbated in mSOD1H46R rats. (A) Photomicrographs showing Nissl-stained facial nuclei sections of wild-type and mSOD1H46R rats. At 3 weeks after facial nerve avulsion, the number of Nissl-stained motoneurons was lower in the facial nuclei of mSOD1H46R rats than in wild-type rats. Scale bar, 100 μm. *P < 0.05 versus wild-type rats; #P < 0.05, ##P < 0.01 versus mSOD1H46R rats 2 days after avulsion; n = 7–12 for wild-type rats, n = 8–11 for mSOD1H46R rats. (B) Brainstem sections of wild-type and mSOD1H46R rats were immunostained with anti-ChAT antibody. At 1 and 2 weeks after avulsion, the number of ChAT-positive motoneurons was lower in the facial nuclei of mSOD1H46R rats than in wild-type rats. Scale bar, 100 μm. *P < 0.05 versus wild-type rats; ##P < 0.01 versus mSOD1H46R rats 2 days after avulsion; n = 7–9 for wild-type rats, n = 8–9 for mSOD1H46R rats.

Download figure to PowerPoint

thumbnail image

Figure 2. Avulsion-induced microglial activation and the formation of microglial clusters in the facial nuclei. (A) Brainstem sections of wild-type and mSOD1H46R rats were immunostained with anti-Iba1 antibody. The arrows indicate microglial clusters. At 3 days, 1 week, 2 weeks, and 3 weeks after avulsion, the number of microglial clusters was significantly increased in the facial nuclei of mSOD1H46R rats, compared with that in wild-type rats. Scale bar, 50 μm. *P < 0.05, **P < 0.005 and ***P < 0.0001 versus wild-type rats; n = 8–12 for wild-type rats, n = 8–11 for mSOD1H46R rats. (B) Photomicrographs showing Iba1-immunostained (magenta) and DAPI-counterstained (white) microglial clusters. The clusters consisted of numerous microglia. Scale bar, 20 μm. (C) Nissl staining (green), Iba1 immunostaining (magenta), and DAPI counterstaining (white) in the facial nuclei of wild-type and mSOD1H46R rats. Microglial clusters were observed around the motoneurons. The arrows indicate the microglial clusters. Scale bar, 50 μm.

Download figure to PowerPoint

thumbnail image

Figure 3. Microglial proliferation was enhanced in mSOD1H46R rats. (A) The number of microglia was counted in Iba1-immunostained and DAPI-counterstained facial nuclei sections and expressed as a bar graph. At 2 days, 3 days, and 1 week after avulsion, the number of Iba1-positive microglia was higher in mSOD1H46R rats than in wild-type rats. *P < 0.05 and **P < 0.01 versus wild-type rats; n = 4–12 for wild-type rats, n = 5–11 for mSOD1H46R rats. (B) Brainstem sections of wild-type and mSOD1H46R rats were immunostained with anti-Ki67 (green) and anti-Iba1 (magenta) antibodies. The arrows indicate Ki-67-positive microglia in the facial nuclei after avulsion. At 3 days after avulsion, the number of Ki-67-positive microglia was significantly higher in the facial nuclei of mSOD1H46R rats than in wild-type rats. Scale bar, 50 μm. *P < 0.05 versus wild-type rats; n = 7–9 for wild-type rats, n = 8–10 for mSOD1H46R rats.

Download figure to PowerPoint

thumbnail image

Figure 4. Phagocytic activity of microglia was enhanced in mSOD1H46R rats. (A) Brainstem sections of wild-type and mSOD1H46R rats were immunostained with anti-ED1 (green) and anti-Iba1 (magenta) antibodies. The arrows indicate ED1-positive microglia in the facial nuclei after avulsion. Immunopositive signals of ED1 were expressed in microglia as early as 2 days after avulsion. At 2 and 3 weeks after avulsion, the numbers of ED1 positive microglia were higher in the facial nuclei of mSOD1H46R rats than in wild-type rats. Scale bar, 50 μm. *P < 0.05 versus wild-type rats; n = 8–12 for wild-type rats, n = 7–11 for mSOD1H46R rats. (B) An in vitro phagocytosis assay was performed using a primary microglial culture, revealing that microglia prepared from mSOD1H46R rats represent enhanced phagocytic activity, compared with microglia prepared from wild-type rats. The phagocytic activities were expressed as the intensity of FITC and were presented as a bar graph. *P < 0.05, versus wild-type rats; n = 3 for each group.

Download figure to PowerPoint

Cell Culture

Mixed glial cultures were prepared from 0 to 2-day-old rat pup cerebral cortex and were cultured until confluent, as described previously (Nakajima et al.,1992). The cells were cultured in Dulbecco's Modified Eagle Medium (Gibco, Carlsbad, CA) containing 10% fetal bovine serum at 37°C in a 10% CO2 incubator. After 2 weeks, when the cells were confluent, microglia were prepared by gentle shaking and were replated on 13-mm cover glasses at a density of 1–2 × 105 cells.

In Vitro Phagocytosis Assay

FITC-labeled beads (final, 0.0025%) were applied to microglia and incubated for 15 min at 37°C. Microglia were stained with Texas red-labeled phalloidin and DAPI, and the images were obtained using a confocal laser microscope. The amount of beads in the microglia was represented by the integral intensity of the FITC fluorescence that was calculated for each image using MetaMorph software (Molecular Devices, Sunnyvale, CA). The specific activity of phagocytosis was determined by subtracting the FITC fluorescence intensity of microglia incubated at 4°C from that of microglia incubated at 37°C.

Isolation of RNA from Facial Nuclei of Rats

The brains were rapidly dissected and frozen with liquid nitrogen. The facial nuclei were cut on dry ice, and the total RNA was extracted using acid guanidinium thiocyanate–phenol–chloroform (Chomczynski and Sacchi,1987).

Laser Microdissection and Isolation of RNA

Rats were deeply anesthetized with ether and the brains were dissected. The brainstems were embedded in OCT medium and rapidly frozen with dry ice. Frozen tissues were stored at −80°C until the preparation of 14-μm sections using a cryostat. The sections were mounted onto RNase-free Leica FrameSlides with POL-membrane (0.9 μm) and stained for 3 min in 0.05% Toluidine blue solution. The slides were washed once in DEPC-treated PBS and air-dried. Motoneurons in the brainstems were collected using a laser microdissection system (Leica). mRNA was isolated using RNeasy Plus Micro Kit (QIAGEN, Tokyo, Japan) and eluted in 20 μL RNase-free water. The prepared mRNA was subjected to reverse transcriptase-polymerase chain reaction (RT-PCR) analysis.

Reverse Transcriptase-Polymerase Chain Reaction

Total RNA was converted to first-strand cDNA using an Advantage RT-for-PCR kit (TaKaRa, Shiga, Japan), according to the manufacturer's protocol. One microliter of the resulting first-strand cDNA was then used for each PCR reaction. A real-time PCR analysis was performed using THUNDERBIRD™ SYBR qPCR Mix (TOYOBO, Osaka, Japan) and the Mx3000P™ Real-Time QPCR System (Stratagene, La Jolla, CA). The actual sequences of the specific primers are shown in Table 1. Amplifications were carried out in a 96-well optical plate, and the thermocycle conditions were as follows: 5 s at 95°C, 10 s at 55°C, and 30 s at 72°C for 40 cycles. A quantitative analysis was performed using the delta–delta Ct method with GAPDH as an internal control. GAPDH expression was consistent in all tissues prepared from the facial nuclei of mSOD1H46R and no Tg control rats, and nonoperated and 2 days after avulsion rats (data not shown).

Table 1. Primers Employed in RT-PCR Analysis
GeneSense primerAntisense primer
IL-1βAGGACCCAAGCACCTTCTTTAGACATCACGAGGCATTTTT
IL-6TAGTCCTTCCTACCCCAACTTCCTTGGTCCTTAGCCCACTCCTTC
TNFαGTCTGTGCCTCATCCTCTTCCCCATTTGGGAACTTCTCCT
TGFβTGACGTCACTGGAGTTGTCCGGGGTTCATGTCATGGATGGTGC
MCP1TGCTGTCTCAGCCAGATGCAGTTATACAGCTTCTTTGGGACACCTGCT
COX2CCAGCAGGCTCATACTGATAGGAGCAGGTCTGGGTCGAACTTG
M-CSFCTCTGGCTGACTTGGCTTGGGATTTGGTTGCTCTGTTGACTC
c-fmsGAGGGTTCATTATCCACAAGCTCGATTCACCTTAAGCC
P2X4TGGCGGACTATGTGATTCCAGGTTCACGGTGACGATCATG
P2X7GTGGAGACGGTGAAGGTGTTAACGACACCTTTGGGTCTTG
P2Y6CAATCGGAAACCATACCGAGAAAACTGACCAGTCCCCGAAA
P2Y12CATTGCTCTACACTGTCCTGAGCTCCCAGTTTGGCATCAC
GluR1GAGCAACGAAAGCCCTGTGACCCTTGGGTGTCGCAATG
GluR2TTGAGTTCTGTTACAAGTCAAGGGCAGGAAGATGGGTTAATATTCTGTGGA
SynaptophysinGCCACGGACCCAGAGAACATGGAAGCCAAACACCACTGAG
Synapsin IGCAAGTGTTGTGGCACTGACTAAGCTTCTGGACACGCACATCGT
Bcl-2CTGTGGATGACTGAGTACCTGAACAGAGACAGCCAGGAGAAATCAAAC
BaxCCAAGAAGCTGAGCGAGTGTCTCAGTTGCCATCAGCAAACATGTCA
ATF3CCTGATTTCCGAGAGTTTGGTCCTCAGCAGTGGGTACAGG
GAPDHGTCATCATCTCCGCCCCTTCTGCGATGCCTGCTTCACCACCTTCTTG

Statistical Analysis

The data of Figs. 1A,B, 5, and 7A were evaluated using analysis of variance, followed by the Tukey–Kramer post hoc test. Data of Figs. 2–4 and 7Bg were evaluated using the Student's t-test to compare the means for two groups, wild-type rats and mSOD1H46R rats, at the same postoperative days. Statistical analyses were performed using the JSTAT software program and the KaleidaGraph 3.6 software program (Synergy Software, Reading, PA). All the values were expressed as the mean ± SEM, and P-values less than 0.05 were considered significant.

thumbnail image

Figure 5. P2Y12 mRNA was up-regulated in the facial nuclei of mSOD1H46R rats. Total RNA was isolated from the facial nuclei of wild-type and mSOD1H46R rats at 2 days after avulsion, reverse-transcribed, and subsequently subjected to real-time PCR using specific primers. GAPDH served as the unchanging control mRNA. The mRNA expressions of IL-1β, MCP1, COX2, c-fms, and P2Y6 were up-regulated on the ipsilateral side of the facial nuclei, compared with the expressions on the nontreated mSOD1H46R rats. The expression levels of P2Y12 mRNA were significantly up-regulated on the ipsilateral side of mSOD1H46R rats, compared with that on the ipsilateral side of wild-type rats. *P < 0.05 and **P < 0.01 versus nontreated rats, and #P < 0.01 versus wild-type rats at 2 days after avulsion; n = 5 for nontreated wild-type rats, n = 4 for nontreated mSOD1H46R rats, n = 8 for wild-type rats at 2 days after avulsion, n = 9 for mSOD1H46R rats at 2 days after avulsion.

Download figure to PowerPoint

thumbnail image

Figure 6. P2Y12 was expressed in microglial clusters. Brainstem sections of mSOD1H46R rats were immunostained with anti-P2Y12 (green) and OX-42 (magenta) antibodies at 2 weeks after avulsion. DAPI was used for counterstaining. The immunoreactivity for P2Y12 was observed in the OX-42-positive clustered microglia. Scale bar, 20 μm.

Download figure to PowerPoint

thumbnail image

Figure 7. ATF3 was up-regulated in the motoneurons of mSOD1H46R rats. (A) RT-PCR analysis of ATF3 using RNA isolated from laser-microdissected motoneurons. The expression of ATF3 mRNA was up-regulated in motoneurons of the facial nuclei at 2 days after avulsion in both wild-type and mSOD1H46R rats. The induced expression of ATF3 mRNA by avulsion was significantly up-regulated in motoneurons of mSOD1H46R rats, compared with that in wild-type rats. **P < 0.01 versus nontreated rats, and #P < 0.01 versus wild-type rats at 2 days after avulsion; n = 5 for wild-type rats, n = 6 for mSOD1H46R rats. (B) Brainstem sections of wild-type and mSOD1H46R rats were stained with cresyl violet acetate solution (green) and anti-ATF3 antibody (magenta). At 1 week after avulsion, the number of ATF3-positive motoneurons was significantly higher in the facial nuclei of mSOD1H46R rats than in wild-type rats. Scale bar, 50 μm. *P < 0.05 versus wild-type rats; n = 7–8 for wild-type rats, n = 7–10 for mSOD1H46R rats.

Download figure to PowerPoint

RESULTS

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Exacerbation of Motoneuron Degeneration After Facial Nerve Avulsion in Presymptomatic mSOD1H46R Rats

The loss of facial motoneurons after avulsion is reportedly exacerbated in mSOD1H46R and SOD1G93A rats compared with their non-Tg littermates (Ikeda et al.,2005). To confirm the exacerbation of motoneuron loss in mSOD1H46R rats using our experimental system, we evaluated the survival of facial motoneurons after avulsion by counting the number of Nissl-stained motoneurons in the facial nuclei of wild-type and mSOD1H46R rats. At 1 week after avulsion, the number of Nissl-stained motoneurons did not differ between the injured side and the contralateral side in both wild-type and mSOD1H46R rats (Fig. 1Ae). At 3 weeks after avulsion, the number of Nissl-stained motoneurons in presymptomatic mSOD1H46R rats decreased to 55.50 ± 8.78% of that on the contralateral side in wild-type rats, whereas 81.11 ± 6.50% of the Nissl-stained motoneurons were preserved in the facial nuclei of wild-type rats (Fig. 1A).

ChAT is a marker molecule that reflects the functional activity of motoneurons. We examined ChAT immunoreactivity in the motoneurons of the facial nuclei after avulsion. At 1 week after avulsion, the number of ChAT-positive motoneurons decreased to 49.94. ± 6.66% of that on the contralateral side in mSOD1H46R rats and 74.51 ± 9.32% of that on the contralateral side in wild-type rats (Fig. 1Be). At 2 weeks after avulsion, the number of ChAT-positive motoneurons decreased significantly in mSOD1H46R rats (42.41 ± 9.12%) compared with wild-type rats (72.71 ± 7.92%).

Microglial Cluster Formation in the Facial Nuclei After Avulsion

We previously reported that microglial clusters were observed near motoneurons in the lumber spinal cord of mSOD1H46R rats (Sanagi et al.,2010). To investigate whether microglial clusters appear after avulsion, an immunohistochemical examination was performed. In both wild-type and mSOD1H46R rats, the microglia exhibited small cell bodies with highly ramified processes and were distributed throughout the facial nuclei on the contralateral side after avulsion (Fig. 2Aa,d). At 3 days after avulsion, the microglia had formed clusters in the facial nuclei of both wild-type and presymptomatic mSOD1H46R rats (arrows in Fig. 2A). The number of microglial clusters increased during the process of motoneuronal degeneration after avulsion (Fig. 2Ag) and was significantly higher in the facial nuclei after avulsion in mSOD1H46R rats, compared with that in wild-type rats (Fig. 2Ag). The microglial clusters observed in the facial nuclei after avulsion were comprised of numerous microglia (Fig. 2B). To examine the location of the microglial clusters in the facial nuclei, we performed Nissl staining and Iba1 immunostaining. The clustered microglia were found around Nissl-stained motoneurons in the facial nuclei (arrows in Fig. 2C).

Characterization of Microglia in the Facial Nuclei After Avulsion

In pathological states, the resident ramified microglia transform into activated microglia, which change their morphology and increase the expression of the microglial marker OX-42. Activated microglia have been reported to surround injured motoneurons following facial nerve axotomy in adult rats (Lopez-Redondo et al., 2000). Avulsion-induced microglial activation, characterized by an enlarged cell body and stubby processes in the facial nuclei of the ipsilateral side (Fig. 2A). The number of microglial processes was significantly lower in the facial nuclei of mSOD1H46R rats, compared with that in wild-type rats, after avulsion (data not shown). In the facial nuclei after avulsion, the expression of OX-42 was elevated in the Iba1-positive microglia, and clustered microglia were immunoreactive for OX-42 (Supp. Info. Fig. 1). Microglial attachment to the somata of motoneurons was seen in the facial nuclei after avulsion (Supp. Info. Fig. 2).

Proliferation is a key event in the activation of microglia. The number of microglia was higher in the facial nuclei of the ipsilateral side (Fig. 2A). The total number of microglia was also higher in the facial nuclei of mSOD1H46R rats after avulsion, compared with that in wild-type rats (Fig. 3A). Immunohistochemistry for Ki67, a marker of proliferating cells, was used to investigate microglial proliferation after avulsion. At 2 and 3 days after avulsion, numerous Ki67-positive microglia were observed in the facial nuclei of both wild-type and mSOD1H46R rats (Fig. 3B). At 3 days after avulsion, the number of Ki-67-positive microglia was significantly higher in mSOD1H46R rats, compared with that in wild-type rats (Fig. 3Be). However, the number of Ki-67-positive microglia was lower in the facial nuclei at 1 and 2 weeks after avulsion.

Activated microglia are known to phagocytose neural and myelin debris. Therefore, immunohistochemistry for ED1, a phagocytic marker protein, was performed to determine whether the activated microglia in the facial nuclei after avulsion were phagocytic. In the facial nuclei of wild-type and mSOD1H46R rats, immunopositive signals for ED1 were expressed in microglia as early as 2 days after avulsion (Fig. 4Ab,e). At 2 weeks after avulsion, the clustered microglia expressed particularly strong immunopositive signals for ED1 (Fig. 4Ac,f). The number of ED1-positive microglia was significantly higher in the facial nuclei of mSOD1H46R rats, compared with that in wild-type rats, at 2 and 3 weeks after avulsion (Fig. 4Ag). Furthermore, an in vitro phagocytosis assay showed that microglia prepared from mSOD1H46R rats exhibited enhanced phagocytic activity, compared with the microglia prepared from wild-type rats (Fig. 4B).

RT-PCR Analysis After Avulsion

Various factors are known to be produced by activated microglia in injured brain and are involved in the progression of neuronal injury (Nakajima and Kohsaka,2001, 2004). Proinflammatory mediators, such as interleukin-1β (IL-1β), interleukin-6 (IL-6), tumor necrosis factor α (TNFα), transforming growth factor β (TGFβ), and cyclooxygenase 2 (COX2), are known to contribute to the regulation of microglial activation in an autocrine/paracrine manner. Monocyte chemotactic protein 1 (MCP1) increases in response to brain injury and regulates the activation and recruitment of microglia (Deng et al.,2009; Zhou et al.,2007). Macrophage-colony stimulating factor (M-CSF) and its receptor, c-fms, are required to trigger signal transduction for microglial proliferation (Nakajima et al.,2006). ATP receptors including ionotropic (P2Xs) and metabotropic (P2Ys) types are known to contribute to the regulation of various physiological functions of microglia (Inoue et al.,2007).

To identify factors involved in the regulation of microglial activation and the formation of microglial clusters, we investigated the changes in these gene expressions in the facial nuclei at 2 days after avulsion. The RT-PCR method was used to detect mRNA levels of proinflammatory cytokines (IL-1β, IL-6, TNFα, and TGFβ), MCP1, COX2, M-CSF, c-fms, and ATP receptors (P2X4, P2X7, P2Y6, and P2Y12). Among these genes, the mRNA expression of IL-1β, MCP1, COX2, c-fms, and P2Y6 tended to be up-regulated on the ipsilateral side of the facial nuclei, compared with the expressions on the contralateral side, at 2 days after avulsion in both wild-type and mSOD1H46R rats (Fig. 5). No significant differences in the mRNA expressions of IL-6, TNFα, TGFβ, M-CSF, P2X4, and P2X7 were seen (data not shown). P2Y12 has been reported to be expressed in microglia and to play an important role in the control of microglial motility in response to neuronal injury (Haynes et al.,2006; Honda et al.,2001). The expression of P2Y12 mRNA was up-regulated on the ipsilateral side of the facial nuclei, compared with that on the contralateral side, at 2 days after avulsion in mSOD1H46R rats, but not in wild-type rats. The expression levels on the ipsilateral side of mSOD1H46R rats were significantly up-regulated, compared with that on the ipsilateral side of wild-type rats (Fig. 5). To check the difference between mSOD1H46R and wild-type rats, we analyzed the expression level of P2Y12 using hypoxanthine-guanine phosphoribosyltransferase (HPRT) as an internal control because HPRT expression remained consistent in all tissues and its mRNA level was relatively low in brains that are similar to those of P2Y12 genes. P2Y12 mRNA expression level of mSOD1H46R rats in 2 days after avulsion was significantly higher than that of nonoperated animals and that of wild-type rats at 2 days after avulsion, giving the same result as obtained using GAPDH (data not shown). To confirm the expression of P2Y12 in the clustered microglia, we immunostained the facial nuclei sections of wild-type and mSOD1H46R rats after avulsion with anti-P2Y12 and OX-42 antibodies. Ramified microglia were immunoreactive for P2Y12 on the contralateral side of wild-type and mSOD1H46R rats (Fig. 6). Strong immunoreactivity for P2Y12 was observed in the activated and clustered microglia.

Increased Expression of ATF3 in Motoneurons of mSOD1H46R Rats After Avulsion

At 1 week after avulsion, the number of ChAT-positive motoneurons decreased in the facial nuclei of mSOD1H46R rats (Fig. 1B). However, the enhancement of microglial activation, such as the increase in microglial clusters, microglial attachments to motoneurons, and microglial proliferation, was observed in mSOD1H46R rats at 3 days after avulsion (Figs. 2A and 3, Supp. Info. Fig. 2). Therefore, microglia may react to early neuronal change after avulsion, becoming activated and forming clusters. To demonstrate the early neuronal changes that result in the differences in microglial activation between wild-type and mSOD1H46R rats, we investigated the mRNA changes in molecules such as ionotropic glutamate receptors (GluR1 and GluR2), synaptic proteins (Synaptophysin and Synapsin I), antiapoptotic Bcl-2, and proapoptotic Bax at 2 days after avulsion. RT-PCR was performed to detect the mRNA levels in motoneurons collected from the facial nuclei using a laser microdissection system. Although the expressions of GluR1, GluR2, Synaptophysin, Synapsin I, and Bcl-2 mRNA were down-regulated, and the expression of Bax mRNA tended to be up-regulated in the motoneurons of both wild-type and mSOD1H46R rats at 2 days after avulsion, no differences in the expression levels of these genes were seen between wild-type and mSOD1H46R rats (data not shown).

ATF3, a member of the ATF/CREB family of transcription factors, is induced in the motoneurons of an ALS model mouse (Malaspina et al.,2010; Vlug et al.,2005) and in neurons injured by dorsal root avulsion (Linda et al.,2011). The expression of ATF3 mRNA was up-regulated in motoneurons at 2 days after avulsion in both wild-type and mSOD1H46R rats. The avulsion-induced expression of ATF3 mRNA was significantly up-regulated in the motoneurons of mSOD1H46R rats, compared with that in wild-type rats (Fig. 7A). Immunohistochemistry with an antibody to ATF3 revealed that ATF3 was hardly expressed on the contralateral side after avulsion. At 2 days, 3 days, and 1 week after avulsion, ATF3 was induced in the nuclei of facial motoneurons of the ipsilateral side (Fig. 7B). At a week after avulsion, the number of ATF3-positive motoneurons was significantly increased in the facial nuclei of mSOD1H46R rats, compared with that in wild-type rats (Fig. 7Bg).

DISCUSSION

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

In this study, activated microglial clusters were detected in the facial nuclei after avulsion, and the number of clusters was higher in mSOD1H46R rats than in wild-type rats (Fig. 2A). We previously reported that activated microglia clustered near motoneurons in the lumbar spinal cord of mSOD1H46R rats during the presymptomatic stage (Sanagi et al.,2010). The number of Nissl-stained motoneurons was not lower in the lumbar spinal cord of presymptomatic mSOD1H46R rats, compared with that in wild-type rats, but the ChAT immunoreactivity was weaker in the motoneurons near microglial clusters in presymptomatic mSOD1H46R rats. Therefore, microglia might react to neuronal changes early during ALS pathogenesis, becoming activated and forming clusters. As shown in Figs. 1 and 2A, the results of Nissl staining and ChAT immunostaining revealed that an increase in microglial clusters accompanied the loss of motoneurons after avulsion in both mSOD1H46R and wild-type rats. At 3 days after avulsion, the number of microglial clusters was higher in the facial nuclei of mSOD1H46R rats, compared with that in wild-type rats, whereas a lower number of Nissl- and ChAT-positive motoneurons was not observed on the ipsilateral side of both wild-type rats and mSOD1H46R rats. The number of Nissl-stained motoneurons was lower at 3 weeks after avulsion in mSOD1H46R rats, compared with that in wild-type rats (Fig. 1A). The decrease in ChAT-positive motoneurons and the increase in ATF-3 positive motoneurons were remarkable at 1 week after avulsion in mSOD1H46R rats, compared with the findings in wild-type rats (Figs. 1B and 7B). Attachment of several microglia to a motoneuron was observed in mSOD1H46R rats (Supp. Info. Fig. 2). In contrast, facial nerve axotomy did not induce significant loss of injured motoneurons in mSOD1 rats or wild-type rats (Ikeda et al.,2005). We observed that microglia clusters did not appear in the facial nuclei after facial nerve axotomy (data not shown). These results suggest that microglia after facial nerve avulsion might react to neuronal changes common to ALS, forming clusters, and that the formation of microglial clusters might be involved in neuronal degeneration and loss.

The number of total microglia was increased until 1 week after avulsion, and the number of microglial clusters increased until 1–2 weeks after avulsion in both wild-type and mSOD1H46R rats (Figs. 2A and 3A). However, Ki67-positive microglia were rarely observed at 1–2 weeks after avulsion, and the proliferation of microglia was mainly observed at 2 and 3 days after avulsion in wild-type and mSOD1H46R rats (Fig. 3B). These results indicate that the proliferative activity of microglia might not be involved in the formation of microglial clusters at 1–2 weeks after avulsion.

In pathological states, microglia alter their morphology and migrate toward injured site (Raivich et al.,1999). Migrating microglia adhere to damaged structures, such as lesioned neurons or degenerating neurite terminals. At 3 days after avulsion, the microglial attachment to motoneurons was observed in mSOD1H46R rats (Supp. Info. Fig. 2). Although whether the attachment of the microglia to the motoneurons was protective or toxic for the neurons is uncertain, microglia may react to the damaged structures of motoneurons and migrate to motoneurons in the facial nuclei of mSOD1H46R rats after avulsion. MCP-1 reportedly induces the chemotactic migration of microglia (Deng et al.,2009; Zhou et al.,2007). At 2 days after avulsion, the expression of MCP1 mRNA was up-regulated on the ipsilateral side of the facial nuclei of mSOD1H46R rats (Fig. 5). However, no significant differences in the expression levels of MCP1 mRNA on the ipsilateral side were observed between wild-type and mSOD1H46R rats. ATP is released from injured cells and is known to regulate microglial functions through ionotropic and metabotropic purinergic receptors (Inoue et al.,2007). P2Y12 is reportedly involved in microglial migration via P2Y12 (Honda et al.,2001; Ohsawa et al.,2010). We revealed that the expression of P2Y12 mRNA was transiently up-regulated on the ipsilateral side of the facial nuclei of mSOD1H46R rats, compared with that in wild-type rats (Fig. 5), and that P2Y12 immunoreactivity was observed in microglial clusters (Fig. 6). Therefore, P2Y12 induced by avulsion might be involved in the early functional changes of microglia and the formation of microglial clusters. Further studies are required to investigate whether P2Y12 in addition to other factors induce the formation of microglial clusters.

As early as 2 days after avulsion, ED1-positive microglia were observed on the ipsilateral side of the facial nuclei of both wild-type and mSOD1H46R rats (Fig. 4A). The number of ED1-positive microglia was significantly higher in mSOD1H46R rats at 3 days, 1 week, and 2 weeks after avulsion, compared with that in wild-type rats (Fig. 4A). We previously reported that phagocytic microglia were observed in the lumbar spinal cord of presymptomatic mSOD1H46R rats (Sanagi et al.,2010). Phagocytosis by microglia is an important function for the removal of dead cells and the inhibition of content leakage from dying cells (Neumann et al.,2009; Raivich et al.,1999; Stolzing and Grune,2004). Similar to the situation in facial nuclei after avulsion, microglia might acquire phagocytic activity and may be involved in early neuronal degeneration during the early nonadvanced stage of neuronal cell damage. An in vitro phagocytosis assay revealed that microglia prepared from mSOD1H46R rats have enhanced phagocytic activity without stimulation, compared with that in wild-type rats (Fig. 4B). Therefore, the phagocytic ability of microglia in mSOD1H46R rats might be enhanced before neuronal degenerative changes. Koizumi et al. (2007) reported that P2Y6 is up-regulated when neurons are damaged and may function as a sensor for phagocytosis by sensing diffusible UDP signals. A PCR analysis revealed that the expression of P2Y6 mRNA was up-regulated on the ipsilateral side of the facial nuclei of mSOD1H46R rats at 2 days after avulsion (Fig. 5). However, no significant differences in the expression levels of P2Y6 mRNA were observed between wild-type and mSOD1H46R rats. Recently, activated microglia have been reported to engulf myelinated axons via P2Y12 signaling (Maeda et al.,2010). We revealed that the expression of P2Y12 mRNA was up-regulated in the facial nuclei of mSOD1H46R rats after avulsion, compared with that in wild-type rats (Fig. 5). Therefore, P2Y12 might contribute to the enhanced phagocytic activity observed in mSOD1H46R rats.

We revealed that the expression of ATF3 mRNA was significantly up-regulated in the motoneurons of mSOD1H46R rats, compared with that in wild-type rats, at 2 days after avulsion (Fig. 7A). ATF3 is known to be induced in neurons by various insults, such as ischemia (Yin et al.,1997), and to play an important role in intracellular signaling cascades resulting in neuronal cell death (Hai and Hartman,2001; Tsujino et al.,2000). In mSOD1G93A mice, ATF3 expression in motoneurons reportedly precedes the death of spinal motoneurons (Vlug et al.,2005). Recently, Saxena et al. performed an in vivo analysis of motoneurons that were selectively identified as being vulnerable or resistant to motoneuron disease and showed that a subtype-selective endoplasmic reticulum (ER) stress response influenced disease manifestation (Saxena et al.,2009). Vulnerable motoneurons were selectively prone to ER stress, and ATF3 was specifically expressed in these vulnerable motoneurons. Dopaminergic neurons undergoing axotomy-induced neurodegenerative changes also reportedly express ATF3, and activated microglia participate in the clearance of these neurons during the early stage of neurodegeneration (Song et al.,2008). These reports indicate that the expression of ATF3 might reflect very early neurodegenerative changes in motoneurons. Although the involvement of ATF3-expressed neurons in microglial functions is not yet fully understood, microglia might react to changes in motoneurons related to ATF3 expression.

We have previously reported that immunopositive signals for TNFα and MCP-1 were stronger in the anterior horn of presymptomatic mSOD1H46R rats than in wild-type rats, and that the clustered microglia were immunoreactive for TNFα and MCP-1 (Sanagi et al.,2010). Furthermore, a RT-PCR analysis revealed that the mRNA expressions of IL-1β, COX-2, c-fms, P2Y12, TNFα, and IL-6 were up-regulated in the anterior horn of the lumbar spinal cord of presymptomatic mSOD1H46R rats, compared with that in wild-type rats (data not shown). These results suggest that these factors might damage motoneurons and might be involved in disease progression during the presymptomatic stage of ALS. In this study, we revealed that the mRNA expressions of IL-1β, MCP1, COX-2, c-fms, P2Y6, and P2Y12 were up-regulated on the ipsilateral side of the facial nuclei, compared with the expressions on the contralateral side, of wild-type and mSOD1H46R rats at 2 days after avulsion (Fig. 5), suggesting that these factors may be involved in the subsequent motoneuronal death. These factors tended to be up-regulated on the ipsilateral side of the facial nuclei of mSOD1H46R rats, compared with that in wild-type rats, at 2 and 3 days after avulsion (Fig. 5 and data not shown). Therefore, these factors might also be involved in the increased vulnerability of motoneurons after avulsion in mSOD1H46R rats.

Our results provide in vivo evidence suggesting that activated microglia contribute to the progression of neuronal cell loss. Clustered microglia might be involved in the mechanism to induce motoneuron loss which is common to motoneuron injury and motoneuron diseases such as ALS. Further studies of the factors inducing microglial activation and the following changes in microglial functions may advance our understanding of the roles of microglia in various neurodegenerative diseases.

Acknowledgements

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

The authors thank Dr. David Julius and Dr. Sharon E Haynes (Departments of Cell and Molecular Pharmacology and Physiology, University of California, San Francisco) for the gift of an antibody for P2Y12.

REFERENCES

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Supporting Information

  1. Top of page
  2. Abstract
  3. INTRODUCTION
  4. MATERIALS AND METHODS
  5. RESULTS
  6. DISCUSSION
  7. Acknowledgements
  8. REFERENCES
  9. Supporting Information

Additional Supporting Information may be found in the online version of this article.

FilenameFormatSizeDescription
GLIA_22308_sm_suppinfofig1.tif1795KSupporting Information Figure 1. OX-42 was increased by avulsion and was expressed in microglial clusters. A. Brainstem sections of wild-type and mSOD1H46R rats were immunostained with anti-OX-42 (green) and anti-Iba1 (magenta) antibodies. The images were collected using a confocal laser microscope, and 10 XY-images acquired at 1-μm z-step intervals were merged. Iba1-positive microglial clusters were strongly immunoreactive for OX-42. Scale bar, 50 μm.
GLIA_22308_sm_suppinfofig2.tif1105KSupporting Information Figure 2. Microglial attachments to motoneurons in mSOD1H46R rats. The brainstem sections of wild-type and mSOD1H46R rats were stained with cresyl violet acetate solution (green), anti-Iba1 antibody (magenta) and DAPI (blue). In the facial nuclei, the attachment of microglia to the somata of motoneurons was observed in mSOD1H46R rats at 2days after avulsion. Several microglia attached to the somata of motoneurons in mSOD1H46R rats at 1 week after avulsion. White arrows show microglia attaching to the somata of motoneurons.
GLIA_22308_sm_suppinfofig3.tif99KSupporting Information Figure 3. Real-time PCR analysis of P2Y12 mRNA in the facial nuclei of wild-type and mSOD1H46R rats. Total RNA was isolated from the facial nuclei of wild-type and mSOD1H46R rats at 2 days after avulsion, reverse-transcribed, and subsequently subjected to real-time PCR using specific primers for housekeeping genes (Sigma). HPRT served as the unchanging control mRNA. The expression levels of P2Y12 mRNA were significantly up-regulated on the ipsilateral side of mSOD1H46R rats, compared with that on the ipsilateral side of wild-type rats. *p<0.05 versus non-treated rats, and #p<0.05 versus wild-type rats at 2 days after avulsion; n=5 for non-treated wild-type rats, n=4 for non-treated mSOD1H46R rats, n=8 for wild-type rats at 2 days after avulsion, n=9 for mSOD1H46R rats at 2 days after avulsion.

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.