SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Patients and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The purpose of this study was to assess the use of dried blood spot (DBS) samples for hepatitis B virus (HBV) DNA quantification, HBV genotyping, and detection of G1896A precore mutants and variants in the YMDD polymerase motif. We studied DBS and serum samples from 82 patients with chronic HBV infection (23 hepatitis B e antigen [HBeAg]-positive and 39 HBeAg-negative), 20 HBeAg-inactive carriers, and 15 HBeAg-negative patients under lamivudine therapy (selected from chronic HBV patients). DBS samples consisted of approximately 20 μL of blood applied to 5-mm paper disks. HBV DNA quantification and HBV precore mutant detection were done using real-time polymerase chain reaction, HBV genotyping using restriction fragment length polymorphism, and YMDD variant detection by Inno-lipa assay. DBS and serum results were compared. HBV DNA was detected in a range of 102–108 copies/mL, with low intra-assay and inter-assay variation (<10%). Median DBS HBV DNA (copies/mL) was: 3.7 × 106 in HBeAg-positive, 6.2 × 105 in HBeAg-negative, and 5.5 × 102 in inactive carriers (P < .05). HBV DNA was positive in serum (median 5 × 103 copies/mL) but negative in DBS for five inactive carriers. The correlation coefficient between HBV DNA concentration in DBS versus serum samples was r2 = 0.96 (P < .001). The sensitivity of HBV DNA detection in DBS samples was 1 log10 lower than in serum samples. Concordance between DBS and serum for HBV genotyping, and for precore mutant and YMDD variant detection was optimal. DBS storage for 7 days at room temperature and 21 days at −20°C revealed no decrease in HBV DNA levels or integrity. In conclusion, the DBS sample is useful for HBV DNA quantification, genotyping, and detection of precore mutant and YMDD variants. All four determinations can be completed with a single drop of dried blood. (HEPATOLOGY 2004;40:133–139.)

Virological diagnosis and monitoring of hepatitis B virus (HBV) infection are based on serological assays that detect specific antibodies and that detect, quantify, or characterize HBV particles at the molecular level. Several authors have suggested that the study of virological characteristics such as HBV genotypes, molecular HBV variants, and quantification of HBV-DNA levels should be included as part of the laboratory testing for routine management of chronic hepatitis B (CHB) infection.1–3 However, implementation of this policy requires access to specific laboratory equipment that may not be readily available in some settings.

Dried blood spot (DBS) samples collected on filter paper have been used for genetic screening and diagnosis of several diseases. This approach is particularly useful for programs in which samples from many areas are sent to a central laboratory.4 Since it was first introduced for the detection of RNA human immunodeficiency virus type 1 in 1991, polymerase chain reaction (PCR)-based DBS methods have proved particularly effective for the detection of proviral HIV-1 DNA and for viral sequencing.5–7 In HBV infection, DBS samples have been used mainly for testing viral antigens or specific antibodies.8, 9 Application of this sample for HBV DNA quantification or genetic HBV variant analysis has not been tested. Recently, we described a protocol for genetic screening of alpha-1 antitrypsin deficiency that combines the use of DBS samples on filter paper with real-time PCR identification of the genotype.10 The ease of procuring, storing, and transporting DBS samples has led us to test these samples for the study of chronic hepatitis B infection.

The aim of this study was to assess the usefulness of DNA obtained from DBS samples for quantifying HBV DNA and identifying HBV genotypes and the G1896A precore mutant in patients with different types of HBV infection, and for detecting the emergence of genetic variants in the YMDD polymerase motif in patients under lamivudine therapy. Results obtained from DBS samples were compared with those from serum in blinded experiments using the same techniques.

Patients and Methods

  1. Top of page
  2. Abstract
  3. Patients and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Patients

The study included 82 selected hepatitis B surface antigen (HBsAg)-positive patients regularly seen in our Department of Hepatology. All patients were negative for antibodies to hepatitis C virus and hepatitis D virus. Patients were divided into four groups according to detection of hepatitis B e antigen (HBeAg) and antibody to HBeAg (anti-HBe). Group I consisted of 23 HBeAg-positive CHB patients, group II consisted of 39 HBeAg-negative CHB patients, group III consisted of 20 HBeAg-negative inactive carriers with sustained normal alanine aminotransferase levels (median 22, range 8–37 IU/L), and group IV (selected from group II) consisted of 15 HBeAg-negative patients under viral treatment with lamivudine for more than 1 year.

HBV DNA quantification, HBV genotypes, the G1896A precore mutant, and variants in the YMDD motif were assessed in DBS and serum samples. In each of the treated patients, DBS and serum samples were tested, one at initiation of treatment and one at 1 year.

Methods

Serological Assays.

HBsAg was assayed using commercial enzyme immunoassays (Vitros HBsAg, Johnson & Johnson, Rochester, NY). HBeAg and anti-HBe were detected with enzyme immunoassays (Liaison HBeAg/anti-HBe, Vercelly, Italy).

Preparation of DBS Samples.

To prepare the samples, approximately 20 μL of capillary blood or whole blood/ethylenediaminetetraacetic acid was absorbed into individual 5-mm paper disks (no. 903; Scheicher & Schuell, Dassel, Germany). The disks (three per patient) were left to dry at room temperature for up to 2 hours prior to storage in plastic bags at −20°C until use. HBV DNA from the DBS samples was eluted using a previously described protocol,10 with some modifications. One DBS disk was cut and placed in a 1.5-mL plastic tube; 200 μL of water was added and the tube was incubated at 37°C overnight. Finally, tubes were centrifuged for 30 minutes to eliminate paper residues. Preparation of DBS samples involved dilution of HBV DNA from the initial sample (capillary blood or whole blood/ethylenediaminetetraacetic acid) according to the amount of serum fixed on the filter paper. Because the hematocrit may not always be available, we established a constant value of 50%. On the basis of this value and an approximately 20 μL volume of whole blood applied to the paper, determinations with DBS samples imply working with a theoretical dilution of 1:20 of the initial HBV DNA serum sample (i.e., a disk with 20 μL of whole blood containing 10 μL of serum with a hematocrit of 50%, incubated with 200 μL of water).

HBV DNA Extraction From DBS and Serum Samples.

Viral DNA from DBS and serum samples was extracted using QIAamp mini columns (Qiagen Ltd., Sussex, UK), according to the manufacturer's instructions. HBV DNA quantification, HBV genotype and precore mutant detection, and characterization of lamivudine-resistant variants were performed by the same methods our laboratory uses for serum samples. The analyses used the same volume of extracted DNA (10 μL) from both DBS and serum samples. In all determinations, DNA from the two types of samples were processed in the same analytical run.

Quantitative Detection of HBV-DNA By the Real-Time LightCycler PCR Technique.

HBV DNA quantification was performed with two sets of PCR primers and probes corresponding to the HBV core gene.11 The oligonucleotide sequences of the primers were as follows: HBVF: 5′-GACCACCAAATGCCCCTAT-3′ (2299–2317), HBVR: 5′-CGAGATTGAGATCTTCTGCGAC-3′ (2442–2421). Hybridization used two different short oligonucleotide probes that hybridize to two adjacent internal sequences of the PCR fragment. One probe, HBVLC: 5′-TCCCTCGCCTGCCAGACG(A/C)AG(A/G)TCTC (2386–2411), was labeled at the 5′ end with a LightCycler red fluorophore (LC 640) (Roche Diagnostics, Mannheim, Germany) and phosphorylated at the 3′ end. The other probe, HBVFL: 5′-GA(G/C)GCAGGTCCCCTAGAAGAAGAA- (2361–2384), was labeled with fluorescein at the 3′ end. The PCR conditions were 4 mM MgCl2, 4 pmol of each hybridization probe, 20 pmol of the two PCR primers, 2 L of LightCycler Fast Start DNA Master Hybridization probe mix (Roche Diagnostics) and 10 L of HBV DNA. The PCR cycling program consisted of an initial denaturing step at 95°C for 10 minutes, followed by 45 amplification cycles at 92°C for 0 seconds, 50°C for 10 seconds, and 72°C for 10 seconds. The standard for quantification in serum samples was an HBV DNA serum standard containing 4.4 × 109 HBV DNA copies/mL (HBV-DNA Quantiplex assay, Chiron, Fernwald, Germany). The detection limit of HBV DNA in serum was 1.0 × 102 copies/mL. When the results exceeded 108 HBV DNA copies /mL, samples were diluted and retested.

Analysis of HBV Genotypes, the Precore 1896 Mutation, and the YMDD Variants Associated With Lamivudine Therapy.

HBV genotypes were established by restriction fragment length polymorphism on the S-gene sequence amplified by PCR, as previously described.12 The PCR products were subsequently treated with the restriction enzymes HphI, NciI, AlwI, EarI, and NlaIV. After incubation, the samples were run on 3% agarose gel and stained by ethidium bromide. Six HBV genotypes (A–F) were identified by the restriction patterns.12 To determine the precore mutant at position 1896, HBV DNA was amplified with a nested PCR technique using primers (cp21–cp31) synthesized according to the consensus sequence of the pre-C region, as reported previously.13 The PCR product was analyzed for precore mutant using real-time PCR with fluorescent hybridization probes for HBV mutant detection using the LightCycler system. The oligonucleotide sequences of primers corresponding to the HBV core gene were the following: HBVPCF: 5′-CAACTTTTTCACCTTCTGCCTA-3′ (1817–1837) and HBVPCR: 5′-GACGGAAGGAAAGAAGTCAG -3′ (1901–1962). Hybridization was performed with two different short oligonucleotide probes that hybridize to two adjacent internal sequences of the amplified PCR fragment. One probe, HBVPCLC: 5′- AGGCACAGCTTGGAGGCTTG (1884–1865) was labeled at the 5′ end with a LightCycler red fluorophore (LC 640) and phosphorylated at the 3′ end. The other probe, HBVPCFL: 5′-CATGCCC(C)AAAGCCACT- (1903–1888) was labeled with fluorescein at the 3′ end. The PCR conditions were 2 mM MgCl2, 5 pmol of each hybridization probe, 10 pmol of the two PCR primers, 2 μL of LightCycler Fast Start DNA Master Hybridization probe mix, and 2 μL of PCR product in a total volume of 20 μL. The PCR cycling program consisted of an initial denaturing step at 95°C for 7 minutes, followed by 45 amplification cycles at 92°C for 3 seconds, 48°C for 15 seconds, and 72°C for 15 seconds. After amplification was complete, a melting curve was generated by holding the reaction at 95°C for 5 seconds and then at 40°C for 30 seconds, followed by heating slowly at 0.05°C/s to 85°C with continuous collection of fluorescence at 640 nm. The melting curves were converted to melting peaks by plotting the negative derivative of the fluorescence with respect to temperature against temperature. This gave a melting peak of 48°C for the mutant A1896 precore variant and a melting peak of 59°C for the wild G1896 variant. Finally, lamivudine-resistant HBV variants were detected with PCR reverse hybridization using the Inno-Lipa HBV DR assay (Innogenetics, Ghent, Belgium), according to the manufacturer's instructions. The three genotyping assays were able to detect 1.0 × 102 HBV DNA copies/mL.

Stability of DBS Samples.

To assess stability, DBS samples from patients with HBV DNA concentrations of 104, 105, and 107 copies/mL were left to dry for 2 hours prior to storage at room temperature and at −20°C and then processed per duplicate for HBV DNA quantification at 3 days and at 1, 2, and 3 weeks after preparing the sample. The quality of DNA was assessed by comparing PCR product amplification obtained from DBS samples with that obtained from serum samples using a previously described nested PCR method.13

Statistical Analysis.

The correlation between DBS and serum sample HBV-DNA levels obtained with real-time PCR was studied with linear regression analysis. The nonparametric Mann-Whitney U test was used to compare quantitative variables. Statistical analyses were performed using the Statistical Package for Social Sciences version 10.0 (SPSS, Chicago, IL). Significance was set at P < .05.

Results

  1. Top of page
  2. Abstract
  3. Patients and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

To validate HBV DNA quantification using DBS samples, seven duplicate serial dilutions from the HBV DNA standard containing 1 × 109 HBV DNA copies/mL were prepared in whole blood negative for HBV markers of infection to obtain concentrations of 102–108 copies/mL. HBV DNA levels were assessed in the seven DBS samples prepared from each of the serial dilutions and in the serum samples obtained from each of these dilutions. The log10 HBV DNA concentrations determined by the real-time PCR assay were calculated through interpolation of the cycle threshold (CT) value from the standard curve. A linear relationship in a range of 102–107 copies/mL was observed between the CT values and the number of copies of HBV DNA serum standard in whole blood from DBS samples (r = 0.99) (Fig. 1A). In the serum samples corresponding to the seven dilutions, a linear relationship was observed in a range of 102–108 copies/mL (r > 0.99) (Fig. 1B). The fluorescence profiles generated from serum samples corresponding to the serial dilutions of HBV DNA standard (102–108 copies/mL) and from a negative control are shown in Fig. 1C.

thumbnail image

Figure 1. HBV DNA quantification by the LightCycler system. (A) Linear range (102–107 copies/mL) corresponding to DBS samples obtained from serial dilutions of the standard serum in whole blood negative for HBV expressed as logarithm of concentration versus cycle number. (B) Linear range (102–108 copies/mL) corresponding to serum samples obtained from serial dilutions of the standard serum expressed as logarithm of concentration versus cycle number. (C) Fluorescence profiles corresponding to seven serial dilutions of the standard serum (102–108 copies/mL) and a negative control versus cycle number. Note: the cycle number is the number of the PCR cycle. Serial dilutions of HBV DNA standard are numbered 1–7 (dilution number 1 was not detected in DBS samples). DBS, dried blood spot.

Download figure to PowerPoint

Linear regression analysis was performed to determine the relationship between HBV DNA results obtained from DBS samples and those from serum samples. HBV DNA concentrations determined in the two types of samples collected from 82 patients with different stages of HBV infection, including CHB and HBeAg-inactive carriers, were significantly related (r2 = 0.9646, P < .0001). Figure 2 shows a plot of log10 serum HBV DNA copies/mL versus log10 DBS HBV DNA copies/mL, with a fitted regression line described by the following equation: y = 0.65 + 1.08x. The detection limit of the DBS assay was 2 × 103 HBV DNA copies/mL in serum according to the regression line. With regard to samples containing low HBV DNA levels, among eight samples with serum HBV DNA between 103 and 104 copies/mL, seven tested positive using DBS samples, and among four samples with detectable serum HBV-DNA levels <103 copies/mL, none were positive using DBS samples.

thumbnail image

Figure 2. Regression analysis of HBV DNA levels in paired DBS samples collected on filter paper and in serum samples. Linear regression analysis of log10 transformed HBV DNA levels for the 82 matched DBS–serum pairs analyzed by real-time PCR quantitative assay revealed a slope of 1.08 with a squared correlation coefficient (r2) of 0.9646; HBV, hepatitis B virus; DBS, dried blood spot.

Download figure to PowerPoint

Experiments designed to assess the precision of the HBV DNA quantification assay were conducted by testing DBS samples from two patients with established titers of HBV DNA (2 × 104 and 2 × 105 copies/mL) 10 times in a single day; the intra-assay coefficients of variations obtained were 5.9% and 3.2%. The inter-assay coefficients of variations calculated by testing each of these serum samples once a day for 10 days were 8.3% and 6.3%. The specificity of the DBS HBV DNA assay was confirmed by the absence of signal in all the HBV DNA–negative samples included in the experiments.

No significant in vitro decrease in HBV DNA levels and no DNA degradation in gel analysis was observed in the study of DBS stability when samples were stored at room temperature for 1 week and in the three weekly assays of samples stored at −20°C.

Quantitative Detection of HBV DNA in DBS and Serum Samples.

Real-time PCR detected HBV DNA in DBS samples (>102 copies/mL) in 72 (88%) of the 82 patients studied; in 23 (100%) HBeAg-positive CHB patients; in 39 (100%) HBeAg-negative CHB patients; and in 10 (50%) inactive carriers, with a median DBS HBV DNA of 3.7 × 106, 6.2 × 105, and 5.5 × 102 copies/mL, respectively. Differences in DBS HBV DNA levels among the groups studied were statistically significant (P < .05). HBV DNA in serum samples was positive in 77 (93.9%) of the 82 patients studied; in 23 (100%) HBeAg-positive CHB patients; in 39 (100%) HBeAg-negative CHB patients; and in 15 (75%) inactive carriers. The median serum HBV DNA values were 4.5 × 107, 5.9 × 106, and 4.0 × 103 copies/mL, respectively. Differences in serum HBV-DNA levels among the groups studied were statistically significant (P < .05) (Fig. 3). Five inactive carriers were found to be HBV DNA–negative using DBS testing but were HBV DNA–positive according to serum testing. All had HBV DNA serum levels of 1 × 103copies/mL or lower.

thumbnail image

Figure 3. HBV DNA levels in whole blood spot samples collected on filter paper and in serum samples obtained from patients with chronic hepatitis B infection and inactive HBeAg-negative carriers. Median of HBV DNA levels is indicated as a dotted line within the boxes. Statistical analysis: a versus b, P = .05; c versus d, P = .005; e versus f, P = .002. HBV, hepatitis B virus; HBeAg, hepatitis B e antigen; CHB, chronic hepatitis B; DBS, dried blood spot.

Download figure to PowerPoint

HBV Genotype Characterization: Detection of the G1896A Precore Mutant and YMDD Variants Associated With Lamivudine Therapy in DBS and Serum Samples.

HBV genotypes and the G1896A precore mutant were analyzed in 20 CHB patients—10 HBeAg-positive and 10 HBeAg-negative—selected from groups I and II. Similar genotypes were obtained using DBS and serum samples, except in two cases: one genotype A and one genotype D by DBS analysis were A/D mixed genotypes by serum analysis (concordance between DBS and serum samples was 90%). In the precore mutation study, determinations with DBS and serum samples yielded identical results (Table 1).

Table 1. HBV Genotype Characterization: Precore Mutant G1896A and YMDD Mutations Associated With Lamivudine Therapy Detection in DBS and Serum Samples
 DBS SamplesSerum Samples
  • Abbreviations: WT, wild type; MT, mutated.

  • *

    Concordance DBS/serum samples 18 (90%).

  • Concordance DBS/serum samples: 20 (100%).

  • Concordance DBS/serum samples: 29 (97%).

HBV Genotypes (n = 20)*  
 HBeAg positive (n = 10)  
  Genotype A66
  Genotype D33
  Genotype F11
 HBeAg negative (n = 10)  
  Genotype A43
  Genotype D54
  Mixed genotype A/D13
Precore mutant G1896A (n = 20)  
 HBeAg positive (n = 10)  
  WT88
  Mixed WT/MT22
 HBeAg negative (n = 10)  
  MT99
  Mixed WT/MT11
YMDD mutations associated with lamivudine therapy (15 patients, 30 samples)  
 Baseline  
  YMDD (WT)1515
 Month 12  
  YMDD (WT)77
  YMDD/YIDD55
  YMDD/YVDD/YIDD23
  YVDD10

Two samples from 15 HBeAg-negative CHB patients (selected from group II) undergoing lamivudine monotherapy (100 mg/d)—one at baseline and the other at 1 year of treatment—were analyzed for HBV variants associated with lamivudine therapy. At baseline, mutations in the YMDD motif were not detected in either DBS or serum samples. At 1 year of treatment, results from DBS and serum determinations were concordant in 14 patients. In one patient, a mixture of YMDD, YVDD, and YIDD was detected in serum, whereas only the YVDD variant was found in the DBS sample (concordance between DBS and serum samples was 97%). Detection results for YMDD mutations associated with lamivudine therapy are shown in Table 1.

Discussion

  1. Top of page
  2. Abstract
  3. Patients and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

This study indicates that testing of DBS samples on filter paper is an accurate, reliable method for HBV DNA quantification and molecular diagnosis of HBV infection, including characterization of HBV genotypes, detection of the G1896A precore mutation, and detection of lamivudine-resistant HBV variants. Analysis of paired DBS and serum samples revealed a close correlation between results, which in the case of HBV DNA measurement was over a dynamic range of 7 logs (2–8 log10 copies/mL). This correlation is supported by the optimal concordance between the theoretical dilution factor inherent to the method (1:20) and the factor deduced from the regression line (≈1:12). This finding indicates that absorbed HBV DNA elutes well from the filter paper, is highly pure, and shows no significant measurable loss during elution.

Moreover, storage for 7 days at room temperature did not affect HBV DNA levels or DNA integrity. We considered that 7 days was the maximum length of time a delivery service would need to transport samples within Spain. However, for cases in which DBS samples require lengthier transport time or transport involving extreme temperature fluctuations, it will be necessary to assess the potential effects of these conditions on DNA integrity. Because the sample seems to be stable, the ultimate use of the DBS method would depend on the ability of the amplification primers to recognize and amplify the different sequences, and the final sensitivity of the PCR process. Thus DBS samples could theoretically be used with any highly sensitive commercial HBV DNA assay that allows detection of approximately 102 copies/mL of HBV DNA. Nevertheless, the practical applicability of the sample to different analytical methods should be tested in future studies.

The main reasons for monitoring HBV DNA levels are to assess disease activity for selecting patients for antiviral therapy and to determine response to therapy.1, 14–16 Advances in molecular biology have led to the development of sensitive PCR assays17–20 that can be used for this purpose. However, this advanced quantification technology is not available in all hospitals, and often these determinations are performed in referral centers. Outsourcing of samples involves a series of problems, mainly with regard to nucleic acid stability, preanalytic processing, and transport conditions.

DBS samples have been assessed as an alternative to serum.4 Blood collection on filter paper requires a small amount of sample, is minimally invasive, produces a sample that is inexpensive to ship, and requires no special handling or storage conditions. However, an important limitation of DBS samples is the smaller DNA yield, a significant factor where quantitative DNA analysis is concerned. We found that the sensitivity of the method was different when DBS or serum samples were analyzed (≈1 log10 lower in DBS than in serum). This fact seems to be related mainly with the dilution of the DBS samples inherent to the procedure of DBS preparation. Nevertheless, the difference was not significant in our analysis for two reasons: first, because the LightCycler system partially overcomes this drawback through the incorporation of fluorescently labeled probes, which make the real-time PCR technique highly sensitive for detecting minimal amounts of DNA,21 and second, because of the high sensitivity of the nested PCR methods used in the remaining analyses (102 HBV DNA copies/mL). In addition, our protocol avoids contamination by possible PCR-inhibiting substances in DBS samples by extracting DNA before PCR amplification. Nevertheless, when monitoring response to antiviral treatment, it is important to bear in mind that sensitivity is lower in analyses performed with DBS samples: the detection limit for HBV DNA is less than 103 copies/mL with DBS and is not less than 102 copies/mL.

Dried blood spot assays are reproducible and have a high degree of accuracy and precision in both inter- and intra-assay comparisons. The performance of dried samples on filter paper for HBV DNA analysis has been recently assessed using dried serum from infected ducks.22 In contrast to the methods in the present study, the authors did not use specific probes in the PCR quantification, a fact that can limit the specificity of the method. In addition, they use dried serum samples instead of whole blood, thereby requiring a skilled phlebotomist and an initial on-site centrifugation process to separate the serum before applying it to the filter paper.

There is now increasing interest in defining a cut-off value for serum HBV DNA that would be useful to differentiate CHB patients from inactive HBsAg carriers. Establishment of this value is complex, mainly because of the fluctuating course of the infection in HBeAg-negative CHB patients.23 Several values between 104 and 105 copies/mL have been suggested for this cut-off.11, 24–26 The sensitivity of the quantitative method for determining HBV DNA with DBS samples allows the use of any of the proposed values, even the most restrictive ones.

In the present study, HBV DNA concentration in DBS samples was higher in HBeAg-positive CHB than in HBeAg-negative CHB and inactive HBsAg carriers, with significant differences among the three groups. These results are comparable to our findings in serum samples and similar to those described in other studies.25–27 Moreover, they confirm that dried blood is appropriate for obtaining genetic material and that HBV DNA quantification in DBS samples can help to identify the different stages of HBV infection. Nevertheless, in centers with the required infrastructure and equipment, HBV DNA quantification in serum samples continues to be the most appropriate determination.

The implication of viral HBV genotypes and precore region mutations in the clinical aspects of HBV infection has not been fully explored, but there is evidence that these molecular variants may play a role in causing different profiles in the natural course of CHB disease.2, 3, 28 It is predictable that as increasing data on their clinical significance become available, analysis of these variants may evolve from a research tool into an essential routine for CHB management. Until now, one important obstacle in the introduction of these analyses has been the lack of a simple, rapid, accurate test. With the recent commercialization of a simple assay for this purpose, studies on the clinical value of these two determinations have increased notably.29 Another problem is the limited resources of some hospitals. A similar situation occurs with HBV testing for YMDD mutants associated with lamivudine resistance, which, despite its importance when deciding a change of therapy from lamivudine to an alternative treatment such as adefovir,30 is not widely used. The results of our study indicate that DBS samples represent a promising means for accurately identifying HBV polymorphisms and thus could increase the applicability of HBV testing, facilitating population-based studies.

In conclusion, whole blood spotted on filter paper allowed the development of a simple, sensitive, appropriate test for evaluating HBV replication and studying HBV genetic variants. It is an ideal sample for HBV diagnostic testing in areas where these analyses are concentrated in a single laboratory and cold storage and transportation are problematic. Elution of HBV DNA from a single drop of dried blood allowed the completion of all four determinations included in this study.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Patients and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The authors thank Montserrat Gimferrer and Gerardo Ruiz for their technical collaboration and Celine Cavallo for English editing.

References

  1. Top of page
  2. Abstract
  3. Patients and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References