SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Peroxisome deficiency in men causes severe pathology in several organs, particularly in the brain and liver, but it is still unknown how metabolic abnormalities trigger these defects. In the present study, a mouse model with hepatocyte-selective elimination of peroxisomes was generated by inbreeding Pex5-loxP and albumin-Cre mice to investigate the consequences of peroxisome deletion on the functioning of hepatocytes. Besides the absence of catalase-positive peroxisomes, multiple ultrastructural alterations were noticed, including hepatocyte hypertrophy and hyperplasia, smooth endoplasmic reticulum proliferation, and accumulation of lipid droplets and lysosomes. Most prominent was the abnormal structure of the inner mitochondrial membrane, which bore some similarities with changes observed in Zellweger patients. This was accompanied by severely reduced activities of complex I, III, and V and a collapse of the mitochondrial inner membrane potential. Surprisingly, these abnormalities provoked no significant disturbances of adenosine triphosphate (ATP) levels and redox state of the liver. However, a compensatory increase of glycolysis as an alternative source of ATP and mitochondrial proliferation were observed. No evidence of oxidative damage to proteins or lipids nor elevation of oxidative stress defence mechanisms were found. Altered expression of peroxisome proliferator-activated receptor alpha (PPAR-α) regulated genes indicated that PPAR-α is activated in the peroxisome-deficient cells. In conclusion, the absence of peroxisomes from mouse hepatocytes has an impact on several other subcellular compartments and metabolic pathways but is not detrimental to the function of the liver parenchyma. Supplementary material for this article can be found on the HEPATOLOGYwebsite (http://interscience.wiley.com/jpages/0270-9139/suppmat/index.html). (HEPATOLOGY 2005.)

Peroxisomes are indispensable in cellular metabolism, because they harbor enzymes essential for the degradation of very long chain and branched chain fatty acids, for the conversion of cholesterol in bile acids and for the synthesis of ether phospholipids and polyunsaturated fatty acids. They also participate in the catabolism of purines, polyamines, and pipecolic acid.1

The importance of peroxisomes is stressed by the existence of a group of genetic disorders in which one or more peroxisomal functions are impaired. The most severe is the cerebrohepatorenal syndrome of Zellweger, a peroxisome assembly disorder characterized by the absence of functional peroxisomes due to a disturbance in the peroxisomal protein import machinery.2 At birth, Zellweger syndrome patients suffer from neurological and eye abnormalities, hypotonia, characteristic craniofacial dysmorphism, and renal cysts.2 Hepatic pathology develops in the postnatal period, including hepatomegaly, fibrosis, micronodular cirrhosis, cholestasis, hyperbilirubinemia, and elevation of aminotransferases.2, 3 The biochemical hallmarks of this syndrome include the accumulation of very long chain and branched chain fatty acids, bile acid intermediates and pipecolic acid, and a severe depletion of ether phospholipids and docosahexaenoic acid.2

In a few early reports on Zellweger syndrome, mitochondrial abnormalities were documented in hepatocytes. These changes were highly variable but included alterations at the inner mitochondrial membrane with twisted or irregular cristae, dense matrix and crystalline inclusions,4–9 and a reduction of the activities of complex I and II of the respiratory chain.10 No abberant mitochondrial morphology was found in other Zellweger patients.11, 12 Not much attention was paid to these findings until in Pex5 knockout mice, a model for Zellweger syndrome13, ultrastructural changes of the inner membrane and a reduction in the activities of complex I and V of the respiratory chain were observed.14

In the present study, a mouse model with selective elimination of peroxisomes from liver was generated to circumvent the early postnatal death of the Zellweger syndrome mouse model.13 This allowed more extensive analysis of the subcellular changes associated with peroxisome dysfunction in hepatocytes.

Materials and Methods

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Chemicals.

Enzymes were purchased from Roche (Mannheim, Germany), chemicals were purchased from Sigma (Bornem, Belgium), primers for polymerase chain reaction were purchased from Eurogentec (Seraing, Belgium), and organic solvents were purchased from Biosolve (Valkenswaard, The Netherlands) or Acros (Geel, Belgium).

Breeding, Genotyping, and Analysis of Liver-Selective Pex5-Deficient Mice.

Albumin-Cre (Alb-Cre) mice obtained from The Jackson Laboratory (Bar Harbor, ME)15 were crossed with Pex5FL/+ mice.16 In the second generation, the selected Alb-Cre Pex5FL/+ mice were mated with Pex5FL/FL mice yielding Alb-Cre Pex5FL/FL mice, further denoted as L-Pex5 knockout mice, with a theoretical frequency of one in four pups. Mice with one of the other possible genotypes were considered control mice.

Genotypes were determined via polymerase chain reaction analysis on tail DNA using the Cre primers (5′-GCCTGCATTACCGGTCGATGCAACGA and 5′GTGGCAGATGGCGCGGCAACACCATT) and Pex5 primers encompassing a DNA fragment containing the 3′ loxP site (5′-CTCTGGTTCCCATTGGCCAGGGTGG′ and 5′-CTCTGGTTCCCATTGGCCAGGGTGG), allowing to distinguish a shorter wild-type– and longer loxP-containing band. Mice were bred under conventional conditions. All animal experiments were approved by the Institutional Animal Ethical Committee of the University of Leuven. Mice were anesthetized with sodium pentobarbital before removal of organs or perfusion fixation. Tissues were snap frozen in liquid nitrogen, and blood was collected via cardiac puncture in heparinized tubes.

RNA and Protein Analysis.

RNA was extracted from livers using TRIzol reagent (Invitrogen, Merelbeke, Belgium) and analyzed via Northern blotting as previously described.17 The blots were consecutively hybridized with radioactive probes and analyzed via phosphorimaging (Molecular Dynamics, Roosendaal, The Netherlands). The probes were generated via reverse-transcriptase polymerase chain reaction on mouse liver RNA17 using the following primers: metallothionein-2 (5′-TCGTCGATCTTCAACCGCCGCCGCCTCC and 5′-AAAGTTGTGGAGAACGAGTCAGG), glutathione peroxidase-1 (5′-CAGTTCCGGACACCAGGAGAATGGC and 5′-TCGATGTCGATGGTACGAAAGC), manganesesuperoxide dismutase (MnSOD) (5′-TAGTAGGAATTCGCACCACAGCAAGCACCATGCGG′ and 5′-GATGATGGATCCATAAACCAGCCCGGAGCCTGGCC), CYP4A1 (5′-CTCTAAGCCTGACCCGATTTGCAGG and 5′-AGATCTCTATAGAGGAGTCCTGACC, corresponding with mouse EST XM204174, a homologue of rat CYP4A1), multifunctional protein 1 (5′-AGGGCTATTTCTTGATAGAGGAAGG and 5′-TCAGGTAGTCACTGGGCTCCAGCTG), long chain acyl-CoA dehydrogenase (5′-CTGGCATTGCCAGGTCTCTGTGG and 5′-CATCATGGATGCAAGAAGACACACCTGG), and β-actin (5′-GCATTGTTACCAACTGGGACGACATGG and 5′-CTTCATGGTGCTAGG). Western blot analysis on liver homogenates and immunological detection with anti-rat acyl-CoA oxidase 52-kd subunit and anti-rat 3-ketoacyl-CoA thiolase antibodies was performed as previously described.17 Additional antibodies were the polyclonal rabbit anti-human Pex5p (1:3000) (a gift from Prof. S. Subramani, San Diego, CA) and anti-rat MnSOD (0.2 μg/mL, Research Diagnostics, Flanders, NJ).

Light and Electron Microscopy.

Mice were perfusion-fixed with 4% depolymerized paraformaldehyde (w/v) for light microscopy and with 4% paraformaldehyde/0.05% glutaraldehyde (v/v) for electron microscopy. Routine electron microscopy, detection of catalase activity in peroxisomes with the alkaline 3,3′-diaminobenzidine procedure, and immunocytochemistry were performed as previously described.14 For Sirius red staining, sections were deparaffinized, rehydrated, incubated for 90 minutes with an aqueous solution of saturated picric acid containing 0.1% direct red and for 2 minutes in 0.01 N HCl before dehydration and mounting.

Metabolic Analyses.

The activities of the respiratory chain enzyme complexes, citrate synthase, glutamate dehydrogenase, and aconitase were measured in the postnuclear fraction of liver homogenates and expressed per milligram of protein.14, 18 The levels of adenosine triphosphate (ATP), lactate, pyruvate, and β-hydroxybutyrate were quantified in perchloric acid extracts from liver or whole blood14 and total and oxidized glutathione in metaphosphoric acid extracts from liver.19 An indirect spectrophotometric assay was used to measure the activity of MnSOD.20 Homogenate was added to a reaction mixture containing 50 mmol/L K-phosphate buffer (pH 7.8), 0.1 mmol/L diethylenetriaminepenta-acetic acid, 400 μmol/L 2,3-bis[2-methoxy-4-nitro-5-sulfophenyl]-2H-tetrazolium-5-carboxanilide, and 0.1 mmol/L xanthine. The reaction was started by adding sufficient xanthine oxidase to obtain a measurement of 0.025 ΔA/min in a blank solution. KCN was used to discriminate between copper–zinc SOD and MnSOD. The activities of urate oxidase21 and dihydroxyacetone phosphate acyltransferase13 were measured in liver homogenates as well as malondialdehyde levels22 and protein carbonyl content.23 Glucokinase activity using the continuous assay,24 pyruvate kinase activity,25 plasmalogens,13 and branched chain fatty acids26 were determined as previously described. Glycogen content was measured via amyloglycosidase digestion followed by glucose oxidase/peroxidase assay for the quantification of glucose.27

Analyses in Hepatocyte Cell Cultures.

Hepatocytes were isolated by an in situ two-step perfusion technique originally developed for rats but without recirculation of the collagenase solution. Viability, determined via trypan blue exclusion, was always higher than 90%. Isolated hepatocytes were diluted in Williams' E (Invitrogen) supplemented with 10% fetal calf serum, 1% insulin-transferrin-selenium A supplement (Invitrogen), 1% penicillin/streptomycin (Invitrogen), and 5 mmol/L L-glutamine (Invitrogen).28 Fifty thousand cells were seeded in either Lab-Tek double-chambered coverglass wells (Nalge Nunc Int, VWR, Leuven) or 24-well plates, coated with rat-tail collagen (5 μg/cm2), and incubated at 37°C in 95% air/5% CO2. After a 4-hour attachment period, the medium was replaced by fresh Williams' E medium supplemented with 0.2% fatty acid free bovine serum albumin, 1% insulin-transferrin-selenium A supplement, dexamethasone (10 nmol/L) and L-glutamine (2 mmol/L). Experiments were conducted after an overnight recovery period.

The mitochondrial membrane potential was estimated by incubating hepatocyte cultures with 2 μmol/L 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimidazolylcarbocyanine iodide (JC-1, Molecular Probes) for 15 minutes at 37°C followed by laser scanning confocal microscopy (LSCM) (ZEISS CLSM510) (green signal: excitation 488 nm, emission 505–530 nm; red signal: excitation 543 nm, emission 560 nm).29

Hydrogen peroxide production was analyzed by incubating hepatocytes with 2 μmol/L dichlorodihydrofluorescein diacetate for 30 minutes followed by LSCM.30

To investigate the contribution of oxidative phosphorylation and glycolysis to cellular ATP production, cells were incubated for 1 hour with either 25 μmol/L iodoacetate, 10 mmol/L 2-deoxyglucose, 20 μmol/L carbonyl cyanide m-chlorophenylhydrazone, or a combination of 20 μmol/L carbonyl cyanide m-chlorophenylhydrazone with 25 μmol/L iodoacetate or 10 mmol/L 2-deoxyglucose. These concentrations were based on preliminary experiments on control cells. Cellular ATP content was investigated using the Enliten ATP assay kit (Promega, Madison, WI). Incubations were stopped by the addition of lysis buffer (150 mmol/L NaCl, 50 mmol/L Tris, 1% Triton X-100, 0.1% SDS, 1% deoxycholate, 1.5% trichloroacetic acid).31 Lysates were transferred to tubes, snap-frozen and stored at −80°C. After neutralization with 2 mol/L KOH, 2 mmol/L EDTA, and 50 mmol/L MOPS and a 10-minute incubation on ice, samples were centrifuged at 10,000g for 3 minutes. The supernatant was diluted with 100 mmol/L Tris-HCl, 2 mmol/L EDTA, 50 mmol/L MgCl2 (pH 7.75),32 and 10 μL was mixed with 20 μL reconstituted luciferase solution to measure the ATP concentration luminometrically.31

Statistics.

The unpaired two-sided Student t test was used to compare the results obtained for both groups of mice.

Results

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

Elimination of Peroxisomes From Hepatocytes.

To obtain mice with hepatocyte-selective elimination of peroxisomes, Pex5-loxP mice16 were crossed with mice expressing Cre under the control of the rat albumin promoter/enhancer.15 Genotyping of 15 litters from Alb-Cre/Pex5+/FL × Pex5FL/FL breeding pairs confirmed that 25% of the mice were Cre-positive and homozygous for the floxed Pex5 allele as expected for Mendelian-inherited alleles.

Southern blot analysis revealed that recombined Pex5 alleles were only present in the liver, supporting the tissue selectivity of the inactivation process (data not shown). This resulted in the absence of immunoreactive Pex5 protein from the livers of 5-week-old mice and the inability to import matrix proteins into peroxisomes (Fig. 1A–B; Supplementary Fig. 1 ). Indeed, only the precursor forms of the peroxisomal enzymes acyl-CoA oxidase and thiolase (not shown), carrying a peroxisome targeting signal of 1 and 2, respectively, were detectable in liver extracts of L-Pex5−/− mice, whereas in wild-type tissue these proteins were processed after their uptake in peroxisomes. The activity of urate oxidase and dihydroxyacetone phosphate acyltransferase, two peroxisomal enzymes that are very sensitive to an ectopic subcellular localization, was reduced to approximately 15% from activities in control mice (Fig. 1C–D). Despite this low activity of the latter ether phosholipid synthesizing enzyme, plasmalogen levels were normal in the peroxisome-deficient livers (Table 1). The branched chain α- and β-oxidation substrates, phytanic acid and pristanic acid, increased more than 20-fold in 20-week-old mice, but levels of the very long chain fatty acid C26:0 were unaltered compared with littermate controls (see Table 1). Tandem mass spectrometric analyses of bile acids in bile revealed the expected reduced levels of mature C24 bile acids whereas immature C27 bile acids were elevated to a variable extent (1.5- to 8-fold) (M. Duran, S. Ferdinandusse, R. Wanders, personal communication, data not shown). Based on these observations, and considering that hepatocytes constitute only 85% of liver cells, we conclude that only a minority of hepatocytes from 5- to 20-week-old L-Pex5 knockout mice still contain functional peroxisomes. Furthermore, an incomplete deletion of the target gene has been found in other models using Alb-Cre mice.33

thumbnail image

Figure 1. Inactivation of the Pex5 gene in liver. (A,B) Western blots were performed on liver homogenates of 5-week-old control and L-Pex5−/− mice. The blots were stained with (A) Pex5p or (B) acyl-CoA oxidase antibodies. Arrows indicate the unprocessed 71-kd and the processed 52-kd band of acyl-CoA oxidase. The activities of the peroxisomal enzymes (C) urate oxidase and (D) dihydroxyacetone phosphate acyltransferase were measured in at least three independent liver homogenates from 10-week-old mice. DHAPAT, dihydroxyacetone phosphate acyltransferase.

Download figure to PowerPoint

Table 1. Metabolic Alterations in Livers of 20-Week-Old L-Pex5−/−
 ControlL-Pex5−/− 
  1. NOTE. C26:0 refers to the very long chain fatty acid, cerotic acid. Results are expressed as the mean ± SD (number of independent samples).

C26:00.24 ± 0.16 (2)0.15 ± 0.01 (3)pmol/nmol phospholipid
Phytanic acid0.006 ± 0.001 (2)0.155 ± 0.071 (3)pmol/nmol phospholipid
Pristanic acid0.030 ± 0.000 (2)0.690 ± 0.190 (3)pmol/nmol phospholipid
Plasmalogens82.2 ± 14.5 (3)70.0 ± 9.4 (3)pmol/nmol phospholipid

Macroscopic and Microscopic Evaluation.

Light microscopic analysis using cytochemical staining for the peroxisomal marker enzyme catalase confirmed that peroxisomes were absent from the majority of hepatocytes. Whereas peroxisomes appeared as dark granules in wild-type hepatocytes (Fig. 2A), most L-Pex5 knockout hepatocytes displayed a vague cytosolic and/or nuclear staining (Fig. 2B). Small clusters of hepatocytes containing catalase-positive peroxisomes were very rarely encountered in a few periportal areas of L-Pex5 knockout mice (Fig. 2C), but they seemed to expand with age. As expected, normal peroxisomes were present in Kuppfer and endothelial cells from L-Pex5 knockout mice (data not shown).

thumbnail image

Figure 2. Light microscopy of liver sections from WT and L-Pex5−/− mice. (A-C) Localization of catalase activity with DAB reveals normal distribution of peroxisomes in wild-type (WT) mice (A) and their absence in the liver of L-Pex5−/− mice (B); note the nuclear staining for catalase (arrows) and the lipid vacuoles in the cytoplasm of hepatocytes lacking peroxisomes. (C) In rare small islands, hepatocytes contain a normal distribution of peroxisomes (arrowheads); note the absence of nuclear staining for catalase in such islands. Bars: 15 μm. (D,E) Sections were stained with hematoxylin-eosin. Whereas the lobular architecture of the liver is well preserved in wild-type mice (D), it appears severely distorted in L-Pex5−/− mice (E) with evidence of proliferation of large hypertrophic and hyperplastic hepatocytes that are mostly located in pericentral regions of the lobules. Bars: 100 μm. (F,G) Immunohistochemical detection of MnSOD. Whereas the signal in the liver of wild-type mice (F) is confined to sinusoidal lining cells, most hepatocytes in the L-Pex5−/− mice are positively stained (G), except for the small periportal islands that are negative (arrowheads), corresponding to peroxisome-containing cells. Bars: 100 μm. (H,I) Cytochemical staining with Sirius red reveals collagen accumulation in L-Pex5−/− livers (I). Bars: 200 μm. WT, wild-type; KO, knockout; SLC, sinusoidal lining cells; c, pericentral; p, periportal.

Download figure to PowerPoint

L-Pex5−/− mice displayed a growth retardation from the third postnatal week resulting in a 30% to 40% lower body weight than control mice at the age of 7 weeks. Thereafter, the L-Pex5−/− mice tended to catch up in growth, and by 3 months their weight was not substantially different from control mice (data not shown). Throughout this period, the mice looked healthy, were fertile, and liver function was unaffected as judged by normal levels of alanine aminotransferase, aspartate aminotransferase, and bilirubin in plasma (data not shown). However, 10-week-old L-Pex5 knockout mice displayed a severe hepatomegaly that was due to hypertrophic and hyperplastic hepatocytes, particularly in the pericentral region, that seemed to compress the sinusoids (Fig. 2D–E). Special staining with Sirius red for collagen fibers revealed fibrosis in Pex5-deficient livers from 20 weeks on (Fig. 2H–I) but liver function remained within the normal range until at least the age of 14 months (data not shown). All the L-Pex5 knockout mice survived beyond this age but developed extensive liver tumors from 12 months on.

Severe changes in mitochondrial ultrastructure were observed in 60% to 70% of the mitochondrial population in hepatocytes from 10-week-old L-Pex5 knockout mice (Fig. 3C–H). The most common finding was the proliferation of pleomorphic mitochondria with rarefication of cristae (see Fig. 3C). Other abnormalities primarily involved the inner mitochondrial membrane as previously reported in newborn generalized Pex5 knockout mice.13, 14 Mitochondria with curled and stacked cristae (Fig. 3D–E), tubulation of the inner membrane (Fig. 3C,F,H) and invagination of the cytoplasm (see Fig. 3H), as well as mitochondrial ghosts (Fig. 3E,G), were observed. In addition, some mitochondria showed inceased matrix density (see Fig. 3H), and a few were found inside autophagic vacuoles. Interestingly, mitochondria were normal in the few hepatocytes in which catalase-positive peroxisomes were found, indicating that this is a cell-autonomous phenomenon.

thumbnail image

Figure 3. Electron microscopy of livers from L-Pex5−/− mice. Sections were incubated in DAB medium for the detection of enzymatic activity of catalase in peroxisomes. (A,B) Note the absence of peroxisomes and the accumulation of lipid droplets in close association with electron-dense deposits of glycogen in the cytoplasm of hepatocytes. The bile canaliculi appear slightly dilated and are surrounded by (A) aggregates of lysosomes, while some of them contain (B) myelin-like lipid deposits (arrows). Bars: 5 μm. (C-H) Mitochondrial alterations in the liver of L-Pex5−/− mice. Note the proliferation of pleomorphic mitochondria with rarefication of cristae (C). There are some large mitochondria with stacking of curvilinear cristae (D) that may be dilated, occupying most of the matrix (arrowheads in C; F). Furthermore, mitochondrial ghosts with poorly defined outer and distorted inner membranes are present (E,G). Finally, some mitochondria have tubular cristae with increased density of matrix showing invagination of the cytoplasm and myelin figure formation (H). Bars: 0.5 μm. (I) Note the proliferation of the smooth endoplasmic reticulum, which appears in close association with glycogen particles. Bars: 1 μm. S, sinusoids; Lys, lysosomes; BC, bile canaliculi; L, lipid droplets; N, nuclei.

Download figure to PowerPoint

Additional ultrastructural changes in hepatocytes lacking perixosomes were the proliferation of the smooth endoplasmic reticulum and the appearance of lipid droplets and large groups of lysosomes with electron-dense deposits around dilated bile canaliculi (Fig. 3A–B,I), which were all more numerous than in control mice. Glycogen aggregates were found in the vicinity of the proliferated smooth endoplasmic reticulum (Fig. 3I). Myelin figures were present in vacuoles adjacent to as well as in the lumen of bile canaliculi (Fig. 3B).

Analysis of Mitochondrial Function.

To examine whether the ultrastructural changes of the inner mitochondrial membrane were accompanied by dysfunctions of the respiratory chain, the individual enzyme complexes were analyzed at different time points (Fig. 4). None of the complex activities was affected in newborn L-Pex5−/− mice. However, complex I activity was severely reduced to less than 15% at 20 weeks of age, whereas complex III and V activities were approximately 40% lower in the L-Pex5−/− mice. In contrast, no differences in complex II and complex IV activity were observed between both groups of mice. The mitochondrial membrane potential was evaluated in cultured hepatocytes, using the fluorescent probe JC-1 and LSCM. In control mouse hepatocytes, almost all mitochondria displayed a high mitochondrial membrane potential as evidenced by the orange color produced by JC-1 when it is concentrated in the mitochondrial matrix (Fig. 5A–B). In contrast, in Pex5-deficient hepatocytes, the number of orange-colored mitochondria was severely reduced, whereas many but not all mitochondria displayed a green color, which is indicative of the inability of these mitochondria to import and concentrate the JC-1 probe. These results suggest that severely impaired respiratory chain activity provokes a collapse of the mitochondrial membrane potential.

thumbnail image

Figure 4. Activities of the respiratory chain complexes. The respiratory chain enzyme activities and citrate synthase were measured in the postnuclear fraction of homogenates from control (triangles) and L-Pex5−/− livers (squares). Complex III and IV activities are expressed as rate constants (min−1/mg protein), whereas all other activities are expressed in units (U/mg protein). *P < .05; **P < .005; ***P < .001.

Download figure to PowerPoint

thumbnail image

Figure 5. Reduced inner mitochondrial membrane potential in peroxisome-deficient hepatocytes but normal levels of peroxide production. (A,B) Hepatocyte cultures were incubated with the mitochondrial tracker JC-1 and analyzed via LSCM. The wavelength of fluorescence emission of the probe depends on the intramitochondrial concentration (red corresponds to a high concentration, green corresponds to a low concentration), which in turn depends on the charge over the inner mitochondrial membrane. The emission at both wavelengths has been superimposed in the images shown. The mitochondria from control mice (A) fluoresce orange, which is compatible with a normal ΔΨm, whereas most mitochondria from L-Pex5 knockout mice (B) fluoresce green, which is indicative of a low ΔΨm. Bars: 20 μm. (C,D) Hepatocytes were incubated with dichlorodihydrofluorescein diacetate and analyzed via LSCM to visualize peroxide production. Bars: 50 μm. WT, wild-type; KO, knockout.

Download figure to PowerPoint

The reduced activity of the respiratory chain did not negatively affect the activity of the Krebs cycle, because β-oxidation of palmitate was even increased in cultured hepatocytes from L-Pex5 knockout mice compared with controls (R. Dirkx, M. Baes, P. P. Van Veldhoven, unpublished observations). In addition, the activities of the mitochondrial matrix enzymes citrate synthase (see Fig. 4) and glutamate dehydrogenase (data not shown) were increased two- to threefold in liver homogenates.

Analysis of ATP and Redox Status.

Because ATP generation and the redox state can be compromised when the respiratory chain is not functioning properly, we measured ATP levels, lactate/pyruvate, and β-hydroxybutyrate/acetoacetate ratios in 20-week-old mice that were fasted for 48 hours (Table 2). The investigation of the redox state in the livers of these mice was hampered by undetectable levels of pyruvate and acetoacetate. The lactate levels in the livers of L-Pex5−/− mice were approximately 80% higher than those in the control group, whereas no difference was observed in the β-hydroxybutyrate levels. In whole-blood extracts, lactate levels in L-Pex5−/− mice were 70% increased, whereas pyruvate levels were slightly decreased compared with control mice, resulting in the doubling of the corresponding lactate/pyruvate ratios. β-Hydroxybutyrate levels were similar in control and L-Pex5−/− mice, whereas acetoacetate was not detectable (data not shown). ATP levels in the L-Pex5−/− mice were 75% of those in control mice, but this difference was not statistically significant.

Table 2. Parameters of Energy and Redox Homeostasis in L-Pex5−/− and Control Mice
 ControlL-Pex5−/− 
  • NOTE. All measurements were made in mice fasted for 48 hours. Results are expressed as the mean ± SD (number of independent samples).

  • *

    P < .05.

ATP (liver)1.17 ± 0.62 (8)0.86 ± 0.27 (8)μmol/g liver
Lactate (liver)1.83 ± 0.71 (7)3.35 ± 0.71 (7)*μmol/g liver
β-Hydroxybutyrate (liver)0.59 ± 0.35 (8)0.70 ± 0.6 (8)μmol/g liver
Lactate (blood)2.34 ± 0.30 (5)3.94 ± 1.18 (7)*mmol/L
Pyruvate (blood)0.044 ± 0.019 (5)0.035 ± 0.009 (7)mmol/L
Lactate/pyruvate (blood)59.89 ± 19.50 (5)112.81 ± 57.22 (7) 

Glucose Metabolism.

To investigate whether increased glycolytic activity contributes to ATP levels, the activity of some of the main regulatory glycolytic enzymes was analyzed. As shown in Table 3 the activity of glucokinase and pyruvate kinase was 1.5- to 2-fold increased in livers from L-Pex5 knockout mice compared with their wild-type littermates. To further investigate the importance of glycolysis for ATP production in peroxisome-deficient hepatocytes, cultured cells were incubated with inhibitors of glycolysis (2-deoxyglucose and iodoacetate) and/or oxidative phosphorylation (carbonyl cyanide m-chlorophenylhydrazone). In agreement with the data from liver analysis, basal ATP levels were lower in Pex5−/− compared with control hepatocytes, but this did not reach statistical significance (Fig. 6). However, inactivation of glycolysis caused a more severe reduction of ATP levels in the peroxisome-deficient cells. Conversely, these cells were less sensitive to the inhibition of oxidative phosphorylation. The combined addition of glycolysis inhibitors and carbonyl cyanide m-chlorophenylhydrazone led to undetectable ATP levels in both control and peroxisome-deficient cells (data not shown). The increased glycolytic activity in hepatocytes did not affect plasma glucose levels of L-Pex5 knockout mice but was accompanied by a small decrease in liver glycogen content, both in the fed and fasted state (see Table 3). Together, these data indicate that mitochondrial ATP production is impaired in peroxisome-deficient hepatocytes but that a compensatory increase of glycolytic activity can maintain ATP levels in these cells.

Table 3. Glucose Metabolism in L-Pex5−/− and Control Mice
 ControlL-Pex5−/− 
  • NOTE. Glucose and glycogen were measured either in fed or in 24-hour fasted mice. Glucokinase and pyruvate kinase were measured in fed mice. Results are expressed as the mean ± SD (number of independent samples).

  • *

    P < .05.

  • P < .001.

Glucokinase34.0 ± 4.8 (4)68.3 ± 12.0 (4)*nmol/min/mg protein
Pyruvate kinase40.3 ± 2.1 (4)65.7 ± 4.9 (5)nmol/min/mg protein
Plasma glucose (fed)136 ± 12 (4)119 ± 8 (5)mg/dL
Plasma glucose (fasted)60 ± 7 (4)77 ± 9 (5)mg/dL
Glycogen (fed)28.3 ± 2.2 (4)23.2 ± 1.1 (4)*μmol glucose/g liver
Glycogen (fasted)5.9 ± 0.8 (4)2.4 ± 0.1 (4)μmol glucose/g liver
thumbnail image

Figure 6. Contribution of oxidative phosphorylation and glycolysis to ATP content. Three independent hepatocyte cultures were prepared from control (white bars) and L-Pex5 knockout mice (grey bars). Each condition was tested in quadruplicate wells. Hepatocytes were incubated for 1 hour with the inhibitors at the indicated concentrations. The mean ± SD is shown. *Different from the corresponding blank condition (P < .05) (2DG, 2-deoxyglucose). ATP, adenosine triphosphate; CCCP, carbonyl cyanide m-chlorophenylhydrazone; IAA, iodoacetate.

Download figure to PowerPoint

Analysis of the Oxidative Stress Status.

Because mitochondrial anomalies are often accompanied with the production of reactive oxygen species, a thorough analysis of oxidative stress parameters was conducted.

Direct measurement of peroxide production in hepatocyte cultures demonstrated that peroxide levels were not increased in hepatocytes from L-Pex5 knockout mice compared with controls (Fig. 5C–D). Malondialdehyde and protein carbonyl content were analyzed as indicators of oxidative stress damage to lipids and proteins, respectively, but no elevations were found in the livers of 20-week-old L-Pex5−/− mice (Fig. 7A–B). The activity of aconitase, a Krebs cycle enzyme that is very susceptible to oxidative inactivation,18 was not different in liver homogenates of 10-week-old control and L-Pex5−/− mice (Fig. 7C). Because the oxidized glutathione (GSSG)/glutathione (GSH) ratio can also be indicative of oxidative stress development, GSH and GSSG were measured in liver extracts. GSH levels were slightly increased (25%) in the L-Pex5−/− mice compared with control levels. GSSG levels were very low, but no difference was observed between the two groups of animals (Fig. 7D). The GSSG/GSH ratios were slightly lower in the L-Pex5−/− mice than in the control group, which is opposite of that expected in oxidative stress conditions.

thumbnail image

Figure 7. Analysis of oxidative stress parameters in L-Pex5 knockout mice. (A) Malondialdehyde content, (B) protein carbonyl content, and (C) activity of the mitochondrial enzyme aconitase in liver homogenates from 3 to 5 different control and L-Pex5 knockout mice. The mean ± SD is shown. (D) Levels of GSH and GSSG in liver homogenates of three different control (white bars) and L-Pex5 knockout (grey bars) mice. (E) Autoradiographs of Northern blots of liver messenger RNA sequentially hybridized with complementary DNA to MnSOD, glutathione peroxidase 1, and methallothionein-2. The numbers under the bands refer to the average fold change in the L-Pex5−/− mice compared with the expression level in the control mice after normalization for β-actin expression. (F) Activity measurements of MnSOD in liver homogenates from four different control and L-Pex5 KO mice. The mean ± SD is shown. (G) Immunoblots of liver homogenates of mice stained with anti-MnSOD antiserum. GSH, glutathione; GSSG, oxidized glutathione; MnSOD, manganese superoxide dismutase, MT-2, methallothionein-2.

Download figure to PowerPoint

The expression and activity of enzymes known to take part in oxidative stress defense were analyzed. No difference in transcript levels of MnSOD, glutathione peroxidase-1, or metallothionein 2 was noticed between mutant and wild-type mice (Fig. 7E). In addition, the activity of MnSOD measured in liver homogenates was not increased in Pex5-deficient livers (Fig. 7F). In contrast to these findings, MnSOD immunoreactivity was greatly increased in paraffin sections from 10-week-old L-Pex5 knockout mice compared with controls (Fig. 2F–G). However, this vast increase in MnSOD staining could not be confirmed via Western blot analysis on liver homogenates (Fig. 7G).

Alterations in Gene Expression Levels in Peroxisome-Deficient Livers.

The proliferation of the smooth endoplasmic reticulum in livers of L-Pex5 knockout mice was further investigated by analyzing expression levels of the cytochrome P450 enzyme, lauryl-ω-hydroxylase. Increased levels of this enzyme were also found in mouse models with peroxisomal β-oxidation deficiencies.34, 35 As shown in Fig. 8, transcripts of CYP4A1, but also of the peroxisomal multifunctional protein 1 and mitochondrial long-chain acyl-CoA dehydrogenase, were strongly increased in L-Pex5 knockout livers. Because all these enzymes are known PPAR-α target genes, these data point to the activation of PPAR-α in peroxisome-deficient livers.

thumbnail image

Figure 8. Induction of PPAR-α regulated enzymes in livers from 10-week-old L-Pex5 knockout mice. Autoradiographs of Northern blots of liver messenger RNA sequentially hybridized with complementary DNA to CYP4A1, multifunctional protein 1, long chain acyl-CoA dehydrogenase, and β-actin. The numbers under the bands refer to the average fold change in the L-Pex5−/− mice compared with the expression level in the control mice after normalization for β-actin expression. MFP-1, multifunctional protein 1; LCAD, long-chain acyl-CoA dehydrogenase.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The present data prove that absence of peroxisomes in hepatocytes has repercussions on different subcellular compartments, including mitochondria, endoplasmic reticulum, and lysosomes. In particular, peroxisomes seem to be necessary for the maintenance of the integrity of the inner mitochondrial membrane, a finding that confirms previous observations in patients4, 6–9 and other mouse models.13, 36, 37 Some of the presently observed ultrastructural changes at the inner mitochondrial membrane were similar to the alterations in Zellweger patients. However, crystalline inclusions in mitochondria were not seen in the livers of L-Pex5 knockout mice. The structural changes were accompanied with severely reduced activities of complex I, III, and V, whereas the activities of mitochondrial matrix enzymes were increased. This is in line with the observed mitochondrial proliferation and points to a compensatory increase of the mitochondrial compartment. It should be emphasized that all hepatocytes still contained a number of mitochondria with normal structure and membrane potential. Heterogeneity of mitochondria has previously been observed in physiological and damaging conditions in diverse tissues.38 It can only be speculated that the mitochondrial heterogeneity observed in L-Pex5 knockout livers relates to a subpopulation of mitochondria that are more susceptible to damage because of their age or because of specific functions.

There are several reasons to hypothesize that mitochondrial abnormalities might be associated with increased oxidative stress: (1) the ultrastructural changes of the mitochondria in peroxisome-deficient hepatocytes are similar to the alterations observed in conditions of oxidative stress39; (2) defects in complex I, the main production site of reactive oxygen species in mitochondria,40 lead to an increased radical production41, 42; and (3) the activity of complex I can be severely impaired as a result of oxidative stress.43 However, neither increased peroxide production, oxidative damage to proteins or lipids, nor elevation of oxidative stress defense mechanisms were found, with the exception of increased immunocytochemical staining of MnSOD. We do not have a clear-cut explanation for these discrepant results, but in the absence of any other indication for the development of reactive oxygen species, we hypothesize that the increased staining of MnSOD is not directly involved in an oxidative stress response. Recently, evidence for oxidative stress was reported in fibroblasts of patients with multifunctional protein-2 deficiency, a peroxisomal β-oxidation defect, but not in patients with peroxisome biogenesis defects,44 which is in line with the present findings.

The severe hepatic pathology found in Zellweger patients2, 3 is only partly mimicked in the L-Pex5 knockout mouse model. Hepatomegaly and fibrosis do develop, but micronodular cirrhosis, hyperbilirubinemia, and elevation of aminotransferases were not observed. This could be due to the specific situation that peroxisomes are only depleted in hepatocytes, and other tissues/cells can convert and exchange peroxisomal metabolites with the hepatocytes. The unexpected finding that plasmalogens and very long chain fatty acid levels were unaffected in peroxisome-deficient livers compared with wild-type controls is in line with this hypothesis.

At present, the functional interrelationship between peroxisomes and mitochondria remains unresolved. However, the fact that mitochondrial anomalies, although less severe, were also observed in mice with a total ablation of peroxisomal β-oxidation through the inactivation of both multifunctional protein 1 and 234 strongly suggests that perturbations of fatty acid and/or bile acid metabolism might underlie the mitochondrial defects. In the past, bile duct–ligated rats showed reduced activities of complex I, II, and III of the electron transport chain,45 and lipophilic bile acids such as chenodeoxycholate and lithocholate were shown to have an inhibitory effect on complex I and III.46 Interestingly, mitochondrial anomalies were also reported in adrenocortical cells of a mouse model for X-linked adrenoleukodystrophy,47 implying the involvement of very long chain fatty acids in the mitochondrial alterations. This is, however, an unlikely mechanism in the L-Pex5 knockout mice, because C26:0 levels were unaltered in liver phospholipids. Lastly, exogenously added peroxisome proliferators have been shown to induce a depolarization of the mitochondrial membrane and derangement of the mitochondrial respiratory chain.48, 49 In peroxisome-deficient hepatocytes, PPAR-α is activated, probably as a result of increased concentrations of endogenous PPAR-α ligands. In fact, phytanic acid, which strongly accumulates in L-Pex5 knockout livers, was previously shown to be a PPAR-α activator.50 It can therefore be hypothesized that phytanic acid or other putative PPAR-α ligands interfere with the inner mitochondrial membrane in a way similar to exogenous peroxisome proliferators. Analyses of the lipid composition of the inner mitochondrial membrane might shed light on the molecular interactions between peroxisomes and mitochondria.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

The authors appreciate the excellent technical assistance of Benno Das, Lies Pauwels, Inge Mestdagh, Els Meyhi, Inge Frommer, and Gabi Kraemmer. We thank M. Duran, S. Ferdinandusse, H. Overmars, and R. Wanders for bile acid analyses and S. Subramani for providing the Pex5 antibody.

References

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information
  • 1
    Mannaerts GP, Van Veldhoven PP. Metabolic role of mammalian peroxisomes. In: GibsonG, LakeB, eds. Peroxisomes: Biology and Importance in Toxicology and Medicine. London: Taylor & Francis, 1993: 1962.
  • 2
    Gould SJ, Raymond GV, Valle D. The peroxisome biogenesis disorders. In: ScriverCR, BeaudetAL, ValleD, and SlyWS, eds. The Metabolic and Molecular Bases of Inherited Disease. New York: McGraw-Hill, 2001: 31813217.
  • 3
    Kelley RI. The cerebrohepatorenal syndrome of Zellweger, morphologic and metabolic aspects. Am J Med Genet 1983; 16: 503517.
  • 4
    Goldfischer S, Moore CL, Johnson AB, Spiro AJ, Valsamis MP, Wisniewski HK, et al. Peroxisomal and mitochondrial defects in the cerebro-hepato-renal syndrome. Science 1973; 182: 6264.
  • 5
    Trijbels JMF, Berden JA, Monnens LAH, Willems JL, Janssen AJM, Schutgens RBH, et al. Biochemical studies in the liver and muscle of patients with Zellweger syndrome. Pediatr Res 1983; 17: 514517.
  • 6
    Mathis RK, Watkins JB, Szczepanik-Van Leeuwen P, Lott IT. Liver in the cerebro-hepato-renal syndrome: defective bile acid synthesis and abnormal mitochondria. Gastroenterology 1980; 79: 13111317.
  • 7
    Hughes JL, Poulos A, Robertson E, Chow CW, Sheffield LJ, Christodoulou J. Pathology of hepatic peroxisomes and mitochondria in patients with peroxisomal disorders. Virchows Arch A Pathol Anat Histol 1990; 416: 255264.
  • 8
    Pfeifer U, Sandhage K. Licht-und Elektronenmikroskopische Leberbefunde beim Cerebro-Hepato-renalen Syndrom nach Zellweger (Peroxisomen-Defizienz). Virchows Arch A Pathol Anat Histol 1979; 384: 269284.
  • 9
    Mooi WJ, Dingemans KP, Van den Bergh Weerman MA, Jöbsis AC, Heymans HAS, Barth PG. Ultrastructure of the liver in the cerebrohepatorenal syndrome of Zellweger. Ultrastruct Pathol 1983; 5: 135144.
  • 10
    Goldfischer S, Johnson AB, Essner E, Moore C, Ritch RH. Peroxisomal abnormalities in metabolic diseases. J Histochem Cytochem 1997; 21: 972977.
  • 11
    Aubourg P, Robain O, Rocchiccioli F, Dancea S, Scotto J. The cerebro-hepato-renal (Zellweger) syndrome: lamellar lipid profiles in adrenocortical, hepatic mesenchymal, astrocyte cells and increased levels of very long chain fatty acids and phytanic acid in the plasma. J Neurol Sci 1985; 69: 925.
  • 12
    Lazarow PB, Black V, Shio H, Fujiki Y, Hajra AK, Datta NS, et al. Zellweger syndrome: biochemical and morphological studies on two patients treated with clofibrate. Pediatr Res 1985; 19: 13561364.
  • 13
    Baes M, Gressens P, Baumgart E, Carmeliet P, Casteels M, Fransen M, et al. A mouse model for Zellweger syndrome. Nat Genet 1997; 17: 4957.
  • 14
    Baumgart E, Vanhorebeek I, Grabenbauer M, Borgers M, Declercq P, Fahimi HD, et al. Mitochondrial alterations caused by defective peroxisomal biogenesis in a mouse model for Zellweger syndrome (PEX5 knockout mouse). Am J Pathol 2001; 159: 14771494.
  • 15
    Postic C, Shiota M, Niswender KD, Jetton TL, Chen Y, Moates JM, et al. Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic β cell-specific gene knock-outs using Cre recombinase. J Biol Chem 1999; 274: 305315.
  • 16
    Baes M, Dewerchin M, Janssen A, Collen D, Carmeliet P. Generation of Pex5-IoxP mice allowing the conditional elimination of peroxisomes. Genesis 2002; 32: 177178.
  • 17
    Huyghe S, Casteels M, Janssen A, Meulders L, Mannaerts GP, Declercq PE, et al. Prenatal and postnatal development of peroxisomal lipid-metabolizing pathways in the mouse. Biochem J 2001; 353: 673680.
  • 18
    Hausladen A, Fridovich I. Superoxide and peroxynitrite inactivate aconitases, but nitric oxide does not. J Biol Chem 1994; 269: 2940529408.
  • 19
    Akerboom TPM, Sies H. Assay of glutathione, glutathione disulfide, and glutathione mixed disulfides in biological samples. Methods Enzymol 1981; 77: 373382.
  • 20
    Sutherland MW, Learmonth BA. The tetrazolium dyes MTS and XTT provide new quantitative assays for superoxide and superoxide dismutase. Free Radic Res 1997; 27: 283289.
  • 21
    Van Veldhoven PP, Just WW, Mannaerts GP. Permeability of the peroxisomal membrane to cofactors of β-oxidation. J Biol Chem 1987; 262: 43104318.
  • 22
    Wong SHY, Knight JA, Hopfer SM, Zaharia O, Leach CN, Sunderman FW. Lipoperoxides in plasma as measured by liquid-chromatographic separation of malondialdehyde-thiobarbituric acid adduct. Clin Chem 1987; 33: 214220.
  • 23
    Levine RL, Garland D, Oliver CN, Amici A, Lenz AG, Ahn BW, et al. Determination of carbonyl content in oxidatively modified proteins. Methods Enzymol 1990; 186: 464478.
  • 24
    Davidson AL, Arion WJ. Factors underlying significant underestimation of glucokinase activity in crude liver extracts: physiological implications of higher cellular activity. Arch Biochem Biophys 1987; 253: 156157.
  • 25
    Imamura K, Tanaka T. Pyruvate kinase isoenzymes from rat. Methods Enzymol 1982; 90: 150165.
  • 26
    Baes M, Gressens P, Huyghe S, De Nys K, Qi C, Jia Y, et al. The neuronal migration defect in mice with Zellweger syndrome (Pex5 knockout) is not caused by the inactivity of peroxisomal β-oxidation. J Neuropath Exp Neur 2002; 61: 368374.
  • 27
    Keppler D, Decker K. Glycogen. Methods of enzymatic analysis. In: BergmeyerHU, ed. Metabolites 1: Carbohydrates. Weinheim, Germany: Verlag Chemie, 1984: 1118.
  • 28
    Honkakoski P, Negishi M. Protein serine/threonine phosphatase inhibitors suppress phenobarbital-induced Cyp2b10 gene transcription in mouse primary hepatocytes. Biochem J 1998; 330: 889895.
  • 29
    Smiley ST, Reers M, Mottola-Hartshorn C, Lin M, Chen A, Smith TW, et al. Intracellular heterogeneity in mitochondrial membrane potentials revealed by a J-aggregate-forming lipophilic cation JC-1. Proc Natl Acad Sci U S A 1991; 88: 36713675.
  • 30
    Degli Esposti M. Measuring mitochondrial reactive oxygen species. Methods 2002; 26: 335340.
  • 31
    Cheng G, Polito CC, Haines JK, Shafizadeh SF, Fiorini RN, Zhou X, et al. Decrease of intracellular ATP content downregulated UCP2 expression in mouse hepatocytes. Biochem Biophys Res Commun 2003; 308: 573580.
  • 32
    Menzies FM, Cookson MR, Taylor RW, Turnbull DM, Chrzanowska-Lightowlers ZM, Dong L, et al. Mitochondrial dysfunction in a cell culture model of familial amyotrophic lateral sclerosis. Brain 2002; 125: 15221533.
  • 33
    Jia Y, Qi C, Kashireddi P, Surapureddi S, Zhu Y-Z, Rao MS, et al. Transcription coactivator PBP, the peroxisome proliferator-activated receptor (PPAR)-binding protein, is required for PPARα-regulated gene expression in liver. J Biol Chem 2004; 279: 2442724434.
  • 34
    Fan C-Y, Pan J, Usuda N, Yeldandi AV, Rao MS, Reddy JK. Steatohepatitis, spontaneous peroxisome proliferation and liver tumors in mice lacking peroxisomal fatty acyl-CoA oxidase. J Biol Chem 1998; 273: 1563915645.
  • 35
    Jia Y, Qi C, Zhang Z, Hashimoto T, Rao MS, Huyghe S, et al. Overexpression of peroxisome proliferator-activated receptor-alpha (PPARalpha)-regulated genes in liver in the absence of peroxisome proliferation in mice deficient in both L- and D-forms of enoyl-CoA hydratase/dehydrogenase enzymes of peroxisomal beta-oxidation system. J Biol Chem 2003; 278: 4723247239.
  • 36
    Kovacs WJ, Shackelford JE, Tape KN, Richards MJ, Faust PL, Fliesler SJ, et al. Disturbed cholesterol homeostasis in a peroxisome-deficient PEX2 knockout mouse model. Mol Cell Biol 2004; 24: 113.
  • 37
    Maxwell M, Bjorkman J, Nguyen T, Sharp P, Finnie J, Paterson C, et al. Pex13 inactivation in the mouse disrupts peroxisome biogenesis and leads to a Zellweger syndrome phenotype. Mol Cell Biol 2003; 23: 59475957.
  • 38
    Kuznetsov AV, Usson Y, Leverve XMR. Subcellular heterogeneity of mitochondrial function and dysfunction: evidence obtained by confocal imaging. Mol Cell Biochem 2004; 256: 359365.
  • 39
    Treem WR, Sokol RJ. Disorders of the mitochondria. Semin Liver Dis 1998; 18: 237253.
  • 40
    Hansford RG, Hogue BA, Mildaziene V. Dependence of H2O2 formation by rat heart mitochondria on substrate availability and donor age. J Bioenerg Biomembr 1997; 29: 8995.
  • 41
    Barrientos A, Moraes CT. Titrating the effects of mitochondrial complex I impairment in the cell physiology. J Biol Chem 1999; 274: 1618816197.
  • 42
    Pitkänen S, Robinson BH. Mitochondrial complex I deficiency leads to increased production of superoxide radicals and induction of superoxide dismutase. J Clin Invest 1996; 98: 345351.
  • 43
    Paradies G, Petrosillo G, Pistolese M, Di Venosa N, Federici A, Ruggiero FR. Decrease in mitochondrial complex I activity in ischemic/reperfused rat heart. Circ Res 2004; 94: 5359.
  • 44
    Ferdinandusse S, Finckh B, de Hingh YC, Stroomer LE, Denis S, Kohlschutter A, et al. Evidence for increased oxidative stress in peroxisomal D-bifunctional protein deficiency. Mol Genet Metab 2003; 79: 281287.
  • 45
    Krähenbühl S, Stucki J, Reichen J. Reduced activity of the electron transport chain in liver mitochondria isolated from rats with secondary biliary cirrhosis. HEPATOLOGY 1992; 15: 11601166.
  • 46
    Krähenbühl S, Talos C, Fischer S, Reichen J. Toxicity of bile acids on the electron transport chain of isolated rat liver mitochondria. HEPATOLOGY 1994; 19: 471479.
  • 47
    McGuinness MC, Lu J-F, Zhang H-P, Dong G-X, Heinzer AK, Watkins PA, et al. Role of ALDP (ABCD1) and mitochondria in X-linked adrenoleukodystrophy. Mol Cell Biol 2003; 23: 744753.
  • 48
    Zhou S, Wallace KB. The effect of peroxisome proliferators on mitochondrial bioenergetics. Toxicol Sci 1999; 48: 8289.
  • 49
    Scatena R, Bottoni P, Martorana GE, Ferrari F, De Sole P, Rossi C, et al. Mitochondrial respiratory chain dysfunction, a non-receptor-mediated effect of synthetic PPAR-ligands: biochemical and pharmacological implications. Biochem Biophys Res Commun 2004; 319: 967973.
  • 50
    Ellinghaus P, Wolfrum C, Assmann G, Spener F, Seedorf U. Phytanic acid activates the peroxisome proliferator-activated receptor α (PPARα) in sterol carrier protein 2-/sterol carrier protein x-deficient mice. J Biol Chem 1999; 274: 27662772.

Supporting Information

  1. Top of page
  2. Abstract
  3. Materials and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  8. Supporting Information

This article includes a Supplementary Figure available at http://www.interscience.wiley.com/jpages/0270-9139/suppmat

FilenameFormatSizeDescription
jwsHEPv41.4.868.figures.ppt585KImport of peroxisomal enzymes, and activities of urate oxidase and DHAPAT in the postnatal period in L-Pex5 knockout mice and control littermates. Experiments were performed on liver homogenates of mice of the indicated ages (W = age in weeks) as described for Figure 1

Please note: Wiley Blackwell is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article.