Differential regulation of rodent hepatocyte and oval cell proliferation by interferon γ

Authors


  • Potential conflict of interest: Nothing to report.

Abstract

Hepatocytes and intrahepatic progenitor cells (oval cells) have similar responses to most growth factors but rarely proliferate together. Oval cells constitute a reserve compartment that is activated when hepatocyte proliferation is inhibited. Interferon γ (IFN-γ) increases in liver injury that involves oval cell responses, but it is not upregulated during liver regeneration after partial hepatectomy. Based on these observations, we used well-characterized lines of hepatocytes (AML-12 cells) and oval cells (LE-6 cells) to investigate the potential mechanisms that regulate differential growth responses in hepatocytes and oval cells. We show that IFN-γ blocks hepatocyte proliferation in vivo, and that in combination with either tumor necrosis factor (TNF) or lipopolysaccharide (LPS), it causes cell cycle arrest in hepatocytes but stimulates oval cell proliferation in cultured cells. The hepatocyte cell cycle arrest is reversible, is p53-independent, and is not associated with apoptosis. Treatment of AML-12 hepatocytes with IFN-γ/LPS or IFN-γ/TNF, but not with individual cytokines, induced NO synthase and generated NO, while similarly treated oval cells produced little if any NO. Generation of NO by an NO donor reproduced the inhibitory effect of the cytokine combinations on AML-12 cell replication, while NO inhibitors abolish the replication deficiency. In conclusion, we propose that IFN-γ, in conjunction with TNF or LPS, can both inhibit hepatocyte proliferation through the generation of NO and stimulate oval cell replication. The response of hepatocytes and oval cells to cytokine combinations may contribute to the differential proliferation of these cells in hepatic growth processes. (HEPATOLOGY 2005;41:906–915.)

Growth responses in the adult liver can involve hepatocytes or liver precursor cells known as oval cells.1 Regeneration of the liver after partial hepatectomy or acute chemical injury is dependent on the replication of hepatocytes.2 In contrast, in hepatic injury caused by agents such as galactosamine, or by partial hepatectomy coupled with the administration of a toxic chemical, oval cells proliferate and differentiate.3, 4 In patients with cirrhosis, hepatocyte replication in response to apoptosis is eventually followed by proliferation and differentiation of intrahepatic progenitor cells, similar to oval cells.5, 6 These and other conditions, both in experimental animals and humans, indicate that hepatocyte and oval cell replication in liver growth processes appear to be almost mutually exclusive events. Thus oval cells constitute a reserve or facultative cell compartment that is activated only when hepatocytes are not capable to rapidly respond to growth stimuli.1, 7, 8

The differential growth response of hepatocytes and oval cells is particularly puzzling, because both cell types can be stimulated by similar growth factors and cytokines.9, 10 For instance, lack of tumor necrosis factor (TNF) signaling through TNF receptor 1 inhibits both liver regeneration after partial hepatectomy and oval cell proliferation that occurs in mice fed a choline-deficient, ethionine-supplemented (CDE) diet.11, 12 Moreover, replication of hepatocytes and oval cells in vivo is associated with increases in hepatocyte growth factor and transforming growth factor α, and both cell types can be stimulated to replicate in culture using the same growth factors.1, 9, 10

The differential growth responses of hepatocytes and oval cells may involve several mechanisms:

  • 1hepatocytes and oval cells may respond to the same stimuli, but hepatocytes respond more rapidly than oval cells, imposing spatial constrains or causing the release of factors that prevent oval cell proliferation;
  • 2hepatocytes and oval cells respond to different triggering agents to enter the cell cycle, but subsequent steps leading to cell cycle progression and cell replication are similar between the two cell types; and
  • 3oval cell proliferation may be triggered by a combination of factors that both inhibit hepatocyte proliferation and actively stimulate oval cell replication.

We have tested the last hypothesis, that is, that oval cell proliferation involves stimuli that both stimulate their proliferation and inhibit hepatocyte replication. Several reports have shown that levels of interferon γ (IFN-γ) and the expression of IFN-γ target genes increase in situations in which oval cells proliferate, while they decrease or remain unchanged during liver regeneration after hepatectomy, in which hepatocytes, but not oval cells, replicate.7, 11, 13, 14 Moreover, in mice deficient in IFN-γ, the oval cell response is attenuated, while hepatocyte replication in the regenerating liver is enhanced.14, 15 Thus it is possible that IFN-γ, by itself or in combination with other agents such as lipopolysaccharide (LPS) and tumor necrosis factor (TNF), may regulate the nature of the cellular response to a growth stimulus by inhibiting hepatocyte replication and enhancing oval cell proliferation. We show that IFN-γ in combination with either LPS or TNF—agents that are present in liver growth processes—causes a reversible cell cycle arrest in cultured hepatocytes but stimulates DNA replication in oval cells. Hepatocyte cell cycle arrest induced by IFN-γ was caused, at least in part, by stimulation of inducible NO synthase (iNOS) and NO release.

Abbreviations

IFN-γ, interferon γ; TNF, tumor necrosis factor; LPS, lipopolysaccharide; CDE, choline-deficient, ethionine-supplemented; iNOS, inducible nitric oxide synthase; NMMA, N-monomethylarginine; SET, S-ethylisothiourea-Hbr; SNAP, S-nitroso-N-acetylpenicillamine; mRNA, messenger RNA.

Materials and Methods

Mice and Animal Procedures.

Eight- to ten-week-old male C57BL/6 mice (Jackson Laboratories, Bar Harbor, ME) were kept on a 12-hour light/dark cycle with free access to food and water. Two thirds partial hepatectomies were performed as previously described.16 Infusion of IFN-γ (3 μg/d, starting 3 days before the surgery and continued until the end of the experiment) was performed using micro-osmotic pumps (Alza Corporation, Palo Alto, CA) inserted subcutaneously. Controls received pump-delivered saline. All animal work was done in accordance with animal care policies at the University of Washington. Experiments with mice fed a 100% CDE diet have been previously described11 and were done in accordance with the National Health and Medical Research Council of Australia.

Chemicals and Reagents.

Sources for the antibodies and reagents were as follows: recombinant murine (and rat) IFN-γ and recombinant murine TNF, R&D Systems (Minneapolis, MN); LPS (Escherichia coli O111:B4) and mouse anti-mouse β-actin antibody, Sigma-Aldrich (St. Louis, MO); rabbit anti-mouse iNOS antibody, Chemicon (Temecula, CA); mouse anti-mouse p53 antibody, Calbiochem (La Jolla, CA); rabbit anti-mouse STAT-1 antibody, Cell Signaling (Beverly, MA); rabbit anti-mouse IFN-γ-Rα and IFN-γ-Rβ antibodies, Santa Cruz Biotechnology (Santa Cruz, CA); anti-rabbit and anti-mouse horseradish peroxidase–conjugated secondary antibodies and tritiated thymidine, Amersham Pharmacia Biotech (Piscataway, NJ); L-N-monomethylarginine (NMMA), D-NMMA, S-ethylisothiourea-Hbr (SET), and DEVD-7-amino-4-methylcoumarin substrate, Biomol (Plymouth Meeting, PA); S-nitroso-N-acetylpenicillamine (SNAP), Calbiochem; Greiss reagent kit, Molecular Probes (Eugene, OR); and Trizol reagent, Invitrogen (Carlsbad, CA).

Tissue Culture.

The LE2 and LE6 rat oval cell lines were cultured as previously described.17 AML-12 hepatocytes, a nontransformed, well-differentiated murine hepatocyte cell line18, 19 and TAMH murine hepatocytes were maintained as previously described.20 In all experiments, except where indicated, cells were plated at subconfluency and incubated for 16 hours in either serum-free medium (TAMH and AML-12) or 1% serum (LE6 and LE2). Unless otherwise specified, cells were pretreated with 2 ng/mL IFN-γ 2 hours before the addition of TNF or LPS and were then incubated for 24 hours.

Cell Proliferation Assay.

Cells were labeled with 1 μCi/mL tritiated thymidine for 3 hours as previously described.21 Cells were plated in triplicate in 24-well plates at 20,000 cells per well. The amount of radioactivity was determined using Ecolite (ICN, Aurora, OH). When NO inhibitors/donors were used, they were added 15 minutes before the addition of cytokines.

Cell Cycle Analysis.

AML-12 hepatocytes were plated at 400,000 cells per dish (60-mm plates) and maintained overnight in the presence of serum. Cells were then kept for 24 hours in serum-free medium before treatment with either 2 ng/mL IFN-γ, 20 ng/mL TNF, or both cytokines. After 24 hours of treatment, cells were trypsinized, resuspended in serum-free media, and stained with a solution containing 10 μg/mL DAPI and kept at 4°C until flow cytometric analysis could be performed. The data were processed using the Multi Plus software package (Phoenix Flow Systems, San Diego, CA).

Protein Lysate Preparation and Immunoblot Analysis.

Cells were harvested and lysed in 1% Triton X-100 lysis buffer and quantified via Bradford assay as previously described.19 Protein lysates were subjected to SDS-PAGE and transferred to polyvinylidene fluoride membranes (Millipore, Bedford, MA), blocked with Tris-buffered saline with 0.1% Tween-20 containing 5% milk at 4°C, and incubated with primary antibodies overnight. Antigen–antibody complexes were detected with anti-rabbit and anti-mouse horseradish peroxidase–conjugated secondary antibodies, and then exposed to ECL from Pierce Chemical Co. (Rockford, IL).

Caspase Activity.

Caspase-3 activity was measured as previously described19 using DEVD-7-amino-4-methylcoumarin as a substrate. Enzymatic assays and standard curves were generated in duplicate using a fluorescent plate reader (Packard Instruments, Meriden, CT).

Immunohistochemistry.

Mice were injected with bromodeoxyuridine (50 mg/kg) (Roche, Indianapolis, IN) 2 hours before killing. Livers were fixed in methacarn16 overnight at room temperature and then embedded in paraffin. Bromodeoxyuridine incorporation was measured as previously described.16 Muscle pyruvate kinase was measured using a goat anti–muscle pyruvate kinase antibody (Rockland, Gilbertsville, PA). The Elite Vectastain ABC kit (Vector, Burlingame, CA) was used as previously described.16

RNA Preparation and Reverse-Transcriptase Polymerase Chain Reaction Analysis.

Cells were rinsed in phosphate-buffered saline and lysed in Trizol reagent. The RNA was isolated according to the manufacturer's protocol (Invitrogen) and quantified by absorbance at 260 nm. SOCS-1 messenger RNA (mRNA) was determined via radioactive reverse-transcriptase polymerase chain reaction using β-actin competimers for normalization as described by the manufacturer (Ambion, Austin, TX). The linear range for the product of each gene and PCR primer pair were determined according to the manufacturer's protocol. Two hundred nanograms of RNA was amplified using 0.4 μmol/L of both SOCS-1 (forward: CTCGAGTAGGATGGTAGCACGCAA; reverse: CATCTTCACGCTGAGCGCGAAGAA) and β-actin (Ambion) reverse-transcriptase polymerase chain reaction primers, 0.25 U RedTaq polymerase (Sigma), and 32P-dCTP. The amplified radioactive product was electrophoresed in 6% TBE-Urea gel (BioRad, Hercules, CA) and analyzed with a Storm phosphorimager (Molecular Dynamics, Sunnyvale, CA).

NO Detection.

NO production was determined by measuring the amount of nitrite in cell supernatants using a Greiss reaction kit (Molecular Probes), following the manufacturer's protocol.

Statistical Analysis.

Data were analyzed with a GraphPad Prism (GraphPad Software for Science, San Diego, CA). Error bars shown indicate the standard error of the mean. Statistical analysis between any two groups of data was performed with a paired t test.

Results

Differential Effects of IFN-γ on Hepatocyte and Oval Cell Replication.

To study the effects of IFN-γ alone or in combination with other cytokines on hepatocyte and oval cell replication, we used well-characterized cell lines established in this laboratory. AML-12 is a nontransformed, proliferative, hepatocyte cell line that retains a differentiated phenotype.18, 19 LE-6 and LE-2 are oval cell lines capable of differentiating into hepatocytes.17 Some of the experiments performed with AML-12 hepatocytes were repeated using the hepatocyte cell line TAMH.20

We first examined the effects of IFN-γ in combination with either LPS or TNF in AML-12 hepatocytes (Fig. 1A-B). IFN-γ by itself at 2 ng/mL had variable but small inhibitory effects on DNA replication of these cells. However, LPS at 1.0 μg/mL (see Fig. 1A) and TNF at concentrations of 2 and 20 ng/mL enhanced DNA replication (see Fig. 1B). In particular, TNF increased replication by 50% to 150%, confirming previously reported data. In contrast, cells exposed to combinations of IFN-γ with either LPS or TNF showed a marked decrease in DNA replication, particularly at the higher TNF concentration, which decreased DNA replication well below the basal levels of nonstimulated cultures. To ascertain whether the IFN-γ/TNF or LPS inhibitory effect on DNA replication was restricted to AML-12 hepatocytes, we repeated the same experiments using the TAMH hepatocyte cell line (Fig. 1-D). An inhibitory effect similar to that observed in AML-12 cells also occurred in TAMH cells.

Figure 1.

IFN-γ in combination with either LPS or TNF inhibits DNA replication of two murine hepatocyte cell lines. (A,B) AML-12 and (C,D) TAMH cell cultures were treated with the indicated doses of (A,C) LPS or (B,D) TNF for 24 hours. Cells were labeled with tritiated thymidine and harvested as described in Materials and Methods. Each treatment was done in triplicate. The results are presented as amounts of tritiated thymidine incorporated per well and are representative of four independent experiments. Error bars represent the standard error of the mean. *P < .027. **P < .015. ***P < .0085 versus “untreated” values. IFN-γ, interferon γ; LPS, lipopolysaccharide; TNF, tumor necrosis factor.

To determine whether the combination of IFN-γ/TNF or LPS would be inhibitory to oval cell replication, we performed the experiments described in Fig. 1, with the LE-6 and LE-2 oval cell lines. In marked distinction from the effects on hepatocytes, no inhibitory effect of the combination of IFN-γ and TNF was observed in LE-6 oval cells (Fig. 2). On the contrary, IFN-γ had a small stimulatory effect on DNA replication, which was enhanced by TNF (Fig. 2A). In LE-2 cells, the combination of IFN-γ and TNF decreased the TNF stimulation, but the levels of replication were above those of nonstimulated cells or cells exposed to IFN-γ alone (Fig. 2B). The effects of LPS alone or in combination with IFN-γ in LE-6 and LE-2 cells were similar to those presented for TNF in Fig. 2, although LPS caused a smaller stimulation of replication than TNF (not shown).

Figure 2.

IFN-γ and TNF treatment enhances tritiated thymidine incorporation in oval cell lines. (A) LE-6 and (B) LE-2 cell lines were treated for 24 hours with the indicated doses of the cytokines. Cells were labeled and harvested as described in Materials and Methods. Each treatment was done in triplicate. The results shown are representative of four independent experiments (see Fig. 1). Error bars represent the standard error of the mean. *P = .04. **P = .011. ***P < .005 versus “untreated” values. IFN-γ, interferon γ; TNF, tumor necrosis factor.

In summary, as previously demonstrated, TNF induces the proliferation of both hepatocytes and oval cells.18, 22 However, IFN-γ abolished the TNF effect in hepatocytes, dropping the level of DNA replication below (>90%) that of nonstimulated cells, while the IFN-γ/TNF or IFN-γ/LPS combinations stimulated oval cell replication.

Hepatocytes and Oval Cells Contain IFN-γ Receptors and Can Activate IFN-γ Target Genes.

The lack of IFN-γ inhibition on oval cell replication could be due to the absence of IFN-γ receptors or defective stimulation of IFN-γ target genes. However, immunoblot analysis of AML-12 hepatocytes and LE-6 oval cells with antibodies to IFN-γ receptors α and β showed that both cell types contain these receptors and express key IFN-γ signaling molecules (Fig. 3A). In both cell types, IFN-γ induced STAT-1 phosphorylation and IP-10 mRNA expression (not shown). Furthermore, mRNA for SOCS-1, an important IFN-γ target gene that regulates cytokine signaling, increased after exposure to IFN-γ in both cell types, although the kinetics and the level of expression differ between AML-12 and LE-6 cells (Fig. 3B). These results indicate that both AML-12 and LE-6 cells contain IFN-γ receptors, and express a number of IFN-γ-inducible genes.

Figure 3.

IFN-γ receptors and target genes are expressed in both hepatocyte and oval cell lines. (A) Protein lysates were prepared from AML-12 and LE-6 cells in duplicate, without exposure to cytokines. Proteins were separated via SDS-PAGE and immunoblotted with antibodies to IFN-γ-Rα, IFN-γ-Rβ, total STAT-1, and β-actin (as a loading control). (B) AML-12 and LE-6 cells were treated with 2 ng/mL IFN-γ and harvested at the times indicated. RNA was isolated from the cells and analyzed via reverse-transcriptase polymerase chain reaction for SOCS-1 mRNA as described in Materials and Methods. Data are presented as fold induction relative to β-actin mRNA used as a loading control. Fold induction was normalized to control or untreated cells. The data are representative of at least two independent experiments. Error bars represent the standard error of the mean. IFN-γ, interferon γ; mRNA, messenger RNA.

Inhibition of the Hepatocyte Cell Cycle by Cytokine Combinations.

The decrease in DNA replication observed in hepatocytes treated with IFN-γ in combination with either TNF or LPS could be a consequence of cell cycle arrest or apoptosis. We examined the effects of the IFN-γ/TNF combination on the replication of AML-12 hepatocytes. Cells were maintained in serum-free medium for 24 hours to decrease replication to below 10% and were then treated for 24 hours with either 2 ng/mL IFN-γ or 20 ng/mL TNF or a combination of both. Cells were stained with DAPI as described in Materials and Methods and analyzed by flow cytometry (Table 1). IFN-γ had no apparent effect on the percentage of cells in the G1 or S phases of the cell cycle, while TNF treatment decreased the proportion of G1 cells by approximately 18% and more than doubled the percentage of cells in the S phase. However, the combination of IFN-γ and TNF completely reversed the TNF effects, significantly decreasing the proportion of cells in the S phase, compared with cells treated with either cytokine alone. The cell cycle arrest induced by IFN-γ/TNF was reversible (Fig. 4A). For these experiments, cells were treated for 48 hours with cytokines, or treated for 24 hours and then maintained for an additional 24 hours in medium without cytokines. TNF increased DNA replication by approximately 2.5-fold. The combination of TNF with IFN-γ blocked the TNF stimulatory effect and decreased the replication level well below that of nonstimulated cells (see Fig. 4A, gray bars). However, these effects were gradually reversed in cells exposed to cytokines for 24 hours (see Fig. 1) and then maintained for another day in cytokine-free medium (see Fig. 4A, hatched bars), demonstrating that the cell cycle arrest induced by IFN-γ/TNF in AML-12 hepatocytes is reversible.

Table 1. Delay of S Phase Entry in AML-12 Hepatocytes After Treatment With IFN-γ and TNF in Combination
TreatmentG1 Phase (%)S Phase (%)G2 Phase (%)
  • NOTE. Cells were treated as indicated for 24 hours, then stained with DAPI as described in Materials and Methods. Data are presented as the mean ± SEM of three samples.

  • *

    P = .003, † P < .0001 vs. TNF + IFN-γ values.

  • P = .0036, § P < .025 vs. untreated values (IFN-γ vs. untreated was not significant).

Untreated85.03 ± 0.6110.05 ± 0.654.91 ± 0.33
IFN-γ81.32 ± 0.3213.77 ± 0.40*4.91 ± 0.14
TNF69.74 ± 0.0922.03 ± 0.14†8.24 ± 0.22
TNF + IFN-γ90.49 ± 0.175.04 ± 0.19§4.47 ± 0.10
Figure 4.

Hepatocyte cell cycle arrest induced by IFN-γ/TNF is reversible, p53-independent, and not associated with apoptosis. (A) AML-12 cells were treated with the indicated cytokine doses for either 48 hours (gray bars), or treated for 24 hours, and then maintained in serum-free media without cytokines for an additional 24 hours (hatched bars). Cells were labeled with tritiated thymidine and harvested as described in Materials and Methods. Each treatment was done in triplicate. The error bars represent the standard error of the mean. Data are representative of two individual experiments. (B) Cells were treated with IFN-γ alone or IFN-γ (2 ng/mL) and TNF (20 ng/mL) for the indicated amount of time (h), separated by SDS-PAGE, and exposed to total p53 antibody. β-Actin was used as a loading control. (C) Caspase-3 activity was determined on protein lysates using DEVD-7-amino-4-methylcoumarin as a substrate. Cell extracts were prepared and protein concentrations were determined as described in Materials and Methods. As a positive control for apoptosis, cells were treated with 20 ng/mL TNF and 200 nmol/L Act D for 24 hours to induce caspase-3 activity.19 The data are representative of three individual experiments. IFN-γ, interferon γ; TNF, tumor necrosis factor; DEVD-AMC, DEVD-7-amino-4-methylcoumarin.

IFN-γ–induced cell cycle arrest has been associated with stimulation of p53.23, 24 However, p53 protein levels did not increase in cells exposed to either IFN-γ or IFN-γ/TNF (Fig. 4B). To determine whether the cell cycle arrest induced in AML-12 hepatocytes by IFN-γ/TNF could be associated with apoptosis, we measured caspase-3 activity in cells exposed to either IFN-γ or TNF alone, or to a combination of these cytokines (Fig. 4C). We did not detect caspase-3 activity in cells exposed to single cytokines. Caspase-3 activity was detectable in cells treated with the IFN-γ/TNF combination, but at minimal levels compared with the increase in caspase-3 activity detected in AML-12 hepatocytes treated with TNF and actinomycin D, as previously documented.19 Exposure of the cells to the combination of IFN-γ with 0.1 to 1 μg/mL of LPS produced a barely detectable level of caspase-3 activity (not shown). On the basis of these data and morphological analyses (not shown), we conclude that while TNF stimulates proliferation of AML-12 hepatocytes, the combination of IFN-γ and TNF causes a reversible cell cycle arrest in G1, which is p53-independent and is not associated with significant apoptosis.

Cytokine Combinations Lead to the Production of iNOS and NO in Hepatocytes but Not in Oval Cells.

Production of iNOS, which has multiple biological effects through the generation of NO, is greatly stimulated by cytokine combinations containing IFN-γ.25–27 We determined whether IFN-γ in combination with either LPS or TNF would differentially modulate iNOS and NO levels in hepatocytes and oval cells. Western blot analysis of protein extracts of AML-12 and LE-6 cells exposed to individual cytokines or the combination of IFN-γ with either LPS or TNF showed that iNOS is produced in AML-12 hepatocytes only by the combination of IFN-γ with LPS or TNF, and that IFN-γ/TNF (or LPS, not shown) fails to induce iNOS in LE-6 cells (Fig. 5A). Similar results were obtained with LE-2 oval cells (data not shown). We then measured the amounts of NO released in the medium of the same cultures (see Fig. 5A). In AML-12 cells, NO was produced in substantial amounts only in cultures exposed to IFN-γ/LPS and IFN-γ/TNF. In oval cells, NO was detectable in the LE-6 cell line at levels approximately 50-fold lower than those of AML-12 cells and was not present in LE-2 cells (Fig. 5B). We also determined the timing of iNOS expression and NO production in AML-12 cells exposed to individual cytokines or the IFN-γ/LPS combination. Production of NO and iNOS was detected only in cells treated with IFN-γ/LPS. Neither NO nor iNOS was detectable until 8 hours after exposure to IFN-γ/LPS, but their levels increased progressively at 12 and 24 hours (Fig. 5C). These levels were significantly lower at 48 hours (data not shown).

Figure 5.

IFN-γ with either TNF or LPS induces strong iNOS expression and the production of NO in hepatocytes but not in oval cells. AML-12, LE-6, and LE-2 cells were treated as indicated (2 ng/mL IFNγ, 20 ng/mL TNF, and 100 ng/mL LPS, respectively) for (A,B) 24 hours or (C) as otherwise indicated. (A) Protein lysates were prepared from cells as described in Materials and Methods. Samples were subjected to SDS-PAGE and immunoblot analysis with antibodies to iNOS (top panel), and β-actin (bottom panel). (B) Measurement of NO released into the media (same samples as those shown in panel A) was performed using the Greiss reagent, as described in Materials and Methods. Data are expressed in μmol/L concentrations of nitrite per dish. (C) Detection of iNOS protein and measurement of NO released into media in AML-12 cells treated with the indicated cytokines for 4 to 24 hours. The results are representative of three independent experiments. U, untreated; IFN, interferon γ; LPS, lipopolysaccharide; TNF, tumor necrosis factor; L/I, LPS + IFN-γ; T/I, TNF + IFN-γ; ns, not significant; iNOS, inducible nitric oxide synthase; I, IFN-γ alone; L, LPS alone.

Effects of NO on Hepatocyte Replication.

Because NO was produced in AML-12 hepatocytes but not in LE-6 or LE-2 oval cells exposed to IFN-γ combined with TNF or LPS (a treatment that causes an inhibition of hepatocyte replication as shown in Fig. 1), we investigated whether NO would interfere with DNA replication of AML-12 cells. For these experiments, we treated AML-12 cultures with either the NO donor SNAP or the NO inhibitors L-NMMA and SET.28 Cells were exposed to SNAP, which was added to the culture medium at concentrations of 50 to 500 μmol/L, before measuring NO production and DNA replication (Fig. 6). Untreated cells and cells exposed to IFN-γ alone did not produce NO, while exposure to IFN-γ/LPS generated NO (see Fig. 5B). Cells exposed to increasing amounts of SNAP in the culture medium produced increasing levels of NO (Fig. 6A). In these cells, there was a marked decrease in DNA replication at SNAP dosages of 200 and 500 μmol/L (Fig. 6B), an effect equivalent to or higher than the inhibitory effect of IFN-γ/LPS on AML-12 cell replication. To determine whether iNOS inhibitors would prevent the inhibition of DNA replication caused by IFN-γ/LPS, AML-12 cells were treated with L-NMMA (10 μmol/L to 1 mmol/L), SET (1 and 100 μmol/L), and the inactive molecule D-NMMA (1 mmol/L), which served as a control (Fig. 7). The two inhibitors used blocked NO production (Fig. 7A), while D-NMMA had no effect. Inhibition of NO production was also observed in cells treated with L-N-nitroarginine methyl ester, another NO inhibitor, but the effect was smaller than that obtained with the other inhibitors (not shown). Exposure to either L-NMMA or SET prevented the inhibition of DNA replication caused by IFN-γ/LPS (Fig. 7B) and led to a complete reversal of the cytokine inhibitory effect. The effectiveness of these iNOS inhibitors to reverse the blockage of proliferation caused by IFN-γ/LPS was inversely proportional to their capacity to decrease NO production in AML-12 cells (shown in Fig. 7A). The inactive molecule D-NMMA did not prevent the inhibition of DNA replication caused by IFN-γ/LPS. In summary, NO, produced by cells exposed to IFN-γ/LPS and in cells treated with a NO donor, blocks DNA replication in AML-12 hepatocytes. Inhibition of iNOS decreases NO production in these cells and reverses the blockage of DNA replication caused by exposure to IFN-γ/LPS.

Figure 6.

The NO donor SNAP inhibits DNA replication in AML-12 hepatocytes. Effects of SNAP on (A) NO production and (B) DNA replication are shown. Cells were untreated or treated with 2 ng/mL IFN-γ, 100 ng/mL LPS, with both cytokines in combination (L/I), or with increasing doses of SNAP (50, 200, and 500 μmol/L) for 24 hours. Cells were harvested and processed as described in Materials and Methods. Each treatment was done in triplicate. The data are representative of three independent experiments. Error bars represent the standard error of the mean. NT, not treated; IFN, interferon γ; LPS, lipopolysaccharide; L/I, LPS + IFN-γ; SNAP, S-nitroso-N-acetylpenicil lamine.

Figure 7.

iNOS inhibitors prevent the inhibitory effect of LPS/IFN-γ on DNA replication of AML-12 hepatocytes. The effects of iNOS inhibitors on (A) NO production and (B) DNA replication are shown. All inhibitors were added 15 minutes before IFN-γ treatment. The 24-hour treatments were performed as follows: increasing doses of L-NMMA (10 μmol/L, 100 μmol/L, and 1 mmol/L); 1 mmol/L of the inactive isomer D-NMMA; increasing doses of SET (1 μmol/L, 10 μmol/L, and 100 μmol/L); and 2 ng/mL of IFN-γ and 100 ng/mL of LPS. Cells were harvested and processed as described in Materials and Methods. Each treatment was done in triplicate. The data are representative of two individual experiments. Error bars represent the standard error of the mean. NT, not treated; L+I, LPS + IFN-γ; L-NMMA, L-N-monomethylarginine; D-NA, D-N-monomethylarginine; SET, S-ethylisothiourea-Hbr.

IFN-γ Inhibits Hepatocyte Replication After Partial Hepatectomy.

As a counterpart of studies done in culture, we asked whether IFN-γ would block hepatocyte replication during liver regeneration. In agreement with recently published data,15 we show that IFN-γ has a profound inhibitory effect on hepatocyte replication after partial hepatectomy (Fig. 8A). Moreover, regenerating livers of mice exposed to IFN-γ showed an increased number of cells containing muscle pyruvate kinase (Fig. 8B), an oval cell marker.11, 14 We also show that iNOS increases in the livers of mice fed a CDE diet (Fig. 8C), an experimental condition in which there is extensive oval cell proliferation, increased IFN-γ, and inhibition of hepatocyte replication.11, 14

Figure 8.

IFN-γ inhibits hepatocyte replication in the regenerating liver and iNOS mRNA increases in oval cell responses. (A,B) Mice received 3 μg/d of IFN-γ or saline (control group) using an osmotic pump. The infusion began 3 days before partial hepatectomy and was continued until the end of the experiment at 30 to 72 hours after the operation. (A) DNA replication in hepatocytes was determined by bromodeoxyuridine incorporation (3-hour labeling time) at different times after partial hepatectomy (n = 2-3 animals per group). (B) Muscle pyruvate kinase staining 72 hours after partial hepatectomy in both control (upper panel) and IFN-γ–treated (lower panel) mice (Original magnification 40×). (C) RNA was isolated from the livers of mice fed a CDE diet for 1 to 3 weeks and analyzed using reverse-transcriptase polymerase chain reaction for iNOS mRNA as described in Materials and Methods. The data are presented as fold induction over normal values, relative to β-actin mRNA used as a loading control. Error bars represent the standard error of the mean. BrdU, bromodeoxyuridine; PH, partial hepatectomy; IFN, interferon γ; mRNA, messenger RNA.

Discussion

Hepatocytes, which are metabolically active but mitotically quiescent, respond rapidly to stimuli such as partial hepatectomy and acute injury caused by chemicals.2, 9 In these situations, liver growth occurs by hepatocyte replication, with no obvious activation of a stem cell compartment. However, if hepatocytes are unable or slow to respond to a growth stimulus, activation of an intrahepatic compartment of progenitor cells, known as oval cells, occurs.1, 8 These cells function as an amplifying compartment and can differentiate into hepatocytes and cholangiocytes.29

Oval cells and hepatocytes have very different phenotypes, including their cell size and metabolic activities.30, 31 In addition, oval cells express markers present in biliary32 and hematopoietic cells,33 as well as other markers not detectable in hepatocytes.34 Nevertheless, cultured hepatocytes and oval cells have similar growth requirements, and there is considerable overlap between the response of these two cell types to growth factors and cytokines in vivo, although differences have also been noted.35 Moreover, growth factor infusion enhances the proliferation of hepatocytes in normal liver and of oval cells in rats treated with 2-acetylaminofluorene.36, 37 The general similarities between the growth requirements of hepatocytes and oval cells raises the question about the differential response of these cells to various growth stimuli and in particular about the mechanism through which one or the other cell type (but rarely both) responds to these stimuli. It has been demonstrated that levels of IFN-γ increase in experimental conditions in which oval cells proliferate, and that the oval cell response is diminished in IFN-γ knockout mice. In contrast, IFN-γ is not upregulated after partial hepatectomy, while liver regeneration is enhanced in IFN-γ knockout mice.7, 13, 14 Moreover, sets of genes related to IFN-γ are modulated during oval cell proliferation but not hepatocyte replication.13 We hypothesized that hepatocytes and oval cells differentially respond to the combination of IFN-γ with cytokines that are present or increase during hepatic growth processes. We show that IFN-γ inhibits hepatocyte replication in the regenerating liver, and that in combination with either LPS or TNF, it is highly inhibitory to hepatocytes but can stimulate oval cell DNA replication in cell cultures. These experiments were performed in AML-12 hepatocytes and LE-6 oval cells and reproduced in one additional cell line for each cell type. IFN-γ is also inhibitory to DNA replication in primary hepatocytes (data not shown).23, 24 Because of the low proliferative capacity of primary hepatocytes and the loss of some plasma membrane receptors that occur during hepatocyte isolation, we performed the work using well-characterized cell lines.

The inhibitory effect of IFN-γ in combination with either LPS or TNF on hepatocyte DNA replication involved cell cycle arrest at the G1 phase, which could be reversed by withdrawal of the cytokines from the culture medium. We identified NO as a main mediator of the inhibitory effect of the cytokine combination, and found that while iNOS and NO were produced by hepatocytes in response to IFN-γ with LPS or TNF, neither iNOS protein nor NO could be detected in oval cells at more than minimum levels. IFN-γ can produce NO in the liver in vivo, particularly in combination with other cytokines such as LPS and TNF,26, 38 and we show that iNOS levels increase in mice fed a CDE diet. Interleukin 1β can by itself induce the generation of NO; however, AML-12 and LE-6 cells exposed to interleukin 1β, LPS, or TNF alone failed to generate NO. NO can have protective, antiapoptotic39 or toxic effects on liver cells, depending on the context of its expression, which can be influenced by the metabolic state of the cell and the presence of stimuli for growth, survival, and apoptosis.26 In our experiments, NO blocked the hepatocyte cell cycle without causing apoptosis, an effect that may occur in vivo in inflammatory conditions associated with the release of multiple cytokines.26, 40 It has been demonstrated that NO blocks cytokine-mediated apoptosis in hepatocytes by preventing increases in caspase-3 and caspase-8.41, 42 NO production can induce p53 accumulation and downregulation of mdm2, but p53 levels were not increased in the NO-induced cell cycle arrest of AML-12 cells.43–45

The mechanisms through which IFN-γ in combination with LPS or TNF prevent NO formation in oval cells, whether transcriptional or posttranscriptional, remain to be determined. Both hepatocytes and oval cells contain IFN-γ receptors and can be induced to express IFN-γ target genes; however, we tested only a few of these genes, and even if there is overlap between genes induced by IFN-γ in hepatocytes and oval cells, the timing and intensity of the responses for individual genes may differ between the two cell types.

In conclusion, situations in which oval cells proliferate in vivo are associated with toxic and inflammatory reactions, in which IFN-γ and multiple cytokines (particularly TNF and lymphotoxin-beta) are produced.11, 14 The results of the present work and recent data from in vivo experiments suggest that under these conditions, there is both inhibition of hepatocyte replication and stimulation of oval cell proliferation.

Acknowledgements

The authors wish to thank Peter S. Rabinovitch and his laboratory staff for their help with the flow cytometry. We would like to thank Janina Tirnitz-Parka and Dr. George Yeoh's lab for providing tissue from the CDE-diet mice. We also wish to thank Alyssa Stephenson-Famy for her preliminary work on this project. A special thanks to all of the members of the Fausto lab for their help and critique on the work that is presented in this article.

Ancillary