Hepatitis C virus core protein stimulates hepatocyte growth: Correlation with upregulation of wnt-1 expression

Authors


  • Potential conflict of interest: Nothing to report.

Abstract

Hepatitis C virus (HCV) core protein has been implicated in the development of human hepatocellular carcinoma (HCC). Here we report that expression of HCV core protein by transient transfection increased cell proliferation, DNA synthesis, and cell cycle progression in Huh-7 cells, a human HCC-derived cell line. Culture supernatant from transfected cells also harbored a growth-promoting effect. Moreover, a full-length HCV replicon, but not a subgenomic replicon devoid of the core gene, significantly stimulated growth of transiently transfected Huh-7.5 cells. However, growth of the subgenomic replicon-containing Huh-7.5 cells could be stimulated by secondary transfection with core gene but not other structural genes present in the full-length replicon. Microarray analysis revealed threefold or more transcriptional changes in 372 of 12,500 known human genes in core protein expressing Huh-7 cells, with most genes involved in cell growth or oncogenic signaling, being upregulated rather than downregulated. Of particular interest is the marked upregulation of both wnt-1 and its downstream target gene WISP-2. Indeed, small interfering RNA against wnt-1 blunted growth stimulation by core gene, whereas transfection of Huh-7 cells with the wnt-1 gene sufficed to promote cell proliferation. Consistent with secretion of the wnt-1 protein, conditioned medium from wnt-1 transfected cells accelerated cell growth. In conclusion, HCV core protein induces Huh-7 cell proliferation whether alone or in the context of HCV replication, which is at least partly mediated by transcriptional upregulation of growth-related genes, in particular wnt-1. (HEPATOLOGY 2005;41:1096–1105.)

Hepatitis C virus (HCV) infects nearly 200 million people worldwide. Persistent HCV infection often leads to chronic hepatitis, liver steatosis, cirrhosis, and ultimately hepatocellular carcinoma (HCC).1, 2 The molecular events during HCV infection that lead to HCC development are poorly defined. In this regard, expression of core protein alone is sufficient to induce liver steatosis and HCC development in some cancer-prone mouse strains.3 As the major component of viral nucleocapsid, the core protein is a conserved basic protein possessing RNA binding activity.4, 5 It has been detected in various subcellular compartments including cytosol, lipid droplets, endoplasmic reticulum/Golgi apparatus, mitochondria, and nuclei. The broad intracellular distribution raises the possibility that core protein may modulate multiple cellular processes. Indeed, pull-down experiments and yeast two-hybrid screens revealed its physical interaction with a variety of cellular proteins of diverse physiological functions,4, 5 although the biological significance of these interactions has been difficult to ascertain.

Disruption of growth control is a crucial early event in tumor development. In this regard, the core protein can regulate intracellular signaling pathways associated with cell proliferation, differentiation, and apoptosis. It has been reported to immortalize primary human hepatocytes6 and to transform immortalized fibroblast cell lines either alone7 or together with the H-Ras oncoprotein.8 The core protein has also been found to stimulate growth of fibroblast cell lines,8–10 but not a human osteosarcoma cell line.11 There are conflicting reports as to whether the core protein stimulates the growth of human hepatoma cell lines.12, 13 In the present study, we observed enhanced growth of Huh-7 human hepatoma cells in the presence of HCV core protein or the full-length replicating viral genome. Microarray analysis revealed marked transcriptional upregulation of wnt-1, a known regulator of cell proliferation and oncogenic process. This finding prompted us to test its role as a mediator of cell proliferation via both depletion and overexpression.

Abbreviations

HCV, hepatitis C virus; HCC, hepatocellular carcinoma; cDNA, complementary DNA; PCR, polymerase chain reaction; GFP, green fluorescent protein; siRNA, small interfering RNA.

Materials and Methods

Plasmids.

HCV complementary DNA (cDNA) encoding the full-length core protein (amino acids 1-191 of 1b genotype, accession no. AY365213) was amplified via polymerase chain reaction (PCR) using primers listed in Table 1, and cloned into the BamHI-EcoRI sites of pcDNA3.1/Zeo(+) vector (Invitrogen, Carlsbad, CA). A null mutant was generated in parallel through a sense primer containing a TGA stop codon immediately downstream of the initiation codon (Table 1). The full-length (FL S2204I) and subgenomic (SG-5′HE S2204I) replicon constructs, as well as the full-length replicon with triple amino acid substitution in the active site of the polymerase that abolishes viral replication (pol), were provided by Dr. Charles Rice.14 Both subgenomic and full-length replicons contain an adaptive S2204I mutation in the NS5A region that enhances RNA replication. The HCV envelope genes E1, E2, p7, and E1-p7 were amplified from the full-length replicon cDNA via PCR using the primers listed in Table 1 and were inserted into pcDNA3.1/Zeo(+) vector. The plasmid encoding green fluorescent protein (GFP) was purchased from Clontech (Palo Alto, CA). The SV40 large T antigen construct was provided by Dr. James DeCaprio.15 The plasmid encoding HA-tagged wnt-1 under control of the cytomegalovirus promoter was purchased from Upstate Biotechnology (Lake Placid, NY).

Table 1. Primers Used for PCR Amplification and Protein Expression
GeneSenseAnti-sense
  1. NOTE. Italic represents irrelevant sequence and restriction sites (BamHI, EcoRI, or HindIII) for cloning.

CoregtggatccATGAGCACGAATCCTAAACCTCAAActgaattcTTAAGCGGAAGCTGGGATGGTCAA
Core null-mutanttcggatccATGTGAACGAATCCTAAACctgaattcTTAAGCGGAAGCTGGGATGGTCAA
E1taagcttaccATGGAAGTGCGCAACGTATCCGGAGTtgaattcTTACCCGTCAACGCCGGCAAAGAGT
E2tggatccaccATGGGAACCTATGTGACAGGGGGGAggaattcCTAGGCCTCAGCTTGAGCTATCAGCA
P7aggatccaccATGGCCCTAGAGAACCTGGTGGTCCcgaattcCTAGGCGTATGCTCGTGGTGGTAAC
E1-p7taagcttaccATGGAAGTGCGCAACGTATCCGGAGTcgaattcCTAGGCGTATGCTCGTGGTGGTAAC
18S RNAATCTTGGGAGCGGGCGGGCGGCGGTCCTATTCCATTATTCCTA
β-actinGGGACCTGACTGACTACCTCATCAGGAAGGAAGGCTGGAAGAGTG
GAPDHATCATCAGCAATGCCTCCTGCGCCATCACGCCACAGTTTCCCG
Rev-ErbAlphaTCCAGCAGAACATCCAGTACAAAGGGATATCACATCCTCCACTGT
Apolipoprotein C-IVAGAGGCCCAGGAAGGAACCCTGGCTGTCTTTGGATTCGAGGAACCA
wnt-1TCACAACAACGAGGCAGGCCGTTGTGCCCAGGCGTCCGCTGTA

Human Liver Cell Lines and Transfection.

Huh-7 and other human hepatoma cells (HepG2, Hep3B, and FOCUS) were fed with Dulbecco's Modified Eagle Medium supplemented with 10% fetal bovine serum. One day before transfection cells were seeded in 6-well plates at 3 × 105 cells per well or 96-well plates at 1 × 104 cells per well to achieve approximately 50% confluence around the time of transfecton. The DNA was incubated with polyamine (TransIT; Mirus, Madison, WI) at a ratio of 1 μg:3 μL and added to cells at 1.0 μg DNA per well of 6-well plates, or 0.065 μg per well of 96-well plates. For microarray analysis, cells grown in 10-cm dishes to approximately 50% confluence were transfected with 6 μg DNA and harvested 24 hours later. Huh-7.5 cells (≈6 × 106), which are highly permissive for HCV replication, were transfected with 1 μg of HCV replicon RNA via electroporation as previously described14 and seeded in 96- or 24-well plates. After an overnight incubation, cells were transfected with HCV core construct or E1, E2, p7, E1-p7 constructs with polyamine as described previously in this paragraph. To inhibit the expression of endogenous wnt-1, 1.8 μL of 10 μmol/L wnt-1 small interfering RNA (siRNA) (Santa Cruz Biotechnology, Santa Cruz, CA) was transfected to each well of 24-well plates cultured in 0.5 mL medium according to the manufacturer's protocol. After an overnight incubation, cells were transfected with core or core-null mutant construct (0.25 μg/well). To monitor the efficiency of the siRNA in wnt-1 gene silencing, Huh-7 cells in 6-well plates were transfected with 7.2 and 14.4 μL of 10 μmol/L wnt-1 siRNA, respectively, and harvested at day 2 postinfection for real-time PCR analysis. An irrelevant siRNA (14.4 μL of 10 μmol/L stock) targeting duck carboxypepdase D was transfected in parallel as a negative control.

Immunoblot Detection of HCV Core and wnt-1 Proteins.

Transfected cells from 6-well plates were lysed with a buffer (50 mmol/L HEPES [pH 7.5], 150 mmol/L NaCl [0.1% NP40]) supplemented with protease inhibitor cocktail (Sigma, St. Louis, MO). For detection of HCV core protein, a total of 20 μg proteins were separated in 0.1% SDS–12% PAGE and transferred to polyvinylidene fluoride membranes. The blots were blocked with 3% nonfat milk/3% bovine serum albumin in phosphate-buffered saline [0.05% Tween 20] and incubated at 4°C overnight with a 1:8,000 dilution of monoclonal antibody C750.16 After washing, the blots were incubated at room temperature for 1 hour with horseradish peroxidase–conjugated anti-mouse immunoglobulin (Amersham, Piscataway, NJ). The signals were revealed by enhanced chemiluminescence. For detection of epitope-tagged wnt-1 protein, one fiftieth of the cell lysate and 20 μL (one seventy-fifth) of culture supernatant were separated in 0.1% SDS-10% PAGE. After transfer, the blots were blocked with TBS containing 3% nonfat dry milk (TBS-MLK) for 60 minutes at room temperature, followed by overnight incubation at 4°C with 0.5 μg/mL of anti-HA Tag (Upstate Biotechnology) in TBS-MLK. After washing with water, the blots were incubated at room temperature for 1 hour with horseradish peroxidase–conjugated anti-rabbit immunoglobulin (1:5,000 dilution) (Upstate Biotechnology) in TBS-MLK. After final wash with water, signals were revealed using enhanced chemiluminescence.

Indirect Immunofluorescent Detection of Core Protein.

Two days after transfection, cells grown on glass cover slips were fixed with ethanol/acetic acid glacier (95:5) at −20°C. After washing, cells were incubated at 4°C for 1 hour each with 3% bovine serum albumin in phosphate-buffered saline, monoclonal antibody C750 in 3% bovine serum albumin in phosphate-buffered saline (1:1,000 dilution), and FITC-conjugated anti-mouse immunoglobulin in phosphate-buffered saline (1:1,000 dilution). Cells were examined under an ultraviolet light microscope.

Cell Proliferation Assays.

Three independent assays were used to monitor cell proliferation, all with cells seeded in 96-well plates. First, we used a cell counting assay (CCK-8 kit; Dojindo, Gaithersburg, MD) to quantify mitochondrial dehydrogenase activity. Culture medium was removed and cells were incubated at 37°C for 2 hours with 10 μL of tetrazolium salt diluted in 100 μL of complete medium. The absorbance at 450 nm was measured with a reference wavelength at 620 nm. Seconod, we used crystal violet staining to detect intact chromosome DNA. Transfected cells were incubated at room temperature with 100 μL/well of crystal violet solution (0.75% crystal violet, 50% ethanol, 0.25% NaCl, 1.75% formaldehyde) for 10 minutes, washed, and lysed with 1% SDS. Absorbance at a wavelength of 540 nm was measured. Finally, [3H]thymidine incorporation assay was used to measure DNA synthesis. Twenty-four hours after transfection, Cells were incubated at 37°C for 4 hours with 100 μq of [3H]thymidine per well. Cells were trypsinized and transferred to MultiScreen Harvest plates (Millipore, Bedford, MA). Cellular DNA was precipitated with 5% trichloroacetic acid and fixed with 95% ethanol. Incorporated [3H]thymidine was measured with a microplate scintillation counter (Packard, Meriden, CT).

Cell Cycle Analysis.

Nocodazole (60 ng/mL; Sigma) was added 24 hours posttransfection. Cells in triplicate were pulse-labeled with 10 μmol/L 5-bromo-2'-deoxyuridine (Sigma) for 30 minutes, combined, and fixed with cold 70% (v/v) ethanol at −20°C. The subsequent steps were performed according to a previous publication.17 After incubation with FITC-conjugated anti–5-bromo-2′-deoxyuridine (Roche Diagnostic, Indianapolis, IN) at 4°C for 45 minutes, samples were treated with RNase A and nuclei stained with propidium iodide (10 μg/mL) and analyzed via two-dimensional flow cytometry. Data were analyzed using ModFit software (Topsham, ME).

Microarray Analysis.

Twenty-four hours after transfection, cells grown in 10-cm dishes were lysed with TRIzol solution (GIBCO/BRL, Rockville, MD). Total cellular RNA was isolated and dissolved in 150 μL of diethyl pyrocarbonate–treated H2O containing 1 U/μL of RNasin. cDNA was synthesized from 5 μg of RNA and converted to complementary RNA with T7 RNA polymerase. Complementary RNA was hybridized with an Affymetrix human GeneChip (U95A; Santa Clara, CA) containing 12,626 probe sets (≈12,500 known genes) according to the manufacturer's protocol. The DNA arrays were scanned using an Affymetrix confocal scanner, and the data were analyzed with Microarray Suite version 4 software (Santa Clara, CA). Gene transcription was considered altered if a threefold or more difference was observed between vector- and core gene–transfected cells.

Reverse-Transcriptase PCR and Real-Time PCR.

Total cellular RNA purified with TRIzol reagent was digested with RQ1 RNase-free DNase (Promega, Madison, WI) (0.2 U/μg RNA) at 37°C for 10 to 30 minutes, followed by DNase inactivation. Reverse transcription was performed at 42°C for 1 hour using 250 ng of RNA template, 0.2 μg of oligo dT primer, or 1 μg of random primers and AMV reverse transcriptase (Invitrogen). A one-tenth aliquot of the cDNA was subjected to PCR amplification using gene-specific primers (Table 1) and the Expand High Fidelity PCR System (Roche Diagnostics). The PCR conditions were 95°C for 3 minutes followed by 40 cycles at 95°C for 30 seconds, 50°C–60°C for 30 seconds, and 72°C for 30 seconds. Quantitative real-time PCR was performed using 5 ng of cDNA and SYBR Green mixture (Applied Biosystems, Foster City, CA) in a total of 25 μL using iCycler Thermal Cycler (Bio-Rad, Hercules, CA) and programs described for reverse-transcriptase PCR.

Statistical Analysis.

Data are presented as the mean ± SD. Differences among the groups were examined via Mann-Whitney U test or Kruskal-Wallis test followed by Scheff's multiple comparison test.

Results

Efficient Transient Expression of HCV Core Protein in Huh-7 Cells.

We decided to use transient transfection to test the growth effect of the HCV core gene, because stable transfection may suffer from clonal differences caused by different integration sites or the amplification of fast-growing clones with secondary genetic alterations. However, the growth-promoting effect of the core protein may be underestimated if only a small fraction of the cell population is transfected. Thus, various liver-derived cells (human hepatoma cell lines HepG2, Huh-7, Hep3B, FOCUS, and primary rat and mouse hepatocytes) were screened for gene transfection efficiency using currently available chemical reagents. With a GFP reporter construct, the highest transfection efficiency was found in Huh-7 cells using polyamine (Mirus) as a carrier (Fig. 1A). Under optimal conditions (i.e., 1 μg DNA/2-3 μL polyamine for each well of 6-well plates), 40%–50% of Huh-7 cells were transfected as revealed by fluorescent microscopy. Similarly, the highest level of core protein expression was also achieved in Huh-7 cells as suggested by Western blot analysis, which revealed an apparent molecular size of 19 kd indicative of the truncated form (Fig. 1C). The core protein stained cytoplasmic and perinuclear cells (Fig. 1B). Core protein expression peaked at 36–72 hours after transfection and persisted for at least a week (Fig. 1D, upper & middle panels). The protein expression level could be modulated by decreasing the amount of HCV plasmid from 1 μg to 0.2 μg per well of the 6-well plates while keeping the total amount of DNA at 1 μg using an empty vector (Fig. 1D, lower panel).

Figure 1.

Efficient expression of HCV core protein in Huh-7 cells. (A) Transfection efficiency in various liver-derived cell lines using a GFP reporter plasmid. Cells were transfected with DNA encoding GFP as indicated using polyamine as a carrier. Two days later, GFP expression was revealed via UV light microscopy. (B) Subcellular localization of core protein in Huh-7 cells as revealed by indirect immunofluorescent staining. (C) Western blot analysis of core protein expression among different cell lines. The molecular size markers in kd and the size of the HCV core protein (p19) are indicated. (D) Upper and middle panels: Western blot analysis of the kinetics of core protein expression at various times after transfection. Lower panel: Dose-dependent expression of core protein. Cells were transfected with various amounts of HCV core gene as indicated, and the protein expression was detected using Western blot analysis. GFP, green fluorescent protein; w/o: nontransfected cells; cDNA, complementary DNA.

Dose-Dependent Stimulation of Cell Growth by HCV Core Protein.

A commercial cell counting assay based on mitochondrial dehydrogenase activity (CCK-8 kit) revealed increased number of core gene–transfected Huh-7 cells than vector-transfectred cells (Fig. 2A), although the increase was modest compared with cells expressing SV40 large T antigen, a potent oncoprotein that promotes cell proliferation and transformation.18 The growth advantage was evident at 8, 16, and 24 hours after transfection (P < .0001) (Fig. 2B) and was confirmed by two independent assays: crystal violet staining and [3H]thymidine incorporation (Fig. 2D). Furthermore, by seeding different numbers of Huh-7 cells to the plates followed by the colorimetric dehydrogenase assay of the CCK-8 kit, a linear curve was obtained (Fig. 2F). Introduction of a TAG nonsense mutation immediately behind the initiation codon of core gene abolished its ability to stimulate cell growth (the null mutant; Fig. 2C), suggesting that core gene translation is required to promote cell growth. The difference in cell number between core-expressing and vector-transfected cells was no longer evident at 48 hours after transfection, when the cells have reached confluence. However, reseeding cells at day 3 after transfection to lower density reproduced growth difference 24 and 48 hours later (data not shown). Within this time frame (less than a week after transfection), the core protein level remained high (Fig. 1D, middle panel).

Figure 2.

HCV core protein induces cell proliferation. Huh-7 cells were transfected in quadruplicate in 96-well plates with pcDNA3.1/Zeo(+) (vector), the core gene or its null mutant (with a nonsense mutation at codon 2), or a plasmid encoding SV40 large T antigen. For panels A-C, E, and F, cell proliferation was measured using a CCK-8 kit. (A) Comparison of different constructs at 24 hours after transfection. (B) Comparison of different time points after transfection with core gene or empty vector. (C) Effect of the null mutation in the core gene on cell proliferation at 24 hours after transfection. (D) Comparison of three different assays for the measurement of cell proliferation at 24 hours after transfection. (E) Dose-dependent effect of the core gene on cell proliferation. The data in panels A-D are presented as the mean ± SD (n = 4). *P < .05. **P < .001. ***P < .0001. (F) Calibration curve to determine number of viable cells using the absorbance value from the CCK-8 kit. The indicated numbers of Huh-7 cells were seeded in 96-well plates for assay with the CCK-8 kit. LT Ag, large T antigen.

To investigate whether a lower level of core protein expression can stimulate cell proliferation, we reduced the amount of the core gene construct from 0.06 to 0.03 μg/well (the total DNA amount was maintained by vector DNA). As a result, the growth advantage did not become statistically significant until 16 hours posttransfection (Fig. 2E).

Full-length But Not Subgenomic HCV Replicon Also Stimulates Cell Growth: Possible Role of the Core Gene.

Core protein is not expressed alone during natural HCV infection. To determine whether core protein can exert its growth-promoting effect in the context of the viral genome and other viral proteins, we electroporated full-length and subgenomic HCV replicons into Huh-7.5 cells, a subclone of Huh-7 cells highly permissive for HCV replication.14 Both replicons contain an adaptive S2204I mutation in the NS5A region that enhances replication. A full-length replicon construct with a defective polymerase gene due to a triple amino acid substitution in the active site of the polymerase (pol) served as a negative control. Under the experimental conditions described in Materials and Methods, we observed faster growth of Huh-7.5 cells transfected with a full-length replicon than with the subgenomic replicon, which does not contain the structural genes including core and envelope (Fig. 3A). This growth acceleration requires HCV replication and gene expression, because cells transfected with replication-defective pol mutant did not grow faster. HCV replication was confirmed by Northern hybridization, which peaked at 2 to 3 days after electroporation (data not shown). Secondary transfection with the core gene augmented the growth of cells harboring a full-length replicon, although the difference did not reach statistical significance. Interestingly, transfection with the core gene significantly accelerated the growth of cells harboring a subgenomic replicon (P < .05) (Fig. 3B). To examine whether the growth advantage of the full-length replicon is attributable to core or other structural proteins, we transfected Huh-7.5 cells harboring a subgenoimic replicon with the expression constructs for core, E1, E2, p7, and E1-p7, respectively. Only the core gene significantly increased cell proliferation (Fig. 3C). Taken together, these results suggest that the core protein is probably the only component of HCV structural proteins that stimulates cell growth, which is not suppressed in the context of genome replication and expression of other viral proteins.

Figure 3.

Cell growth is stimulated by full-length HCV replicon and by subgenomic replicon supplemented with core gene. (A) Comparison of full-length, subgenomic, and replication-defective (Pol) full-length replicons. Huh-7.5 cells were transfected via electroporation with the indicated constructs, and cell proliferation was measured with a CCK-8 kit 2 and 3 days after transfection. The data are presented as the mean ± SD (n = 4). *P < .05. **P < .001. ***P < .0001. (B) Effect of secondary transfection with core gene or its null mutant 24 hours after electroporation with FL or SG replicons. Twenty-four hours after electroporation with the full-length or subgenomic replicon, cells were transfected with the core gene or its null mutant. Cell proliferation was measured at day 2 after secondary transfection. (C) Effect of secondary transfection with cDNA encoding different HCV structural proteins. Huh-7.5 cells were electroporated with subgenomic replicon RNA and transfected with expression vector of core, E1, E2, p7, or E1-p7 1 day later. Cell proliferation was measured at day 1 following secondary transfection. Similar results were observed at day 2. (D) Calibration curve showing relative number of Huh-7.5 cells from absorbance. FL, full-length; SG, subgenomic; Pol−, replication-defective; p.t., posttransfection.

HCV Core Protein Accelerates Cell Cycle Progression.

Increased cell proliferation upon core protein expression may be mediated by altered cell cycle progression. We employed nocodazole, an inhibitor of microtubule formation to synchronize cells at M phase, thus permitting the measurement of the percentage of cells passing from G0/G1 phase through S phase into the M phase. Although no difference in the cell cycle distribution was observed between vector and core gene–transfected cells 24 hours after transfection, significant differences appeared 15 hours following nocodazole treatment (Fig. 4). Expression of the core protein caused a modest but significant increase in the percentage of cells at the S and G2/M phases (P < .05) and a concomitant decrease in G0/G1 population (P < .05), indicating that HCV core protein accelerates cell cycle progression. On the other hand, no significant difference in the rate of apoptosis was observed between core-expressing and vector-transfected cells as suggested by percentage of sub-G1 population (data not shown).

Figure 4.

Core protein accelerates cell cycle progression in Huh-7 cells. Cells were harvested at different time points following nocodazole treatment as indicated, and cell cycle was analyzed via FACS scan. The percentage of cells at the G0/G1, S, and G2/M phases are shown. The data are presented as the mean value from three independent experiments. A statistically significant difference was observed 15 hours after nocodazole treatment (P < .05).

Transcriptional Changes in Core-Expressing Cells.

A cDNA microarray Chip consisting of 12,500 defined human genes was used to screen for cellular transcriptional changes 24 hours following core protein expression. No major difference was found in the transcription of housekeeping genes. A total of 372 genes were differentially expressed in core gene–transfected Huh-7 cells versus vector-transfected cells, with 182 being upregulated and 190 downregulated (Table 2). Many differentially expressed genes perform important biological functions, including oncogenesis (14 genes), growth signaling/cell cycle regulation (9 genes), negative control of cell growth (8 genes), fat/lipid metabolism (11 genes), and cellular defense, immunity, and inflammation (21 genes) (Tables 2, 3). The global transcriptional changes were quite informative. In keeping with the enhanced growth of core gene–expressing cells, 12 of the 14 differentially expressed genes of oncogenesis were upregulated rather than downregulated, as were all the 9 genes related to cell growth signaling or cell cycle progression. In contrast, 7 of the 8 genes involved in apoptosis or negative control of cell growth were downregulated. Interestingly, both wnt-1 and its downstream target WISP-2 genes were upregulated, suggesting activation of the wnt-1 signaling pathway. Also of interest was the upregulation of 8 out of 11 differentially expressed genes of fat/lipid metabolism (up to 20.2-fold). Sixteen out of 21 differentially expressed genes associated with immunity, defense, or inflammatory responses were downregulated.

Table 2. Upregulated or Downregulated Genes in HCV Core-Expressing Huh-7 Cells
CategoryTotal Number of GenesUpregulatedDownregulated
Oncogenesis14122
Growth factor550
Cell cycle440
Apoptosis and negative control of cell growth817
Fat/lipid metabolism1183
Immunity/defense/inflammatory response21516
Signal transduction552332
Transcription factor19811
Kinase/phosphotase1248
NO synthase413
Matrix/cell adhesion1376
Ion channel1275
Miscellaneous and unknown1949797
Total number of differentially expressed genes372182190
Table 3. List of Differentially Expressed Genes Potentially Associated With Pathogenesis of HCV Core Protein
ClassificationName of GeneAccession No.Fold Change
  1. NOTE. Information on other genes is available upon request.

  2. Abbreviation: ATP, adenosine triphosphate.

OncogenesisSmoothened homologU84401∼13.6
 NuMA protein (nuclear mitotic apparatus protein 1)Z11584∼10.3
 Human int-1 (wnt-1) mammary oncogeneX03072∼8.4
 Promyelocytic leukemiaX63131∼5.9
 Tumor necrosis factor receptor superfamily, member 6b, decoyAL080127∼5.5
 Jun-BM29039∼5.2
 Oncogene Ret/Ptc2 ∼4.7
 Growth factor receptor-bound protein 7D43772∼4.6
 Fibroblast growth factor 4 (Kaposi sarcoma oncogene)M17446∼4.2
 Connective tissue growth factor–related protein WISP-2AF100780∼3.2
 Breast cancer-specific protein 1AF044311∼3.1
 Breakpoint cluster region (GTPase activator)X025963.3
 T-cell leukemia, homeobox 1S38742∼ −4.9
 Human fos proto-oncogene (c-fos)K00650∼ −3.6
Growth factor and anti-apoptosisGastrin-releasing peptide/growth factorK020545.3
 Endothelial cell growth factor 1 ∼4.2
 Nerve growth factor, beta polypeptideX52599∼4.1
 VGF nerve growth factor inducibleY12661∼3.1
 MyeloperoxidaseM19507∼3.1
Cell cycleCyclin-dependent kinase inhibitor 1AU03106∼5.8
 PCTAIRE protein kinase 3AA535884∼3.6
 Checkpoint suppressor 1U68723∼3.5
 Membrane associated tyrosine and threonine-specific cdc2 inhibitory kinaseAF014118∼3.1
Apoptosis and negative control of cell growthTumor necrosis factor (ligand) superfamily, member 12AF055872∼ −5.0
 Chorionic gonadotropin, beta polypeptideJ00117∼ −4.8
 Adenosine A2a receptorX68486∼ −4.7
 Caspase 9, apoptosis-related cycteine proteaseU60521∼3.0
 Human death domain receptor 3U83600∼ −3.0
 BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)AF045581∼ −4.1
 Nuclear proteinU57099∼ −3.3
 Transforming growth growth factor beta 1–induced transcript 1AB007836∼ −3.1
Fat/lipid metabolismRev-ErbAlphaX72631∼20.2
 Apolipoprotein C-IVU32576∼10.7
 Hormone-sensitive lipaseL11706∼5.9
 Apoliprotein-related gene CU19517∼5.2
 Apoliprotein-EAI358867∼4.4
 Synuclein beta (phospholipase inhibitor)AF053136∼3.4
 Phospholipase C, delta 1U09117∼3.3
 Low-density lipoprotein receptor–related protein 3AB0094623.0
 Arachidonate 15-lipoxygenase, second typeU78294∼ −3.0
 Apolipoprotein B messenger RNA editing enzymeAL022318∼ −3.0
 Cytochrome p450 subfamily IVA, polypeptide 11D13705−4.5
Immunity, defense, and inflammatory responseImmunoglobin light chainD87012∼ −11.0
 Polymorphic epithelial mucin core protein (inflammatory response pathway)M21868∼ −9.6
 Corticotropin-releasing hormone receptor 1 (immune response, predicted)X72304∼ −8.9
 CD2 antigen-binding protein 2 (antimicrobial humoral response)AF104222∼ −7.7
 Interleukin 17 receptorU58917∼ −5.8
 Lectin, galactoside-binding protein (cellular defense response)L13210∼ −5.7
 Calcium binding atopy-related autoantigen 1 (defense response)Y17711∼5.3
 Transforming growth factor beta receptor–associated protein-1AF022795∼ −5.0
 Tumor necrosis factor receptor superfamily member 14 (herpesvirus entry mediator) (immune response)U70321∼ −4.3
 Human flt3 ligand (positive control of dendritic cell proliferation)U03858∼ −4.2
 Immunoglobulin lamda geneD87002∼3.8
 Interferon-inducible guanylate-binding protein 2 (immune response)M55543∼ −3.6
 Nutrophil cytosolic factor 1 (defense response)M55067∼3.5
 Azurocidin 1 (cationic antimicrobial protein 37) (antibacterial response protein)M96326∼3.3
 Transporter 2, ATP-binding cassette subfamily B (defense response)M74447∼ −3.3
 CD79B antigen (immunoglobulin-associated beta) (immune response)M89957∼ −3.3
 Interleukin-8 receptor type AU11870∼ −3.3
 Interleukin 10 receptor alphaU00672∼ −3.2
 Granlysin (cellular defense response)M85276∼ −3.1
 Leukocyte-specific transcript 1 (cellular defense response/immunity)AF000424∼ −3.1
 Cytokine receptor-like factor 1 (antimicrobial humoral response)AI819249∼3.0

Results obtained via microarray analysis were validated via reverse-transcriptase PCR using RNA samples derived from independent experiments. Three genes with marked upregulation were selected for validation: Rev-ErbAlpha (≈20.2-fold), Apolipoprotein C-IV (≈10.7-fold), and wnt-1 (≈8.4-fold). Three housekeeping genes served as internal controls: β-actin, GAPDH, and 18S ribosomal RNA. The results of 40 cycles of PCR confirmed higher messenger RNA levels of Rev-ErbAlpha, apolipoprotein C-IV, and wnt-1 in core-expressing cells than in empty vector-transfected cells or in cells transfected with the core gene null mutant (Fig. 5A; data not shown). Using real-time PCR, the transcriptional upregulation of Rev-ErbAlpha, apolipoprotein C-IV, and wnt-1 was confirmed by reduced Ct values, the cycle at which exponential signal amplification occurred (Fig. 5B).

Figure 5.

Validation of transcriptional changes by reverse-transcriptase PCR and real-time PCR. Huh-7 cells transfected with empty vector (V) or core gene (C) were harvested 24 hours later. Total cellular RNA was reverse-transcribed into cDNA followed by PCR or real-time PCR. (A) Reverse-transcriptase PCR products analyzed on 2% agarose gels. (B) Real-time PCR results represented as Ct (threshold) values (log2). The fold change represents the approximate fold increase in core- versus vector-transfected cells at the cycle of Ct. V, vector; C, core gene; Rev-Erb, Rev-ErbAlpha; ApoC-IV, apolipoprotein C-IV; wnt-1, human int-1 mammary oncogene; Ct, threshold.

Growth Stimulation by Core Protein Is Partly Mediated by wnt-1.

The transcriptional upregulation of both wnt-1 and its downstream target WISP-2 suggested possible activation of the wnt-1 signaling pathway, which is implicated in the promotion of cell growth.19 Because wnt-1 is a secreted protein, we initially tested the effect of conditioned culture medium from core-expressing cells on cell proliferation. Indeed, such medium-promoted cell growth better than medium collected from cells transfected with the core null mutant (Fig. 6A). To evaluate wnt-1 as the growth mediator, we pretreated Huh-7 cells with wnt-1 siRNA before secondary transfection with core gene or its null mutant. Cell proliferation as induced by core gene was abolished by pretreatment with wnt-1 siRNA, which reduced wnt-1 messenger RNA production in a dose-dependent manner (Fig. 6B). Furthermore, the corresponding culture medium lost advantage in growth stimulation (Fig. 6C). In the reverse experiment, Huh-7 cells were transiently transfected with wnt-1 cDNA, which significantly accelerated cell proliferation (Fig. 6D). Moreover, the medium collected from wnt-1 transfected cells harbored a cell growth-promoting effect as well (Fig. 6E). Western blot analysis confirmed the expression and secretion of epitope-tagged wnt-1 (Fig. 6F). Taken together, these findings implicate wnt-1 as a major mediator of cell proliferation induced by HCV core protein.

Figure 6.

Wnt-1 is a major mediator of core protein–induced cell proliferation. The cell proliferation assay presented below was performed using a CCK-8 kit; the data are presented as the mean ± SD (n = 4). *P < .05. **P < .005. ***P < .0005. (A) Growth-promoting effect of medium derived from core-expressing cells. Day 2 culture supernatant from core gene or its null mutant transfected cells was added to a fresh batch of Huh-7 cells, and cell number was determined 24 hours later. A similar difference was observed 48 hours later. (B) Pretreatment with wnt-1 siRNA blunted cell proliferation induced by core gene. Huh-7 cells were transfected with wnt-1 siRNA overnight, followed by secondary transfection with core gene or its null mutant. Cell proliferation was measured 24 hours later. Silencing of the wnt-1 gene was examined using real-time PCR, and the results are represented as Ct (threshold) values (log2). (C) Pretreatment with wnt-1 siRNA also abolished growth-stimulating effect of the culture supernatant. Medium collected from core-expressing cells with or without wnt-1 siRNA transfection was added to a fresh batch of Huh-7 cells, and cell proliferation was measured 24 hours later. (D) Induction of cell growth by wnt-1 cDNA transfection. Huh-7 cells were transfected with wnt-1 cDNA, and cell proliferation was measured at days 1 and 2 after transfection. (E) Culture medium from wnt-1 cDNA–transfected cells harbored growth-promoting effect. The culture medium was collected at day 2 after transfection and added to a fresh batch of Huh-7 cells. Cell number was determined 24 hours later. (F) Expression of wnt-1 in transfected Huh-7 cells and its secretion to culture supernatant, as revealed by antibody against the HA tag. Huh-7 cells grown in 6-well plates were transfected with 1 μg of empty vector or the vector encoding wnt-1 cDNA using polyamine. Forty-eight hours after transfection, cells and medium were harvested and subjected to Western blot analysis. PCR, polymerase chain reaction; siRNA, small interfering RNA; Ct, threshold; p.t., posttransfection.

Discussion

The present study strongly suggests that the HCV core gene product promotes proliferation of Huh-7 cells either alone or in the context of HCV replication. The increased cell proliferation was dose dependent and was detectable via three independent assays that measure cell number, viability, and DNA synthesis, respectively (Figs. 2, 3). The increase in cell proliferation appears to be primarily driven by accelerated cell cycle progression (Fig. 4) and mediated via secreted proteins (Fig. 6). Consequently, many genes involved in cell growth were upregulated, in particular wnt-1 and its target WISP-2.

Thus far, the growth-promoting activity of HCV core protein has been observed in stably transfected rat embryonic fibroblast cells,9 3T3 mouse fibroblast cells,8, 10 and more recently in human liver-derived HepG2 cells.13 In addition, transgenic mice expressing HCV core protein displayed slightly elevated hepatocyte proliferation rate in comparison with nontransgenic littermates, although the difference did not reach statistical significance.20 Thus, our findings are consistent with most studies suggesting a stimulatory effect of core protein on cell proliferation. However, the mechanisms proposed are diverse, ranging from cyclin E upregulation9 and STAT3 phosphorylation10 to activation of the mitogen-activated protein kinase pathway.13

Using microarray analysis, we found differential transcription of genes associated with oncogenesis (14 genes), cell growth signaling or cell cycle regulation (9 genes), and apoptosis and negative control of cell growth (8 genes) (Tables 2, 3). In particular, upregulation of both wnt-1 and its downstream target WISP-2 suggests activation of the wnt-1 signaling pathway. Consistent with the secreted nature of wnt-1 (Fig. 6F), conditioned medium derived from core-expressing cells stimulated cell growth. Furthermore, transfection of wnt-1 cDNA into Huh-7 cells stimulated cell growth to a similar extent as core gene transfection, and conditioned medium from wnt-1–transfected cells also promoted cell growth (Fig. 6D–E). Thus, wnt-1 alone is sufficient to initiate a signaling pathway that leads to increased cell proliferation. On the other hand, specific inhibition of endogenous wnt-1 by siRNA prior to core gene transfection blunted growth stimulation and abolished growth-promoting effect of the conditioned medium, suggesting that upregulation of wnt-1 as found in core gene–transfected cells is indispensable to the tramsmission of the growth signal. Thus, wnt-1, a known regulator of cell proliferation and oncogenic process, may constitute a major mediator of Huh-7 cell proliferation by HCV core protein. In fact, inappropriate activation of the wnt signal transduction pathway has been observed in a variety of human cancers,21 including HCC.22–24 Moreover, overexpression of WISP family protein has been linked to tumor formation in nude mice25 as well as gastrointestinal carcinoma and cholangiocarcinoma in humans.26, 27 We have recently cloned WISP-2 promoter sequence and found upregulation of the promoter activity in core-expressing cells.28 Sequencing analysis revealed a TCF-1 binding motif AACAAAG (A. von dem Bussche et al., unpublished, January 2005), thus reinforcing the role of WISP-2 as a downstream target of wnt-1. Further experiments will determine whether wnt-1 stimulated cell proliferation in Huh-7 cells signals through the WISP-2 target or other targets. Currently, the physiological function of WISP-2 in the liver remains to be established, and HCV core-expressing Huh-7 cells may provide a platform for future studies.

Microarray analysis also identified transcriptional alteration of genes involved in other physiological functions. Core gene transgenic mice and some HCV-infected human livers suffer from steatosis.20, 29 In this regard, microarray analysis revealed transcriptional upregulation of a significant number of genes responsible for fat/lipid metabolism (Tables 2, 3). Another conspicuous finding is the downregulation of a significant number of genes associated with immunity/defense/inflammatory response (Table 3), which is frequently observed in HCC samples.30 Although microarray data are difficult to compare because of the use of different Gene Chips, four other genes that were upregulated in this study were also upregulated in HCC tissues: apolipoprotein C-IV (10.7-fold, accession no. U32576), cytochrome p450 superfamily IIA (threefold, accession no. M33318), and NO synthase (threefold, accession no. D29675) were upregulated in 31 HCC samples,31 while PCTAIR protein kinase gene (3.6-fold, accession no. AA535884) was upregulated in 20 hepatitis B virus– or HCV-associated HCC samples.30

In summary, our findings support the concept that HCV core protein plays a crucial role in modulating cell growth, lipid metabolism, and cellular defense system(s), and provide provocative information for future investigations aimed at understanding viral-cellular interactions that lead to the development of HCC. Such studies may also identify novel targets for therapy of HCV-related HCC as well.

Acknowledgements

We are grateful to Dr. Charles Rice, Rockefeller University, New York, for providing replicon constructs and Huh-7.5 cells, and to Dr. DeCarprio from the Dana-Farber Cancer Institute, Boston, for the SV40 large T antigen construct.

Ancillary