OSTα-OSTβ: A major basolateral bile acid and steroid transporter in human intestinal, renal, and biliary epithelia

Authors


  • Potential conflict of interest: Nothing to report.

Abstract

The cellular and subcellular localization and mechanism of transport of the heteromeric organic solute transporter (OST) OSTα-OSTβ was examined in human and rodent epithelia. The two subunits of the transporter were expressed together in human small intestine, kidney, and liver, tissues that also express the apical sodium-dependent bile acid uptake transporter ASBT (SLC10A2). Indirect immunofluorescence microscopy localized OSTα and OSTβ to the basolateral membrane of mouse, rat, and human ileal enterocytes, renal proximal tubular cells, and cholangiocytes. Transport in OSTα-OSTβ–expressing Xenopus laevis oocytes was unaffected by depletion of intracellular adenosine triphosphate, or by changes in transmembrane Na+, K+, H+, or Cl concentration gradients. However, the oocytes demonstrated robust substrate efflux and trans-stimulation, indicating that transport occurs by facilitated diffusion. Madin Darby canine kidney cells coexpressing mouse Ostα and Ostβ exhibited enhanced apical to basolateral transport of the major glycine and taurine conjugated bile acid species. In conclusion, the selective localization of OSTα and OSTβ to the basolateral plasma membrane of epithelial cells responsible for bile acid and sterol reabsorption, the substrate selectivity of the transporter, and the facilitated diffusion transport mode collectively indicate that OSTα-OSTβ is a key basolateral transporter for the reabsorption of these important steroid-derived molecules.(HEPATOLOGY 2005;42:1270–1279.)

Bile acid and sterol reabsorption by ileal enterocytes, renal proximal tubular cells, and biliary epithelial cells is essential for cholesterol homeostasis, the absorption of dietary fats and vitamins, and proper regulation of bile flow and biliary lipid secretion.1–4 The initial step in bile acid reabsorption by these epithelial cells—namely, uptake across the apical membrane—is mediated in large part by the apical sodium bile acid transporter (ASBT; gene name SLC10A2). ASBT is most abundant on the apical (luminal) surface of ileal enterocytes, renal proximal tubular cells, and hepatic cholangiocytes.4 Loss-of-function mutations in the human ASBT gene are associated with bile acid malabsorption,5 and targeted deletion of the ASBT gene eliminates enterohepatic cycling of bile acids in mice.2 In the bile duct–obstructed rat, downregulation of renal Asbt facilitates renal excretion of bile acids.6

In contrast to the apical uptake step, the mechanism for sterol export across the basolateral membrane of these cells is not well defined. However, a recent study demonstrated that ileal basolateral bile acid export may be mediated by the Ostα-Ostβ heteromeric transporter,7 a transporter that was initially identified in the liver of the little skate (Leucoraja erinacea).8, 9 In contrast to all other organic anion transporters identified to date, transport activity requires the coexpression of two distinct gene products: a predicted 340–amino acid, 7-transmembrane domain protein (OSTα) and a putative 128–amino acid, single-transmembrane domain ancillary polypeptide (OSTβ). However, the mechanism through which these two proteins interact to generate transport activity has not yet been identified. Substrates for this transporter include the bile acid taurocholate, other steroids (estrone 3-sulfate and digoxin), and prostaglandin E2.8, 9 The present study demonstrates that another steroid, dehydroepiandrosterone sulfate (DHEAS), is also a substrate. The recent work of Dawson and colleagues7 indicates that Ostα and Ostβ messenger RNA (mRNA) expression along the mouse gastrointestinal tract mirrors that of Asbt, and that both Ostα and Ostβ proteins are localized to the basolateral surface of ileal enterocytes.

The present study demonstrates that OSTα and OSTβ are also expressed at relatively high levels in the small intestine and kidneys of humans, mice, and rats, as well as in the human liver. In addition, the results define the subcellular localization of the two proteins, the functional transport activity of the heteromeric complex, and demonstrate that transport is most likely mediated by facilitated diffusion. These results provide strong support for the hypothesis that OSTα-OSTβ is the basolateral transporter responsible for sterol reabsorption in key transporting epithelia.

Abbreviations

ASBT, apical sodium bile acid transporter; OST, organic solute transporter; DHEAS, dehydroepiandrosterone sulfate; mRNA, messenger RNA; MDCK, Madin Darby canine kidney; PCR, polymerase chain reaction; cRNA, complementary RNA; ATP, adenosine triphosphate.

Materials and Methods

Materials.

[3H(G)]Taurocholic acid (2 Ci/mmol), [6,7-3H(N) estrone 3-sulfate (46 Ci/mmol), and [1,2,6,7-3H(N)]dehydroepiandrosterone sulfate (74 Ci/mmol) were purchased from PerkinElmer Life and Analytical Sciences, Inc. (Boston, MA). Inulin [14 C]carboxylic acid (2–10 mCi/mmol) and [32P]dCTP (3,000 Ci/mmol) were purchased from Amersham Biosciences (Piscataway, NJ). Other tritiated bile acids (2–60 Ci/mmol) were obtained from Dr. Alan Hofmann (University of California at San Diego, San Diego, CA) and were synthesized as previously described.10, 11 Unlabeled bile acids were purchased from Sigma-Aldrich (St. Louis, MO) and CalBiochem (San Diego, CA). All other chemicals were obtained from Sigma-Aldrich or J. T. Baker (Philipsburg, NJ). Molecular biology reagents were purchased from Invitrogen (Carlsbad, CA), Clontech (Palo Alto, CA), Integrated DNA Technologies (Coralville, IA), Qiagen (Valencia, CA), Origene (Rockville, MD), Ambion (Austin, TX), Bio-Rad (Hercules, CA), Promega (Madison, WI), Amersham Biosciences, Phenix (Hayward, CA), Kodak (Rochester, NY), and Fermentas (Hanover, MD). Madin Darby canine kidney (MDCK) (CCL-34) cells were obtained from the American Type Culture Collection and grown in monolayer at 37°C in an atmosphere of 5% CO2. Cells were maintained in Dulbecco's modified Eagle medium containing 1,000 mg/L D-glucose, 10% (vol/vol) fetal calf serum, and antibiotics.

Animals.

Mature Xenopus laevis were purchased from Nasco (Fort Atkinson, WI). Male Wistar and Sprague-Dawley rats and male C57Bl/6 mice were purchased from Charles River Laboratories (Kingston, NY). All animal experiments were approved by an institutional animal use and care committee and were performed according to the criteria outlined in the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Northern Blot Analysis.

DNA probes were generated via polymerase chain reaction (PCR) from linearized polyA vectors (351- to 402-bp probes), and the resulting amplicons were sequenced. Probes were radiolabeled with a Strip-EZ DNA kit (Ambion) using [α-32P]-dATP according to the manufacturer's instructions. Blots containing 2 μg poly(A)+ RNA isolated from 12 different human or mouse tissues were purchased from OriGene. Blots were rehydrated, hybridized with 32P-labeled DNA at 42°C, washed twice for 15 minutes in 2× SSC/0.1% SDS at 42°C and three times for 15 minutes in 0.25× SSC/0.1% SDS at 68°C for high stringency, and then exposed to Blue X ray film (Phenix). Blots were stripped using a Strip-EZ DNA kit (Ambion) before being probed for human OSTβ or mouse Ostβ.

Real-Time Quantitative Reverse-Transcriptase PCR Analyses.

Liver, kidney, duodenum, jejunum, ileum, and colon tissue samples were collected from male C57Bl/6 mice and male Wistar rats. Tissues from 5 to 7 mice were pooled for analysis. Tissue samples not immediately processed for RNA were stored in RNAlater (Ambion). Total RNA was isolated using the guanidinium thiocyanate/cesium chloride method of Snutch and Mandel.12 Gene-specific primers (Table 1) were designed using Primer Express 1.5 software (Applied Biosystems, Inc., Foster City, CA), and relative gene expression was determined on a Corbett Rotor-Gene 3000 real-time cycler. Samples were analyzed using an iScript One-step reverse-transcriptase PCR kit with SYBR Green (Bio-Rad).

Table 1. Primer Sequences Used in Real-Time Reverse-Transcriptase PCR Analysis
GenePrimer Sequence: 5′ > 3′Amplicon (bp)
Mouse Ostα 193
 ForwardGCCAGGCAGGACTCATATCAAA 
 ReverseGGCAACTGAGCCAGTGGTAAGA 
Mouse Ostβ 184
 ForwardCAGGAACTGCTGGAAGAAATGC 
 ReverseGCAGGTCTTCTGGTGTTTCTTTGT 
Mouse β-actin 110
 ForwardACCCTGTGCTGCTCACCGA 
 ReverseCTGGATGGCTACGTACATGGCT 
Rat Ostα 109
 ForwardCCCTCATACTTACCAGGAAGAAGCTAC 
 ReverseCCATCAGGAATGAGAAACAGGC 
Rat Ostβ 106
 ForwardTATTCCATCCTGGTTCTGGCAGT 
 ReverseCGTTGTCTTGTGGCTGCTTCTT 
Rat β-actin 100
 ForwardCCGTGAAAAGATGACCCAGATC 
 ReverseGGTACGACCAGAGGCATACAGG 

Membrane-Enriched Tissue Fractions.

Tissues from C57Bl/6 male mice and male Wistar rats (1 g of each tissue) were minced with scissors in 10 mL ice-cold buffer containing 10 mmol/L Tris-HCl (pH 7.4), 10 mmol/L KCl, 1.5 mmol/L MgCl2, 6.25 μL/mL protease inhibitor cocktail (Sigma P-8340), 2 mmol/L phenylmethylsulfonylfluoride, and 0.2 g/L EDTA. Tissues were homogenized with 50 strokes of a Dounce homogenizer (type A, loose-fitting pestle) immersed in ice, and sucrose was added to a final concentration of 250 mmol/L. Samples were centrifuged at 800g at 4°C for 20 minutes, and the resulting supernatant was centrifuged at 100,000g at 4°C for 20 minutes. The pellet (membrane-enriched fraction) was resuspended in 200 to 800 μL of buffer containing 10 mmol/L Tris-HCl (pH 7.4), 125 mmol/L sucrose, 125 μL/mL protease inhibitor cocktail, 0.2 g/L EDTA, and 2 mmol/L phenylmethylsulfonylfluoride. The membrane-enriched fractions were then passed through a 25-gauge needle 10 times and stored at −80°C until use. The protein concentration of each sample was then determined as described by Lowry et al.13

Analysis of Protein Expression.

Synthetic peptides corresponding to amino acids 315–329 of mouse Ostα (mA315; MYYRRKDDKVGYEAC), 91–104 of mouse Ostβ (mB91; FLRETLISEKPDLA), 315–329 of rat Ostα (rA315; MYYRKKDNKVGYEAC), 90–103 of rat Ostβ (rB90; ILRETLISEKADLA), 327–340 of human OSTα (hA327; ETFSSPDLDLNLKA), and 1–14 of human OSTβ (hB1; MEHSEGAPGDPAGT) were synthesized, coupled to keyhole limpet hemocyanin, and used to immunize New Zealand White rabbits (AnaSpec, San Jose, CA; New England Peptide, Inc., Gardner, MA). Each of the antibodies was affinity purified using its respective peptide antigen (AnaSpec; New England Peptide).

For immunoblot analysis of tissue extracts, samples were dissolved in Laemmli buffer (1:1, Bio-Rad), and SDS-PAGE was performed on 4%–20% Tris-HCl Ready Gels (Bio-Rad). For immunoblotting, proteins were electrophoretically transferred onto polyvinylidine fluoride membranes, blocked overnight with 5% nonfat milk in TBST (10 mmol/L Tris-HCl [pH 8.0], 150 mmol/L NaCl, and 0.05% (vol/vol) Triton X-100) at 4°C, and probed with the appropriate antibody in 5% nonfat milk in TBST for 2 hours at room temperature. For detection of mouse Ostβ, mouse Ostα, rat Ostβ, and rat Ostα, primary antibodies mB91, mA315, rB90, and rA315, respectively, were each used at a dilution of 1:1,000. Blots were then probed with a secondary antibody, anti–rabbit immunoglobulin G horseradish peroxidase–linked F(ab′)2 fragment from donkey (Amersham Biosciences), in 5% nonfat milk in TBST for 1 hour at room temperature. Antibody specificity was assessed using peptide competition studies (Supplementary Fig. 1).

Figure 1.

Northern blot analysis of human OSTα and OSTβ and mouse Ostα and Ostβ mRNA distribution. High-stringency Northern hybridization analysis using OSTα and OSTβ DNA probes was performed against poly(A)+ RNA (2 μg) from mouse or human tissues. A single predominant hybridization band was detected at approximately 1.5-kb pairs for mouse Ostα and human OSTα, and at approximately 0.7-kb pairs for mouse Ostβ and human OSTβ. Mouse Ostα and Ostβ were expressed at relatively high levels in the kidney and small intestine. Lower levels of Ostα were detected in stomach, heart, testis, thymus, spleen, muscle, and lung tissues after a longer exposure time (data not shown). Ostβ was also detected in the liver, lung, stomach, and testis after a longer exposure time. Human OSTα was abundant in the liver and small intestine, and lower levels were detected in the kidney, heart, stomach, testis, colon, and muscle. OSTβ was abundant in the kidney and small intestine and was also present in the liver, colon, testis, stomach, and spleen.

Tissue Immunolocalization.

Rodent tissue was acquired from normal C57Bl/6 mice and Sprague-Dawley rats immediately after a quick in vivo perfusion with 0.9% saline to remove blood from the organs. Use of human tissue was approved by the Yale University Human Investigation Committee and assigned HIC Protocol No. 26912. Tissue was acquired from both the Yale University Pathology Department and the Cooperative Human Tissue Network. The tissue was cut into small pieces and quickly frozen in Freon cooled in liquid nitrogen. The tissue was stored in liquid nitrogen until 5-μm sections were cut and placed on polylysine-coated glass microscope slides. Indirect immunofluorescence was performed with the antibodies described in the Analysis of Protein Expression section. Tissue sections were fixed with acetone cooled to −20°C for 10 minutes. Nonspecific sites were blocked with 1% bovine serum albumin in phosphate-buffered saline containing 0.05% Triton X-100. Primary antibody was diluted in the blocking buffer (hA327 1:300 for liver and 1:600 for kidney and ileum; hB1 1:100; mA315 1:200; mB91 1:150) and incubated on the tissue for 2 hours at room temperature. Secondary antibodies (Alexa 488 or Alexa 594 anti–rabbit immunoglobulin G) (Molecular Probes, Eugene, OR) were incubated for 1 hour at room temperature. Images were acquired on a Zeiss LSM 510 confocal microscope (Thornwood, NJ) and were further processed using Adobe PhotoShop (Adobe, San Jose, CA).

Generation of Stable, Triply Transfected Ostα-Ostβ-ASBT–Expressing MDCK Cells and Transcellular Transport Assays in Cell Monolayers.

Ostα-Ostβ-ASBT–expressing MDCK cells were generated and characterized as previously described.7 Following formation of a tight monolayer (typically between days 6 and 10), the cells were refed medium B (Dulbecco's modified Eagle medium containing 1,000 mg/L D-glucose, 10% [vol/vol] fetal calf serum, and antibiotics) containing 10 mmol/L sodium butyrate to induce expression of the transfected genes.14 Approximately 20 hours later, the cell monolayers were washed and incubated at 37°C for 10 to 60 minutes with Hank's balanced salt solution plus 10 μmol/L of various radiolabeled bile acids added to the apical or basolateral chambers. Transcellular transport was monitored by sampling the contralateral chamber. After incubation, the cells were washed in ice-cold Hank's balanced salt solution and harvested to determine cell-associated radioactivity and protein.

X. laevis Oocyte Preparation, Microinjection, and Transport Measurements.

Isolation of X. laevis oocytes was performed as described by Goldin15 and employed previously in our laboratory.16–18 Oocytes were injected with 50 nL of human OSTα and human OSTβ complementary RNA (cRNA) solutions (0.5–1 ng/oocyte),9 or with water for controls. For uptake measurements, 6 to 8 oocytes were placed in a borosilicate glass culture tube per condition and incubated at 25°C in a modified Barth's solution containing various radiolabeled substrates. For efflux measurements, individual oocytes were microinjected with 50 nL of various compounds 3 days after cRNA injection, washed twice with 2.5 mL modified Barth's solution, and incubated at 25°C in polypropylene scintillation vials containing 400 μL of modified Barth's solution, with and without various unlabeled substrates. After various periods, the extracellular medium was removed into a new scintillation vial, and the oocyte was lysed with 200 μL of 10% SDS. After the addition of 5.5 mL of Opti-Fluor liquid scintillation cocktail (Packard Instruments, Downers Grove, IL), radioactivity was counted in a Beckman Coulter LS 6500 scintillation counter (Beckman Coulter, Fullerton, CA).

Depletion of cellular adenosine triphosphate (ATP) was accomplished by incubating the oocytes for 30 minutes in modified Barth's solution supplemented with compounds known to deplete cellular ATP levels (either 0.2 mmol/L 2,4-dinitrophenol, 20 μg/mL antimycin A, or 2.4 mmol/L KCN).16 After the initial 30-minute incubation, the modified Barth's solutions containing the ATP-depleting compounds were removed and replaced with 100 μL of modified Barth's solution supplemented with 50 nmol/L [3H]estrone 3-sulfate (2 nCi/μL), and uptake was measured for 30 minutes at 25°C. Inorganic ion concentrations were adjusted in the modified Barth's solution prior to oocyte incubation by altering a specific ion's concentration within the solution: (1) Na(NO3) was isomotically substituted for NaCl; (2) KCl was isomotically substituted for NaCl at an 88 mmol/L concentration as well as a 44 mmol/L concentration; and (3) modified Barth's solution was supplemented with 100 μg/mL valinomycin, a K+-selective ionophore. The pH of the modified Barth's solutions was altered by adjusting the pH to 6.5 with dilute HCl or to 8.5 with dilute NaOH. Each of these solutions also contained 50 nmol/L [3H]estrone 3-sulfate (2 nCi/μL), and uptake was measured for 5 minutes at 25°C.

Statistical Analyses.

Comparison of data measuring initial rates of uptake and percent of efflux of radiolabeled substrates was performed with an unpaired two-tailed Student t test and correlated to P < .05.

Results

OSTα and OSTβ mRNA Is Expressed in Human and Rodent Intestine, Kidney, and Liver.

Northern blot analysis of multiple human and mouse tissues demonstrated single predominant ≈1.5-kb and ≈0.7-kb transcripts for OSTα and OSTβ, respectively (Fig. 1). In general, tissues that had relatively high levels of OSTα mRNA also had high levels of OSTβ mRNA, indicating a parallel tissue expression pattern. Both transcripts were relatively abundant in tissues that also express the apical sodium-dependent bile acid uptake transporter ASBT (SLC10A2), namely the human small intestine, kidney, and liver (Fig. 1), although they were also expressed at lower levels in many other tissues (data not shown; Seward et al.9). Note that although the human liver had relatively abundant OSTα mRNA and a moderate amount of OSTβ mRNA, the mouse liver had very low levels of these transcripts. These human tissue Northern blot results generally confirm previous quantitative PCR analysis of human OSTα and OSTβ9 (Fig. 2C), with the only exceptions being the testes and colon, which gave weak signals on Northern blot analysis (Fig. 1) but stronger signals in real-time PCR analysis.9 The reason for this quantitative difference in these two analyses is unknown, but it may be due to heterogeneity in the processing of the human samples or to differences in expression among humans.

Figure 2.

Distribution of OSTα and OSTβ mRNA in mouse, rat, and human tissues, and immunoblot detection of mouse and rat Ostα and Ostβ proteins. Relative mRNA expression was determined in the liver, kidney, duodenum, jejunum, ileum, and colon in mouse (A) and rat (B) tissues using real-time RT-PCR analysis. Data for the human tissues (C) were adopted from Seward et al.9 Values are means ± SE; n = 3. (D-G) For immunoblot detection, crude membrane fractions were isolated from liver, kidney, duodenum, jejunum, ileum, and colon of mice and rats. Primary antibodies were used at a 1:1000 dilution, and blots were then probed with anti-rabbit IgG horseradish peroxidase linked F(ab′)2 fragment from donkey. For mouse Ostα analysis, 60 μg protein was used in each lane, and for mouse Ostβ analysis, 80 μg protein was used per membrane fraction type, except for the ileum, in which 20 μg was used. For rat Ostα and Ostβ detection, 50 μg protein was used per membrane fraction type, except ileal Ostβ, where 20 μg was used. Liv., liver; Kid., kidney; Duo., duodenum; Jej., jejunum.

To further evaluate mRNA distribution in the mouse, and to obtain data on Ostα and Ostβ expression in rat tissues, mRNA was isolated from six different tissues and examined via quantitative reverse-transcriptase PCR analysis (Fig. 2). Mouse Ostα and Ostβ transcripts were most abundant in the terminal portion of the small intestine (the ileum); however, they were also expressed in other portions of the small intestine, colon, and kidney, but were barely detectable in the liver (Fig. 2A). These results support those obtained in the Northern blot analysis (Fig. 1) and those reported by Dawson and coworkers.7 Qualitatively similar results were seen in the rat, except that the levels of Ostα and Ostβ mRNA along the three major portions of the rat small intestine varied only by a factor of 2 (Fig. 2B). As previously described,9 human OSTα and OSTβ were most abundant in the liver, kidney, small intestine, and colon (Fig. 2C).

Ostα and Ostβ Proteins Are Expressed in Mouse and Rat Kidney, Small Intestine, and Colon.

The relative abundance of Ostα and Ostβ proteins in various mouse and rat tissues generally paralleled their mRNA abundance (Fig. 2). In both the mouse and rat, Ostα and Ostβ proteins were most abundant in the ileum, but they were also detected in other portions of the small intestine, as well as the colon and kidney (Fig. 2D-G). Note that in Fig. 2E,G, only 20 μg of protein was loaded for the ileum, whereas 80 μg was loaded for the other mouse tissues, and 50 μg was loaded for the other rat tissues.

Immunolocalization of Mouse and Rat Ostα and Ostβ and Human OSTα and OSTβ in Ileum, Kidney, and Liver.

Antibodies to OSTα/Ostα and OSTβ/Ostβ localized each of these proteins to the basolateral membrane of epithelial cells in the ileum, kidney, and liver (Fig. 3). However, as noted above in the Northern and immunoblot analyses, there were significant species and organ differences in relative expression. Notably, OSTα/Ostα was detected in the basolateral membrane of human liver hepatocytes and cholangiocytes (Fig. 3J), but little Ostα was seen in mouse hepatocytes (Fig. 3L). In contrast with mouse hepatocytes, mouse cholangiocytes showed strong labeling of their plasma membranes (Fig. 3L). Staining for OSTα/Ostα was noted in the basolateral membranes of ileal villus epithelial cells from all 3 species (Fig. 3A-C). When compared with the ileum, other segments of the intestine exhibited relatively weak staining (data not shown). OSTα/Ostα was also detected in the basolateral membrane of kidney proximal tubular cells from all three species (Fig. 3G-I). Mouse kidney also demonstrated glomerular labeling for Ostα (Fig. 3I), but the significance of this observation is unknown.

Figure 3.

Indirect immunofluorescence of OSTα/Ostα and OSTβ/Ostβ in liver, kidney, and ileum. Human tissues were labeled with hA327 (A,G,J) or hB1 (D) antibodies as described in Materials and Methods. The proteins were localized to the basolateral membrane of ileal villus epithelium (A,D), proximal tubules (G), hepatocytes (J), and cholangiocytes (J, inset). Similar localization was seen for for Ostα in rat ileum (B), kidney (H), and liver (K), and for Ostβ in rat ileum (E). Mouse ileal villus epithelial basolateral membrane was labeled with both Ostα (C) and Ostβ antibodies (F). Proximal tubule basolateral membrane signal for Ostα was very strong in mouse kidney (I), and, in addition, glomerular membrane staining was also seen (I). Mouse liver expression of Ostα was very low in hepatocytes (L), but the cholangiocyte signal was relatively strong (L, inset). Bar = 20 μm. Inset bar = 10 μm.

In contrast with OSTα/Ostα, weaker immunofluorescence staining was observed for OSTβ/Ostβ. The OSTβ/Ostβ signal was strongest in the intestine, and once again the basolateral membrane of the enterocytes displayed the most intense staining, although immunofluorescence was more diffusely distributed throughout the cell (Fig. 3D-F). Double labeling of intestinal sections for the apical proteins Mrp2 (proximal small intestine) or Mdr1 (terminal intestine) demonstrated clear basolateral localization of OSTα/Ostα and OSTβ/Ostβ (data not shown).

OSTα-OSTβ Mediates Facilitated Diffusion of Bile Acids and Sterols.

To distinguish whether OSTα-OSTα–mediated transport was occurring by facilitated diffusion, secondary active (coupled) transport, or primary ATP-driven transport, transport was measured under different culture conditions in X. laevis oocytes expressing OSTα and OSTβ. As illustrated in Fig. 4, OSTα-OSTβ–mediated uptake of estrone 3-sulfate was unaffected by depletion of intracellular ATP (Fig. 4A), changes in transmembrane Na+, K+, or Cl concentration gradients (Fig. 4B), or changes in the H+ gradient (Fig. 4C), consistent with transport by facilitated diffusion.

Figure 4.

OSTα- and OSTβ-mediated uptake is not affected by the depletion of intracellular ATP or by changes in transmembrane Na+, K+, Cl, or H+ gradients. Oocytes were injected with sterile water (control) or 1 ng OSTα cRNA plus 1 ng OSTβ cRNA. After 3 days, oocytes were incubated in modified Barth's solution containing one of three modifications. (A) Compounds known to deplete cellular ATP levels for 30 minutes at 25°C. Uptake of 50 nmol/L [3H]estrone 3-sulfate was then measured for 30 minutes at 25°C. Values are means ± SE; n = 3 separate oocyte preparations. (B) Five different types of modified Barth's solutions (Na(NO3) isomotically substituted for NaCl, KCl isomotically subsituted for NaCl in a high concentration as well as a medium concentration, and lastly with 100 μg/mL valinomycin), each set containing 50 nmol/L [3H]estrone 3-sulfate. Uptake was measured for 5 minutes at 25°C (n = 6). (C) 50 nmol/L [3H]estrone 3-sulfate at different pH values. Uptake was measured for 5 minutes at 25°C (n = 3). DMSO, dimethyl sulfoxide. DNP, 2,4-dinitrophenol; KCN, potassium cyanide.

To further test this hypothesis, additional studies examined whether OSTα-OSTβ–mediated transport was bidirectional and whether it could be trans-stimulated. Oocytes that were preloaded with unlabeled estrone 3-sulfate or taurocholate demonstrated enhanced uptake of [3H]taurocholate, consistent with accelerated exchange diffusion (Fig. 5A). To directly demonstrate that OSTα-OSTβ can mediate efflux from the cell, oocytes were loaded with either a low (1–2 μmol/L) or a moderate (200 μmol/L) initial concentration of [3H]taurocholate, [3H]DHEAS, or [3H]estrone 3-sulfate, and efflux was measured over 30 minutes (Fig. 5B-G). As previously demonstrated,16, 19 oocytes have an endogenous ATP-driven taurocholate and organic anion transport mechanism, and thus the control oocytes exhibit a robust efflux of these organic anions. Significant OSTα-OSTβ–mediated efflux was observed after the intracellular concentration of [3H]taurocholate, [3H]DHEAS, and [3H]estrone 3-sulfate was increased from 1 to 2 μmol/L to 200 μmol/L. The lower efflux seen at the 1- to 2-μmol/L concentrations is probably explained by the fact that oocytes contain many yolk proteins and other macromolecules that can bind these relatively hydrophobic substrates, and make them unavailable to the transporter.

Figure 5.

Trans-stimulation of [3H]taurocholate uptake by intracellular substrates, and enhanced [3H]taurocholate, [3H]DHEAS, and [3H]estrone 3-sulfate efflux in oocytes expressing OSTα-OSTβ. Oocytes were injected with sterile water (control) or 1 ng OSTα cRNA plus 1 ng OSTβ cRNA. (A) Oocytes were cultured for 3 days, and uptake of 20 μmol/L [3H]taurocholate was measured for 5 minutes at 25°C after preloading with 250 μmol/L trans-stimulating substrate (estrone 3-sulfate or taurocholate, or water for control). Values are means ± SE of 5 experiments in distinct oocyte preparations. (B-F) After 3 days of culture, efflux of either 2 μmol/L or 200 μmol/L [3H]taurocholate (B-C) or [3H]DHEAS (D-E), as well as efflux of 1 μmol/L and 200 μmol/L [3H]estrone 3-sulfate (F-G) was measured at 25°C for 30 minutes (n = 3 to 5 oocyte preparations). Efflux is expressed as the percent of the injected dose.

OSTα-OSTβ–mediated efflux was further enhanced by the addition of unlabeled DHEAS to the extracellular medium (Fig. 6), indicating trans-stimulation of efflux. In contrast, the addition of extracellular taurocholate trans-inhibited efflux of all three substrates, and estrone 3-sulfate had only slight stimulatory effects on efflux (Fig. 6). The mechanism for the trans-inhibition by taurocholate is unknown, but it may reflect differences in affinity for taurocholate on the outward-facing versus the inward-facing conformation of the transporter.

Figure 6.

OSTα-OSTβ–mediated efflux of [3H]taurocholate, [3H]estrone 3-sulfate, and [3H]DHEAS is accelerated by extracellular unlabeled DHEAS but trans-inhibited by taurocholate. Oocytes were microinjected with sterile water (control) or 0.5 ng OSTα cRNA and 0.5 ng OSTβ cRNA. After 3 days of culture, oocytes were injected again with 50 nL of 2.2 mmol/L-stock solutions of [3H]taurocholate (A), [3H]estrone 3-sulfate (B), and [3H]DHEAS (C) to achieve initial intracellular concentrations of approximately 0.2 mmol/L, and then efflux of the radiolabeled molecules was measured during incubation at 25°C in modified Barth's solution containing 0.3 mmol/L of either taurocholate, estrone 3-sulfate, or DHEAS for 5 minutes. The values reported are means ± SE of 3 experiments performed in different oocyte preparations.

Basolateral Bile Acid Export Is Accelerated in Triply Transfected MDCK Cells Expressing Mouse Ostα and Ostβ and ASBT.

To examine the ability of Ostα-Ostβ to function as a basolateral bile acid efflux transporter and to gain insight into its substrate selectivity, transfected MDCK/ASBT cells expressing Ostα, Ostβ, or both Ostα and Ostβ were grown on Transwell filter inserts and assayed for their ability to mediate transcellular transport. Previous studies have shown that MDCK/ASBT cells expressing Ostα or Ostβ alone exhibit only background levels of apical to basolateral taurocholate transcellular transport, whereas cells expressing both Ost subunits mediate significant apical to basolateral taurocholate transport.7 The results of this study demonstrate that in addition to taurocholate, Ostα-Ostβ was able to efficiently stimulate apical to basolateral transport of a variety of taurine- and glycine-conjugated bile acids (Fig. 7).

Figure 7.

Transcellular transport of bile acids in stably transfected MDCK cells. Control ASBT-expressing cells (circles) and cells expressing ASBT, Ostα, and Ostβ (squares) were plated onto Transwell filter inserts on day 0. Expression of the transfected plasmids was induced by addition of 10 mmol/L sodium butyrate on day 7. On day 8, the apical Transwell chamber received Hank's balanced salt solution containing 10 μmol/L of the various radiolabeled bile acids, and aliquots of the media in the opposite chamber were sampled over 60 minutes (n = 3). TUDC, tauroursodeoxycholate; GUDC, glycoursodeoxycholate; TC, taurocholate; GC, glycocholate; TCDC, taurochenodeoxycholate; GCDC, glycochenodeoxycholate; TDC, taurodeoxycholate; GDC, glycodeoxycholate.

Transcellular transport of bile acids requires uptake into the cells, intracellular protein binding and delivery to the basolateral membrane, and basolateral efflux. To isolate the Ostα-Ostβ–mediated basolateral efflux component, the cell-associated bile acid content was compared with the amount of each bile acid transported into the basolateral chamber after incubation for 60 minutes with 10 μmol/L of the various bile acids. The ratio of the basolateral to cell-associated bile acid mass varied from 3:3 (glycodeoxycholate) to 10:1 (tauroursodeoxycholate) in the MDCK/ASBT cells expressing Ostα-Ostβ (Fig. 8). For each bile acid species, the taurine-conjugate exhibited a higher ratio of basolateral to cell-associated bile acid than the corresponding glycine conjugate, suggesting that the taurine conjugates were transported more efficiently across the basolateral membrane by the murine Ostα-Ostβ.

Figure 8.

Cellular accumulation and transcellular transport of bile acids in stably transfected MDCK cells. Cells were plated onto Transwell filter inserts on day 0. Expression of the transfected plasmids was induced by addition of 10 mmol/L sodium butyrate on day 7. On day 8, the apical Transwell chamber received Hanks balanced salt solution containing 10 μmol/L of the various radiolabeled bile acids, and aliquots of the media in the basolateral chamber were sampled after 60 minutes. Cells were harvested at the end of the incubation to determine cell-associated protein and radioactivity. (A) Apical to basolateral transcellular transport by control cells (black bars) and Ostα-Ostβ–expressing cells (white bars) is expressed as pmoles of taurocholate transported per mg of cell protein (mean ± SE, n = 3). Transcellular transport of all bile acids tested was significantly greater in the Ostα-Ostβ–expressing cells (*P < .05; **P < .01). (B) The ratio of bile acid mass accumulated in the basolateral chamber to the cell-associated bile acid mass is shown for the control cells (black bars) and Ostα-Ostβ–expressing cells (white bars). TUDC, tauroursodeoxycholate; GUDC, glycoursodeoxycholate; TC, taurocholate; GC, glycocholate; TCDC, taurochenodeoxycholate; GCDC, glycochenodeoxycholate; TDC, taurodeoxycholate; GDC, glycodeoxycholate.

Discussion

This study characterizes the location and function of the bile acid and sterol transporter OSTα-OSTβ in human and rodent intestine, kidney, and liver. The results demonstrate that the two subunits of the transporter are coexpressed in tissues that also express the Na+-driven apical sterol transporter ASBT—namely, the small intestine, kidney, and cholangiocytes—and that OSTα and OSTβ are both localized to the basolateral plasma membrane in these epithelial tissues. Because ASBT and OSTα-OSTβ have overlapping substrate specificities, the polarized distribution of ASBT to the apical plasma membrane and OSTα-OSTβ to the basolateral membrane in the same tissues would allow for the vectorial, Na+-driven reabsorption of these compounds in these tissues.

Support for this model is provided by the observation that OSTα-OSTβ appears to be mediating facilitated diffusion of bile acids and sterols from the cell. OSTα-OSTβ–mediated transport was found to be independent of Na+, K+, H+, and Cl gradients and of intracellular ATP levels, it occurred in both directions across the plasma membrane, and it was able to accept a variety of sterols as substrates. Although transport activity was bidirectional across the plasma membrane, the kinetics most likely differ for the uptake versus efflux of a given substrate. It is noteworthy that DHEAS was able to trans-stimulate both uptake and efflux, whereas taurocholate trans-stimulated uptake but trans-inhibited radioisotope efflux (Fig. 6). Unfortunately, it is difficult to accurately assess the kinetics of efflux. Not only is it difficult to load cells with a given compound, it is nearly impossible to accurately assess the chemical activity (i.e., concentration of the unbound substance) in the intracellular space. The studies in the transfected MDCK cells clearly demonstrate that murine Ostα-Ostβ confers directional transport across the basolateral but not the apical membrane.

The present results also demonstrate significant differences in tissue expression between humans and rodents. Notably, the human liver expressed a relatively high amount of OSTα mRNA and protein, and a moderate amount of OSTβ, whereas rodent liver expressed very low levels of both of these genes. In the little skate (Leucoraja erinacea), the liver is also a major site of Ostα and Ostβ expression.8 Although the basis for the species differences in tissue expression is unknown, it is interesting to note that recent studies have identified comparable differences between humans and mice in the expression of a cholesterol transporter, the Niemann-Pick C1-like 1 (NPC1L1) gene.20NPC1L1 encodes for a transporter that mediates the intestinal uptake of cholesterol and plant sterols, and appears to be critical in cholesterol homeostasis.21, 22 As is the case for OSTα, NPC1L1 expression is highest in the human liver.20 In contrast, expression of Npc1l1 in mouse liver is extremely low, but the mouse small intestine exhibits a high level of Npc1l1 expression.20 The parallel tissue expression patterns of these sterol transporters in humans and mice may reflect important differences in cholesterol and bile acid metabolism between these species.23–25 In particular, rats and mice exhibit very high rates of both intestinal sterol absorption and hepatic cholesterol synthesis. In contrast, humans absorb relatively few sterols from the diet and have much lower rates of hepatic cholesterol and bile acid synthesis. Thus, the high expression of the Ostα-Ostβ and Npc1l1 transporters in rodent intestine is consistent with a high rate of dietary sterol absorption in rodents.

In conclusion, although the physiological role of this unique heteromeric transporter was not originally understood, the results of the present study—as well as the work of Dawson and colleagues7 demonstrating that OSTα and OSTβ are highly expressed in the ileum—provide strong evidence for a major role in the enterohepatic circulation of bile salts and possibly other sterols. The present study also suggests that this reabsorptive function may be extended to the renal proximal tubule, where filtered bile salts are actively reabsorbed and returned to the systemic circulation under normal physiological conditions. Likewise, localization of OSTα and OSTβ to the basolateral membrane of cholangiocytes should allow for bile salt reabsorption in cholestatic liver disorders, a possibility that has yet to be examined.

Ancillary

Advertisement