Tightly regulated induction of the adhesion molecule necl-5/CD155 during rat liver regeneration and acute liver injury

Authors

  • Briana M. Erickson,

    1. Department of Molecular Biology, Cell Biology and Biochemistry, Brown University, Providence, RI
    Search for more papers by this author
  • Nancy L. Thompson,

    1. Department of Medicine, Division of Hematology and Oncology, Brown University/Rhode Island Hospital, Providence, RI
    Search for more papers by this author
  • Douglas C. Hixson

    Corresponding author
    1. Department of Molecular Biology, Cell Biology and Biochemistry, Brown University, Providence, RI
    2. Department of Medicine, Division of Hematology and Oncology, Brown University/Rhode Island Hospital, Providence, RI
    • Rhode Island Hospital, George Building Room 362, 593 Eddy Street, Providence, RI 02903
    Search for more papers by this author
    • fax: 401-444-8141


  • Potential conflict of interest: Nothing to report.

Abstract

TuAg1/TagE4, the rat ortholog of the human poliovirus receptor CD155, is expressed on a high percentage of rat hepatocellular carcinomas. Recent studies have shown that TuAg1/TagE4/CD155 is a member of the nectin family of immunoglobulin (Ig)-like cell adhesion molecules, designated necl-5. Necl-5 is present at exceedingly low levels in adult epithelial tissues but is upregulated in primary cultures of rat hepatocytes, suggesting that disruption of liver architecture triggers its expression. To explore this possibility, we examined expression of necl-5 after two-thirds partial hepatectomy or carbon tetrachloride (CCl4)–induced acute injury. Using quantitative real-time polymerase chain reaction (QPCR), we found that necl-5 mRNA levels increased 15-fold by 9 hours, and decreased to 4-fold above baseline by 24 hours after partial hepatectomy. Necl-5 mRNA levels increased over 100-fold 6 hours after treatment with CCl4, reaching a peak of 140-fold above baseline by 10 hours, and thereafter rapidly declining. Necl-5 was localized at the membrane of midlobular and centrilobular hepatocytes 10 to 48 hours after CCl4 exposure. Northern blot analysis demonstrated a close correlation between the kinetics of necl-5 expression and the immediate–early response gene c-myc. Subconfluent cultures of the non-transformed liver epithelial cell line WB-F344 expressed high levels of necl-5, which was down-regulated as cells approached confluence. The transformed WB-F344 line GP7TB did not demonstrate density-dependent regulation of necl-5 expression. In conclusion, we report the in vivo induction of necl-5 in rat hepatocytes and provide evidence that both necl-5 mRNA and protein are tightly regulated in adult epithelial cells and tissue. (HEPATOLOGY 2006;43:325–334.)

Nectin-like molecule-5 (necl-5) was first described as the poliovirus receptor (PVR/CD155) after a screen of genomic DNA from cells displaying susceptibility to poliovirus infection.1 The rodent ortholog of necl-5 (necl-5/TuAg1/TagE4)2 was identified in the rat in monoclonal antibody (MAb) screens to isolate tumor-specific markers of hepatocellular carcinoma3–5 and colon carcinoma.6, 7 Necl-5 is a heavily glycosylated single-pass transmembrane protein with three extracellular immunoglobulin (Ig) loops, a short cytoplasmic domain, and a primary sequence that places it in the nectin family of Ig molecules. This family of calcium-independent cell adhesion molecules is divided into two subclasses: the nectins and the nectin-like (necl) molecules, with four and five members, respectively.8 The nectins are characterized by their ability to form cis-dimers and trans-dimers through interaction of their extracellular domains, and by the ability of their cytoplasmic domains to interact with the actin-binding protein afadin.9, 10 Nectins-1, -2, and -3 are expressed ubiquitously in epithelial cells,10 where they are localized to adherens junctions and are thought to play a regulatory role in cadherin-based adherens junction formation.9, 11, 12 Necl-5 forms homo-cis dimers but not homo-trans dimers, and does not bind afadin.13, 14 For this reason, necl-5 is grouped with the nectin-like molecules, whose functions are not well characterized.8

Members of the Ig superfamily perform a number of functions but most often play a recognition role at the cell surface. Accordingly, necl-5 functions in cell–extracellular matrix adhesion by interacting with the matrix molecule vitronectin.2, 15 The physiological importance of necl-5 binding to vitronectin is unknown, but necl-5 has been shown to co-localize with αvβ3 integrin–containing membrane microdomains13 and to be functionally associated with integrin αvβ3 in regulating cell motility.16 Necl-5 also functions as a cell–cell adhesion molecule through trans-interaction with nectin-3.13, 14 Experiments conducted in L fibroblast cells show that this transdimerization promotes recruitment of E-cadherin to nectin-3 in the initial stages of cell–cell adhesion.17 Furthermore, necl-5 stimulation in NIH3T3 cells was shown to expedite the transition from the G1 to the S phase of the cell cycle.18 This was accompanied by an enhancement of cell proliferation, activation of the Ras-Raf-MEK-ERK signaling pathway, and an upregulation of cyclin D2 and cyclin E.18

Although these findings have shed light on the functional activity of necl-5, this mechanistic information comes only from in vitro studies using non-epithelial cell models or reconstructed cell adhesion systems. Consequently, extrapolation of these results to epithelial cells must be made with caution, especially with regard to the function of necl-5 in vivo. This caveat is highlighted by the fact that protein expression of necl-5 can readily be detected by indirect immunofluorescence in most structures that support poliovirus replication, such as the germinal centers of the tonsils and Peyer's patches,15, 19 but is present only at exceedingly low levels in most adult organs.3, 4, 20 Although necl-5 transcripts are detectable in many epithelial tissues by reverse transcription polymerase chain reaction (RT-PCR) or Northern blot after an extended exposure,2, 20–22 normal epithelial cells including hepatocytes express cell surface levels of necl-5 that are undetectable by indirect immunofluorescence or immunoperoxidase staining protocols.4 The low levels of necl-5 mRNA detected in these studies may be attributable to the high expression found on nerve ganglia, or to the presence of contaminating monocytes in bulk tissue samples, which also express necl-5.4, 23–25 It is thus difficult to see how necl-5 would play a role in the normal interactions of epithelial cells. Necl-5 is readily detectable at the RNA and protein levels in all types of cancer tested to date, including human and rodent colon carcinoma,7, 26, 27 rat hepatocellular carcinoma and lung metastases,4 human glioblastoma,28 Min mouse intestinal adenoma,22 and a wide range of transformed cell lines.4, 5, 14, 21, 26 Preliminary data from our laboratory indicate that tumor cell lines express high levels of necl-5 both in culture and growing as nodules in vivo. Primary hepatocytes, however, express necl-5 for the duration of time that they are sustained in culture, but lose expression after transplantation in vivo.4 Necl-5 is also expressed by hepatoblasts in the liver from embryonic day 12 to 14,4 suggesting that necl-5 is one of many onco-fetal proteins that likely function during development and play a role in the progression of cancer.

The intriguing pattern of necl-5 expression, the proposed function of necl-5 in cell adhesion and proliferation, and the fact that several onco-fetal proteins are expressed during liver regeneration led us to investigate the pattern of necl-5 expression in the liver after partial hepatectomy and during recovery from carbon tetrachloride (CCl4)–induced acute liver injury to examine the potential function and regulation of necl-5 in a non-transformed, in vivo model system. Many genes essential for growth and repair have been described in these models. We identified a moderate increase in necl-5 expression 3 to 9 hours after partial hepatectomy. In contrast, necl-5 expression increased dramatically in hepatocytes throughout the liver lobule shortly after CCl4 administration. Expression rapidly returned to baseline 24 to 36 hours after treatment, indicating that necl-5 is tightly regulated in the adult liver. When we examined necl-5 regulation in WB-F344 rat liver epithelial cells, we found that necl-5 was also tightly regulated in response to changes in cell density. We conclude that necl-5 is an early response gene that functions during liver regeneration. Our work provides a physiologically relevant in vivo model in which to test the functional significance of this molecule, including its necessity for cell proliferation and injury repair.

Abbreviations

Necl, nectin-like molecule; MAb, monoclonal antibody; Ig, immunoglobulin; RT-PCR, reverse transcriptase polymerase chain reaction; CCl4, carbon tetrachloride; NIH, National Institutes of Health; QPCR, quantitative real-time RT-PCR; PCNA, proliferating cell nuclear antigen; NK, natural killer cells.

Materials and Methods

Animal Models.

All procedures were conducted in accordance with National Institutes of Health (NIH) guidelines for the humane use of laboratory animals. Two-thirds partial hepatectomy was performed on male Fisher 344 rats (200–250 g) according to the protocol of Higgins and Anderson.29 Animals were killed at time points ranging from 3 to 48 hours after surgery. All time points were performed on two animals. Acute CCl4 liver injury was induced in male Fisher 344 rats (200–250 g) by intraperitoneal injection of 1.25 mL/kg CCl4 in an equal volume of vegetable oil. Animals were sacrificed at time points ranging from 1 hour to 7 days post-injection. Control animals were injected with vegetable oil alone. All time points were performed on three animals. Upon sacrifice, livers of all animals were removed. Portions of each lobe were immersed in RNA-later (Ambion, Austin, TX) for subsequent RNA extraction. The remaining tissue was frozen in a hexane bath at −80°C.

Cell Culture.

WB-F344 cells (passages 12–20)30 and the chemically transformed WB-F344 cell line GP7TB31 were cultured in Dulbecco's minimal essential medium–F12 medium (Invitrogen, Carlsbad, CA) supplemented with 10% fetal calf serum and 2 mmol/L glutamine. Cells were maintained at 37°C in a humidified atmosphere containing 5% CO2 and were seeded at an initial density of 10% confluence in 75-mm2 culture flasks.

RNA Preparation.

Total RNA was isolated from tissue preserved in RNA-later (Ambion) and from cells growing in monolayer culture, using RNAzol B (Tel-Test, Friendswood, TX), in accordance with the manufacturer's instructions. One hundred milligrams tissue was used for RNA isolation from each animal, with typical yields of 150 to 250 μg. Cells growing in culture were washed twice in phosphate-buffered saline before addition of RNAzol B. RNA was isolated from two 75-mm2 flasks for each condition examined.

Northern Blot Analysis.

Aliquots (10 μg) of total RNA were size fractionated on 1% agarose/formaldehyde gels together with commercial RNA size markers (Gibco/BRL, Gaithersburg, MD) as previously described.5 After electrophoresis, gels were equilibrated in 1 mol/L ammonium acetate and RNA was transferred to Nytran nylon membranes (Schleicher and Schuell, Keene, NH). Blots were baked in a vacuum oven for 2 hours at 80°C. Prehybridized filters were hybridized under stringent conditions with cDNA probes labeled with (32P) dCTP (New England Nuclear; 3000 Ci/mmol) to a specific activity of 0.2 to 1.0 × 109 cpm/μg DNA using a primer extension kit (Boehringer Mannheim Biochemicals, Indianapolis, IN). Blots were covered in plastic wrap and exposed to X-ray film (Kodak, Rochester, NY) at −70°C in the presence of intensifying screens. The following cDNA clones were used as probes: an RT-PCR–generated 400-bp fragment of necl-55 and a 400-bp PstI fragment of human c-myc (American Type Culture Collection, Manassas, VA). Ethidium bromide staining of 18S ribosomal RNA served as an indicator of RNA quality and loading variations.

Quantitative PCR.

RNA samples were reverse transcribed to yield cDNA with the Superscript III first-strand synthesis kit (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol, using 2 μg total liver RNA and 1 μL 50 mmol/L oligo(dT)20 in a final volume of 50 μL. DNA primers were designed to amplify an 84-bp region of necl-5 spanning the splice site of exon 6 using Primer3 software.32 The sequences of the primers used were as follows (5′→3′): forward primer, GAGGCATCTGAGATTCTGCC; reverse primer, TCCGATGATCAGGACACAAA. A 76-bp region of β-actin was amplified in tandem from the same cDNAs and was used for normalization. The sequences of the β-actin primers used were (5′→3′): forward primer, GGGAAATCGTGCGTGACATT; reverse primer, GCGGCAGTGGCCATCTC.33 Quantitative real-time RT-PCR (QPCR) mixtures contained 12.5 μL Brilliant SYBR Green QPCR Master Mix (Stratagene, La Jolla, CA), 100 nmol/L each primer, 10 nmol/L reference dye, and 5 μL 1:15 diluted cDNA in a total volume of 25 μL. Samples were incubated at 95°C for 10 minutes, followed by 45 cycles of 95°C for 30 seconds, 56°C for 1 minute, and 72°C for 30 seconds in optical 96-well strips, using the MX4000 Multiplex Quantitative PCR System (Stratagene). Amplification plots were analyzed using MX4000 software version 3.0. A standard curve was generated using amplification plots of serial dilutions ranging from 10 to 0.001 pg plasmid pstBlue1-necl-5f1, amplified with the necl-5 primers shown under the same conditions as the experimental samples. Plotting Ct values obtained for each cDNA on the standard curve enabled us to calculate the fold-difference between each experimental sample and liver cDNA from untreated or vehicle-injected control animals, normalized to β-actin. The level of necl-5 detected in normal, untreated liver was defined as 1, and the abundance of necl-5 transcript in each animal was expressed in terms of the fold-difference. All QPCR reactions were performed in duplicate and were averaged to obtain the data point for each animal, with reported values representing the mean of 2 animals for partial hepatectomy data, and the mean of three animals for CCl4 treatment data.

Immunofluorescence.

Indirect immunofluorescence staining was performed on 5-μm acetone-fixed frozen sections of rat liver, and cells grown on Permanox chamber slides (Nunc, Rochester, NY), according to a previously described protocol.34 Undiluted hybridoma supernatant containing a necl-5 specific mouse monoclonal antibody (MAb 324.9) generated in our laboratory3–5 was used as the primary antibody for immunostaining. AlexaFluor®488 goat anti-mouse IgG (H+L) secondary antibody (Molecular Probes, Eugene, OR), diluted to 5 μg/mL in phosphate-buffered saline with 1% normal goat serum was used for detection. Double labeling was performed using a primary antibody cocktail of MAb 324.9 hybridoma supernatant (isotype IgG2b) and a 1:1,000 dilution of ascites containing mouse MAb H.4 (isotype IgM), specific for the hepatocyte cytoplasmic marker H.4,35 or a 1:300 dilution of ascites containing mouse MAb OC.5 (isotype IgM), specific for the bile duct marker OC.5.36 A secondary antibody cocktail of AlexaFluor®488 goat anti-mouse IgG2b (Molecular Probes, 5 μg/mL), and AlexaFluor®594 goat anti-mouse IgM (μ chain) (Molecular Probes, 5 μg/mL), was used for detection. Labeling of necl-5 and desmin was performed as described, using mouse anti-desmin MAb DE-R-11 (Novocastra, Newcastle, UK) diluted 1:100, with Alexafluor®594 goat anti-mouse IgG1 (Molecular Probes, 5 μg/mL) used for detection.

Confocal Microscopy.

Confocal images were acquired with a Nikon PCM 2000 (Nikon Inc., Mellville, NY) using the Argon (488) and the green Helium-Neon (543) lasers. Serial optical sections were performed with Simple 32, C-imaging computer software (Compix Inc, Cranberry Township, PA). Z series sections were collected at 0.5 μm with 40× and 60× PlanApo lenses and a scan zoom of 1× or 2×. Images were processed in NIH Image J (National Institutes of Health, Springfield VA).

Results

Necl-5 Increases Moderately During Liver Regeneration After Partial Hepatectomy.

After partial hepatectomy, a surgical procedure in which two thirds of the liver is removed, cells in the remaining lobes rapidly transition from G0 to G1 phase of the cell cycle.37, 38 Initiation of DNA synthesis occurs between 12 and 18 hours after surgery, reaching a peak at 22 to 24 hours.39 The integrity of the regenerating liver is not compromised during this process. When we examined necl-5 mRNA levels in normal liver using QPCR, very low expression was detected after 29 amplification cycles. We believe that this small amount is attributable to the presence of nerve ganglia in the liver, which express necl-5 at high levels.4 The level of necl-5 present in normal liver was used as the baseline value for comparison with livers from animals receiving a partial hepatectomy (Fig. 1). Necl-5 levels increased 10-fold over baseline by 3 hours. Maximal levels were observed at 9 hours where expression peaked at 14-fold above baseline. By 24 hours, necl-5 levels had declined to 3-fold above baseline and continued to fall as the liver mass increased.

Figure 1.

Necl-5 mRNA levels after two-thirds partial hepatectomy. Relative necl-5 mRNA levels were determined by QPCR from liver RNA preparations obtained 3 to 48 hours after partial hepatectomy. The nearly undetectable amount of necl-5 present in normal liver is defined as 1, and the increase in necl-5 seen after partial hepatectomy is expressed as the fold increase over the normal liver baseline level. Each time point shown is the average of two animals. All samples were normalized to β-actin expression. QPCR, quantitative real-time reverse transcription polymerase chain reaction.

Analysis of necl-5 protein levels in rat liver is complicated by the lack of reactivity of existing MAbs recognizing rat necl-5 to detect the partially denatured protein on immunoblots. After multiple unsuccessful attempts to detect necl-5 expression at any point after partial hepatectomy using necl-5–specific MAb 324.9 in combination with sensitive indirect immunoperoxidase (Vectastain ABC alkaline phosphatase kit, Vector Laboratories, Burlingame, CA) or immunofluorescence protocols, we concluded that levels of necl-5 present in the adult liver are sufficiently low that a 14-fold increase in transcript is not substantial enough to produce detectable levels of protein in hepatocytes. Whether these low levels of necl-5 have functional significance remains to be determined.

Necl-5 mRNA Levels Rapidly and Dramatically Increase After Acute Liver Injury.

On uptake by the liver, CCl4 is metabolized to the highly reactive trichloromethyl radical by cytochrome p459II.E.1, resulting in hepatocyte lipid peroxidation in the endoplasmic reticulum, plasma membrane damage, disruption of calcium homeostasis, and direct hepatocyte toxicity.39 Acute exposure results in inflammation and vast centrilobular necrosis. This promotes a regenerative response in the midlobular hepatocytes, and normal liver architecture is restored within 7 days of exposure. Because the regenerative response initiated by CCl4 is mediated by many of the same growth factors and signal transduction molecules that are expressed after partial hepatectomy, necl-5 expression likely would be elevated. Intraperitoneal injection of CCl4 in vegetable oil resulted in widespread necrosis that was visible histologically by 24 hours (Fig. 2). Seven days after treatment, the normal liver architecture was restored. Quantitation of necl-5 mRNA levels by QPCR (Fig. 3) showed that 1 to 3 hours after treatment with CCl4 there was a slight increase in necl-5 transcript relative to baseline levels in control animals injected with vegetable oil vehicle alone. Six hours after CCl4 exposure, necl-5 levels rose dramatically to 110-fold above baseline and reached a maximum at 10 hours of 140-fold above baseline. Necl-5 levels fell to 20-fold above baseline by 24 hours, and continued to fall until they returned to baseline levels by 48 hours. This pattern indicates that necl-5 expression in the liver is tightly regulated. Northern blot analysis showed that the time course of necl-5 expression after CCl4 exposure closely paralleled that of c-myc (Fig. 4), a well-characterized immediate–early response gene.40 Both necl-5 and c-myc transcripts were elevated by 3 hours, reached maximal levels between 6 and 12 hours, and began to decline by 24 hours. The immediate–early genes perform many functions that are critical for early events in the regenerative response.37, 40

Figure 2.

Acute CCl4 liver injury induces widespread necrosis. Hematoxylin-eosin staining of 5-μm-thin sections of F344 rats before treatment (A), 24 hours after intraperitoneal injection of CCl4 (B), and 7 days after intraperitoneal injection of CCl4 (C). The large necrotic patches seen in (B) (arrows) are typical of the extent of injury 24 to 48 hours after acute CCl4 toxicity. Representative sections were viewed at 20× magnification. CCl4, carbon tetrachloride.

Figure 3.

Necl-5 mRNA levels after acute CCl4 injury. Relative necl-5 mRNA levels were determined from liver RNA preparations obtained 1 to 168 hours after intraperitoneal injection with CCl4 by QPCR. The very low level of necl-5 transcript detected in oil-injected control animals matched that observed in untreated animals, and is defined as 1. The increase in necl-5 seen after CCl4 treatment is expressed as the fold increase above this baseline level. Each time point shown represents the average of three animals. All samples were normalized to β-actin expression. CCl4, carbon tetrachloride; QPCR, quantitative real-time reverse transcription polymerase chain reaction.

Figure 4.

The kinetics of necl-5 upregulation in comparison with those of the immediate–early response gene c-myc. F344 rats were treated with CCl4 or vegetable oil vehicle. Liver RNA was isolated from animals at the indicated times and subjected to Northern blot analysis using probes that specifically recognize necl-5 or c-myc. Ethidium bromide–stained 18s rRNA bands are shown as a loading control. CCl4, carbon tetrachloride.

Expression of Necl-5 in the Liver Is Localized to Hepatocytes Within the Areas of Injury.

CCl4 toxicity is initiated in centrilobular hepatocytes because of the higher levels of P-450 enzyme activity in these areas and progresses outward to periportal regions.39 To determine the localization of necl-5 after CCl4 treatment, frozen sections of liver tissue were stained by indirect immunofluorescence using MAb 324.9. Membrane staining with MAb 324.9 first became prominent 10 hours after CCl4 exposure (Fig. 5A, B). Interestingly, at this point necl-5 was present in bands of cells radiating throughout the liver lobule. By 24 to 36 hours after CCl4 exposure, necl-5 was present on the membrane of pockets of surviving cells that were surrounded by necrotic tissue (Fig. 5C). After 48 hours, when the liver has begun to recover, necl-5 was sometimes seen on hepatocytes bordering areas of necrosis. By 72 hours, necl-5 was no longer detectable in the liver by indirect immunofluorescence (data not shown). To evaluate the distribution of necl-5 within the liver lobule, double labeling was carried out in conjunction with MAb OC.5 (Fig. 5D–E), which specifically recognizes biliary epithelium.36 Ten hours after CCl4 exposure, necl-5 was found in both midlobular hepatocytes located approximately equidistant from central veins and portal areas with OC.5-positive ducts, and in centrilobular hepatocytes more proximal to central veins.

Figure 5.

Indirect immunofluorescence localization of necl-5 within CCl4-treated liver tissue. Necl-5 is not detectable in normal rat liver (A). Membrane staining first becomes prominent 10 hours after CCl4 exposure (B). Thirty-six hours after CCl4 exposure, large clusters of living cells express necl-5 and are surrounded by necrotic tissue (C). Seventy-two hours after exposure, necl-5 is no longer detectable by immunofluorescence (data not shown). Double labeling of liver sections 10 hours after CCl4 exposure with necl-5 MAb 324.9 (green) and the bile duct specific marker OC.5 (red) (D–E). Ten hours after CCl4 treatment, necl-5 is found throughout the liver lobule, frequently localizing to midlobular and centrilobular hepatocytes (D–E). BD, bile duct; CV, central vein. Central veins are outlined in white for clarity. Representative sections were viewed at 20× magnification, with selected regions enlarged to show staining of hepatocyte membranes (B–C). CCl4, carbon tetrachloride.

Necl-5–expressing cells 24 to 36 hours after CCl4 exposure appeared to be smaller and displayed an altered morphology compared with hepatocytes in the normal rat liver (Fig. 5C). To verify that these cells were hepatocytes, tissue sections from these time points were double-labeled with antibodies specific for necl-5 and for the hepatocyte-specific marker H.4.35 All necl-5–expressing cells in these areas also expressed H.4 (Fig. 6), indicating that these cells were indeed viable hepatocytes. They did not express the transferrin receptor (data not shown), characteristic of small hepatocyte progenitors,41 or the oval cell marker OV.6 (data not shown).42

Figure 6.

Characterization of large clusters of necl-5–expressing cells in the livers of CCl4-treated animals. Tissue sections taken from animals 36 hours (A–C) and 48 hours (D–F) after CCl4 exposure were double-labeled with monoclonal antibodies recognizing the hepatocyte-specific antigen H.4 (A, D) and necl-5 (B, E). The merged images (C, F) demonstrate that most of the necl-5–positive cells are also expressing H.4, indicating that they are viable hepatocytes. These cells did not express markers characteristic of oval cells or SHP cells (data not shown). Representative sections were viewed at 40× and 120× (inset) magnification. CCl4, carbon tetrachloride; SHD, small hepatocyte progenitor.

During CCl4-induced liver injury, an influx occurs of perisinusoidal cells possessing a stellate morphology in and around areas of hepatic necrosis.43 These mesenchymal cells are characterized by expression of the intermediate filament protein desmin. Because whether perisinusoidal cells express necl-5 is unknown, we labeled tissue sections obtained from 10 hours to 48 hours post-CCl4 administration with antibodies recognizing necl-5 and desmin. Consistent with previous findings, we observed a significant increase in the number of desmin-containing stellate cells present in the liver during CCl4-induced injury. These cells were found almost exclusively in areas of the liver that did not contain necl-5; however, necl-5 staining of hepatocyte membranes was frequently observed immediately adjacent to areas with a high concentration of desmin-positive cells (Fig. 7). The few desmin-containing cells that were found in necl-5–positive areas of the liver could clearly be distinguished from hepatocytes, and no overlap of necl-5 and desmin staining was observed (Fig. 7).

Figure 7.

Necl-5 expression by perisinusoidal stellate cells. An influx of stellate cells labeled with antibodies recognizing the intermediate filament protein desmin was seen in the hepatic sinusoids 10 hours after CCl4 administration (A, arrow in C). The stellate cell body can be visualized in several cells across the section (A, asterisks in C), but long cellular processes of additional stellate cells are also visible (A, C, red staining). Necl-5 is found at the membrane of a subset of hepatocytes 10 hours post-CCl4 treatment (B–C, green staining). Stellate cells are found primarily outside of necl-5–expressing areas of the liver. In rare areas where stellate cells localize within necl-5–positive areas, there is no overlap in desmin and necl-5 staining (C, asterisks).

Necl-5 Expression Is Regulated in Normal But Not Transformed Liver Epithelial Cells With Respect to Confluence.

A recent study indicated that necl-5 protein became down-regulated by endocytosis in NIH3T3 fibroblasts on contact with adjacent cells.44 This is in contrast to our findings in liver regeneration, which indicate that necl-5 regulation occurs at the RNA level. To further evaluate the regulation of necl-5 in vitro, we examined necl-5 expression at the RNA level in the liver epithelial cell line WB-F344 at different degrees of confluence after seeding. These non-transformed cells become contact inhibited in their growth on formation of a confluent monolayer.45 In WB-F344 cells, necl-5 expression was high when cells were growing in log phase, as determined by Northern blot analysis (Fig. 8A, 50% confluence). As cells approach confluence, necl-5 levels declined dramatically, and necl-5 transcript was barely detectable in cells that had been maintained at confluence for a period of 48 hours (Fig. 8A, 100+% confluence). In subconfluent WB-F344 cultures, necl-5 localized both to sites of cell–cell contact and to free areas of the cell membrane (Fig. 8B). Necl-5 expression was particularly prominent in cells undergoing division (Fig. 8C) but was barely detectable in a confluent cell monolayer (Fig. 8D). In contrast, the chemically transformed WB-F344 cell line GP7TB was not contact inhibited and did not display density-dependent regulation of necl-5 (Fig. 8A, GP7TB). Future mechanistic studies will be necessary to determine what effect the constitutive necl-5 expression seen in GP7TB and other hepatoma cell lines has on tumorigenicity.

Figure 8.

In vitro regulation of necl-5 expression in WB-F344 and GP7TB hepatoma cells. RNA was isolated from WB-F344 cells, and from the chemically transformed WB-derived cell line GP7TB, at the indicated levels of confluence, and subjected to Northern blot analysis using a necl-5–specific probe (A). Cells that were maintained at confluence for 48 hours were used for the 100% measurement. WB-F344 cells contain an abundance of necl-5 transcript at subconfluence, which declines to nearly undetectable levels as the cells form a growth-arrested, confluent monolayer. Cell density does not alter necl-5 expression in the GP7TB hepatoma cell line. Normal liver RNA and placental RNA were used as negative and positive controls of Necl-5 expression, respectively, and the 18s rRNA band is shown as a loading control. Necl-5 protein is found at the membrane of subconfluent WB-F344 cells (B), with expression highest in cells undergoing division (C). Necl-5 is barely detectable in a confluent monolayer of WB-F344 cells by indirect immunofluorescence (D).

Discussion

We have characterized the expression pattern of necl-5 during liver regeneration to further understand its in vivo regulation and function. In vitro experiments have suggested that necl-5 functions in cell proliferation,18 migration,16, 46, 47 and adhesion,13–15, 17 but the physiological relevance of these findings has not been explored.

During liver regeneration, hepatocytes and nonparenchymal cells rapidly undergo division while maintaining the functionality of the normal liver. This is achieved through the coordinated regulation of transcription factors, growth factors, cytokines, cell cycle–associated proteins, signal transduction molecules, and a number of proteins of unknown function. In contrast to partial hepatectomy, in which regeneration occurs in a liver of reduced mass with intact architecture, CCl4 exposure results in large areas of necrosis and a severe disruption of the structure of the liver, including adhesive interactions between hepatocytes. Necl-5 could promote the re-establishment of these contacts, potentially functioning as an “emergency cell adhesion molecule” when cells are undergoing periods of acute stress, or promoting migration of hepatocytes into areas of the liver lost to necrosis.

This is consistent with the observation that primary hepatocytes express necl-5 when they are dissociated and grown in culture (a dramatic form of injury), but down-regulate expression when returned to an in vivo environment.4 The rapid down-regulation that occurs in the regenerating liver, primary hepatocytes, and WB-F344 cells, but not in carcinomas or transformed epithelial cell lines, suggests that necl-5 performs a function that is deleterious to normal epithelial tissue when expressed at elevated levels but may offer a selective advantage to transformed cells that have lost the ability to downregulate necl-5.4

The rapid upregulation and downregulation of necl-5 before the peak of DNA synthesis after both partial hepatectomy and CCl4 injury appears to preclude any role in re-establishing histotypic cell–cell interactions after cell division. An alternate possibility suggested by the close correspondence between the expression of necl-5 and c-myc, one of the many cell cycle regulatory genes expressed with immediate early kinetics during liver regeneration, would be a role in stimulating hepatocyte proliferation. Indeed, necl-5 has previously been shown to enhance activation of the Ras-Raf-MEK-ERK signaling pathway, resulting in an up-regulation of cyclins D2 and E, and shortening the G0/G1 phases of the cell cycle in NIH3T3 fibroblasts.18 This pathway is known to be active in hepatic regeneration.

Extensive staining was performed to determine whether a correlation exists between necl-5 staining and either BrdU incorporation or nuclear expression of proliferating cell nuclear antigen (PCNA) in hepatocytes during CCl4-induced liver regeneration, suggesting a role for necl-5 expression in hepatocyte proliferation. Demonstrating a consistent correlation proved to be problematic, because necl-5 expression rapidly changed spatially throughout the course of regeneration, with a window of expression that largely preceded the onset of DNA synthesis. Necl-5 was seen selectively in bands of midlobular and centrilobular hepatocytes 10 hours after CCl4 administration. The very few PCNA or BrdU-positive hepatocytes at this time point were all localized within necl-5–positive areas of the liver. By 36 hours, when BrdU and PCNA staining were abundant, necl-5 was typically spread throughout the non-necrotic areas of the liver. By 48 hours, necl-5 staining had diminished, but BrdU and PCNA persisted. We also attempted to address this issue by performing co-localization with other markers of cell cycle progression, including KI-67 and cdc 47, with identical results. Additional studies are necessary to delineate the role of necl-5 in liver regeneration, but given that surviving hepatocytes proliferate to a similar extent in both partial hepatectomy and CCl4-induced regeneration, and that the upregulation of necl-5 that we report is 10-fold greater after CCl4 injury than after partial hepatectomy, cellular injury and mitogenic stimuli likely contribute separate and additive signals for necl-5 induction.

An alternative function for necl-5 in liver regeneration is also suggested by reports that necl-5 interacts with the natural killer (NK) cell activating receptors DNAM-1 (CD226) and Tactile (CD96).48, 49 The liver is known to contain a substantial population of resident NK cells (pit cells),50 but whether these cells express DNAM-1 or Tactile has not been investigated. Stimulation of NK cell receptors by necl-5 could profoundly influence the course of regeneration by inducing the secretion of cytokines, or having an activating or repressive effect on the innate immune response. Further investigation is clearly necessary to define the mechanism and consequence of necl-5 up-regulation during liver regeneration and acute liver injury.

Acknowledgements

The authors thank Kate Brilliant and Helen Callanan for assistance with animal surgeries and harvesting of rat tissues, Virginia Hovanesian for assistance with confocal microscopy, Dr. Patricia Meitner for helpful advice regarding QPCR setup, Shannon Karr for preliminary Northern blot assistance, and Michael Hough for assistance with the manuscript.

Ancillary