SEARCH

SEARCH BY CITATION

Abstract

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Integrin-linked kinase (ILK) is a multidomain focal adhesion protein implicated in signal transduction between integrins and growth factor receptors. Although its expression is upregulated in pulmonary and renal fibrosis, its role in the development of hepatic fibrosis remains to be determined. Therefore, we considered it important to investigate whether ILK is involved in activation of hepatic stellate cells and thus plays a role in the development of hepatic fibrosis. Immunohistochemical analysis of liver sections obtained from rats with CCl4-induced cirrhosis revealed increased expression and colocalization of ILK and alpha-smooth muscle actin in hepatic stellate cells in perisinusoidal areas. In addition, hepatic stellate cells isolated from fibrotic livers expressed high levels of ILK and alpha-smooth muscle actin, and their expression was sustained in culture. In contrast, hepatic stellate cells (HSCs) isolated from normal rat liver did not express ILK, but its expression was increased when the cells were activated in culture. Our studies also showed that ILK is involved in the phosphorylation of ERK 1/2, p38 MAPK, JNK, and PKB and that selective inhibition of ILK expression by siRNA results in a significant decrease in their phosphorylation. These changes were accompanied by significant inhibition of cell spreading and migration without affecting cell proliferation. In conclusion, ILK plays a key role in HSC activation and could be a possible target for antifibrogenic therapy. (HEPATOLOGY 2006;44:612–622.)

Hepatic fibrosis is a wound-healing process in livers with chronic injury and is characterized by excess deposition of extracellular matrix (ECM) components, namely, type I collagen.1 Hepatic stellate cells (HSCs), previously known as lipocytes, fat-storing cells, or Ito cells, are liver perisinusoidal cells whose functions remain to be fully elucidated. However, they are involved in the production of the ECM within the space of Disse, they store vitamin A and triglycerides, and they regulate portal blood flow.2–5 After liver injury, quiescent HSCs convert to myofibroblasts, a phenotypic transformation termed “activation,” resulting from a complex process of gene reprogramming. This is characterized by, among other things, elimination of vitamin A stores, upregulation of expression of several plasma membrane receptors such as PDGF-BB and endothelin, acquisition of a contractile apparatus containing myosins and actins, including skeletal myosin and alpha-smooth muscle actin (α-SMA), and upregulation of type I collagen genes.2–5 In addition to these myofibroblasts (MFs), portal fibroblasts also play a key role in liver fibrosis.6, 7 However, the role of these two types of myofibroblasts in the development of the various types of cirrhosis and liver fibrosis remains to be determined.

The transformation of HSCs into myofibroblasts appears to be an irreversible process in vivo. Indeed, myofibroblasts are eliminated by apoptosis upon discontinuation of the administration of CCl4 to produce cirrhosis.8, 9 Moreover, the induction of myofibroblast apoptosis with gliotoxin accelerates the reversion of liver fibrosis in animals.10

Several extracellular matrix components, cell membrane receptors, and cell growth factors regulate HSC/MF migration, proliferation, and death. Of these, integrins play a key role because they are involved in cell-matrix interactions and regulate cell adhesion.11–14

Integrin-linked kinase (ILK) is expressed in most mammalian cell types and tissues, although expression is low. However, ILK activity is stimulated in pathological conditions in a phosphatidylinositol 3-kinase (PI3K)–dependent manner by adhesion of cells to the ECM. Therefore, ILK plays an important role in the cell adhesion and growth factor signaling pathways. Through the integration of these signaling pathways, ILK regulates integrin-mediated cell adhesion, cell differentiation, proliferation, and the cell cycle as well as ECM assembly.15–17

Overexpression of ILK has been observed in renal fibrosis.18, 19 However, little is known about its role in hepatic fibrosis. Therefore, in this study we investigated the role of ILK in liver fibrosis. We demonstrated that regardless of whether HSCs are activated in vivo after administration of CCl4 or in vitro after culturing the cells, the expression of α-SMA is accompanied by the upregulation of ILK. Increased expression of ILK resulted in enhanced phosphorylation of ERK 1/2, p38 mitogen-activated protein kinase (MAPK), c-Jun N-terminal kinase (JNK), and protein kinase B (PKB), and selective inhibition of the kinase by small interfering RNA (siRNA) prevented this effect.

Material and Methods

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Animal Model of Hepatic Fibrosis.

Male Sprague-Dawley rats (250-300 g body weight, obtained from Charles-River Japan, Yokohama, Japan) were injected subcutaneously with a 1 mL/kg mixture of CCl4 and olive oil [1:1 (v/v)] twice a week for 1-5 weeks. Advanced liver fibrosis was observed in rats injected with CCl4for 5 weeks.8, 20 The rats were sacrificed at 3 days after final CCl4 injection. For example, CCl4 was administered to the animals at 3 days and 7 days of every single week, and the animal was sacrificed at 3 days after injection (Day 10). All rats were fed a standard diet (MF, Oriental Yeast, Tokyo, Japan) and kept at 21°C-25°C under 12-hour dark/light cycles; they received humane care in accordance with the guidelines of the University of Tsukuba for the care of laboratory animals. After harvesting the livers, a minimum of 2 lobes were fixed with formalin for histological examinations, and the remaining tissue was snap-frozen for total RNA and protein extraction.

Isolation and Culture of HSCs.

HSCs were isolated from the livers of control and CCl4-treated rats at the times indicated in the figures. The isolation was performed by sequential pronase E and collagenase digestion of the livers, and the HSCs were harvested by Opti-prep (Sigma, St. Louis, MO) gradient centrifugation as previously described.21 The average number of HSCs collected was approximately 1.5-2 × 106 cells/liver. The purity of the isolated HSCs (greater than 92%) was determined by vitamin A autofluorescence analysis at 328 nm, and viability (greater than 90%) was determined by trypan blue exclusion. Isolated HSCs were plated on plastic culture dishes (Corning Japan, Tokyo, Japan) in DMEM containing 10% fetal bovine serum and 100 U/mL penicillin/streptomycin. HSCs were cultured at 37°C in a humidified atmosphere of 5% CO2. The medium was changed 24 hours after plating and then every 48 hours. HSCs became activated after 3-7 days of plating, as determined by the loss of vitamin A autofluorescence and the increased expression of alpha-smooth muscle actin (α-SMA).

A rat liver myofibroblast-like cell clone (CFSC-2G), obtained from a liver with CCl4-induced cirrhosis after spontaneous immortalization in culture,22 was cultured under the same conditions as those of the freshly isolated HSCs.

Immunohistochemistry.

Immunostaining of rat liver slices was performed as previously described.23 Samples were incubated with anti-α-SMA 141A (diluted 1:100, Sigma, St. Louis, MO) and anti-ILK (Upstate Biotechnology, Lake Placid, NY; diluted 1:100) antibodies. For immunofluorescence staining, HSCs were incubated first with an anti-ILK antibody, followed by incubation with both FITC-labeled anti-rabbit IgG and Cy3-labeled anti-α-SMA 141A (diluted 1:100, Sigma, St. Louis, MO) antibodies. The localization of ILK-positive cells was assessed under a fluorescence microscope (IX71, Olympus Inc. Tokyo, Japan). As a marker for sinusoidal endothelial cells, tissue sections prepared as described in the previous section were incubated with a mouse anti-CD31 antibody (Santa Cruz).

Protein Extraction and Western Blotting.

Cells cultured on 35-mm-diameter culture dishes were rinsed twice with PBS (4°C) and lysed with lysis buffer containing 150 mmol/L NaCl, 1.5 mmol/L MgCl2, 5 mmol/L EDTA, 1% Triton X-100, 1% NP40, 10 mmol/L NaF, 1 mmol/L Na3VO4, and protease inhibitor cocktail (Roche, Indianapolis, IN). The protein concentration of the cell lysates and tissue homogenates was determined by the BCA protein assay kit (Pierce Biotechnology, Rockford, IL). SDS-PAGE (10% acrylamide gel) and Western blotting were performed as previously described.24

Small Interfering RNA Transfection.

Twenty-one sequences of nucleotide RNA were chemically synthesized by Qiagen (Tokyo, Japan). The small interfering RNA sequences targeted rat ILK (accession No. NM_133409). The target sequence and the design of the siRNA are given in Table 1. CFSC-2G cells were transfected with siRNA using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol as previously described.24 Cells were used 48 hours after transfection. In addition, a Nucleofection apparatus (Amaxa, Cologne, Germany) was used for transfection of the HSCs in primary culture.

Table 1. Design of siRNA for ILK Silencing
Target sequenceCACGGACACCGTGACATTGTA
Senser(CGGACACCGUGACAUUGUA)dTdT
Antisenser(UACAAUGUCACGGUGUCCG)dTdG

RNA Extraction and Real-Time PCR.

Total RNA was extracted from CFSC-2G cells with Trizol LS (Invitrogen) according to the manufacture's instructions. One microgram of total RNA was reverse-transcribed to complementary DNA (cDNA) using the Reverse Transcription System by the Roche 1st Strand cDNA Synthesis kit (Roche Diagnosis Corp, Indianapolis, IN). Real-time quantitative PCR was performed with a light cycler (Roche). The design of the primer sets for the PCR reactions is given in Table 2. LightCycler DNA Master SYBR Green I (Roche) was used for the PCR reaction. Triplicate samples were used for these experiments.

Table 2. Primer Sets for Real-Time PCR
 Primer sequences
β-Actinforward, 5′-GATGAGATTGGCATGGCTTT-3′
reverse, 5′-GAGAAGTGGGGTGGCTT-3′
ILKforward, 5′-AGCACGGATCAATGTGATG-3′
reverse, 5′-CCCAGAAACATGCATAGTG-3′
TGF-β1forward, 5′-ACTTTAGGAAGGACCTGGGT-3′
reverse 5′-CGGGTTGTGTTGGTTGTAGA-3′
MMP-9forward, 5′-CGCTTGGATAACGAGTTC-3′
reverse, 5′-AGGTCATAGGTCACGTAGG-3′
Procollagen type Iαforward, 5′-AAACTCCCTCCATCCCAATC-3′
reverse, 5′-GAGAAGTGGGGTGGCTT-3′

Cell Proliferation Assay.

Proliferation of normal and transfected CFSC-2G cells was determined using ELISA with a bromodeoxyuridine (BrdU) colorimetric kit (Roche). The cells were treated according to the manufacturer's instruction. The amount of BrdU incorporated was determined at a wavelength of 405 nm using an Emax™ precision microplate reader (Molecular Devices Corporation, Menlo Park, CA).

ILK Kinase Activity Assay.

Kinase activity of ILK was determined according to the method reported by Kaneko et al.25 Briefly, the liver tissue was homogenized in the cell lysis buffer (see Protein Extraction and Western Blotting section), precleaned with Protein A/G plus gel (Pierce), and then incubated with an anti-ILK antibody (Upstate) at 4°C for 12 hours. After incubation, the immune complexes were immunoprecipitated with Protein A/G gel. The precipitated ILK was incubated at room temperature for 30 minutes in a total volume of 50 μL of a kinase reaction buffer [20 mmol/L Hepes (pH 7.0), 10 mmol/L MgCl2, 10 mmol/L MnCl2, 2 mmol/L NaF, 1 mmol/L Na3VO4, 100 μmol/L ATP] in a 96-well Reacti-Bind Metal™ Chelate Plate (Pierce) coated with his-tagged inactive PKB/Akt (Upstate Biotechnology). Phosphorylation of PKB/Akt was detected using anti-phospho-PKB/Akt (ser473) as a secondary antibody coupled to horseradish peroxidase (Cell Signaling Technology, Beverly, MA) and SuperSignal ELISA Pico Chemiluminescent Substrate (Pierce). Chemiluminescence was visualized by exposing the ELISA plate on ECL hyperfilm (Amersham Pharmacia Biotech, Piscataway, NJ), and the density of each well was quantified using ImageJ software (NIH, Bethesda, MD).26

Wound-Healing Assay.

The wound-healing assay was performed as previously described by Voulet-Craviari et al.27 Plastic dishes containing confluent cells were scraped with a pipette tip (10 μL). Following wounding, the culture medium was changed to remove detached and damaged cells, and the extent of wound closure was determined microscopically 6 hours later. Three fields of the wound were monitored from the beginning to the end of the experiment. Wound images were captured by a microscope (IX71) equipped with a DP70 digital camera (Olympus), and the area of the wound was calculated by ImageJ software. The ratios before and after wound closure were determined and expressed as a percentage of the remaining wound area.

Cell-Spreading Assay.

CSFC-2G cells were plated on plastic dishes (Corning) and incubated for 2 hours. Unattached cells were removed after washing with PBS. The area of a single cell was determined by the captured image of a CFSC-2G cell using ImageJ software. The ratio of the average cell size (n =; 20 each dish) 4 and 6 hours after plating was subtracted by that obtained after 2 hours and expressed as the percentage of cell size.

Statistics.

Statistical analysis was performed either by one-way analysis of variance or the two-tailed Student t test using Prism software (Graphpad Software Inc., San Diego, CA). Results are expressed as mean ± SE, and P values less than .05 were considered statistically significant.

Results

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Upregulation of ILK in Fibrotic Liver.

Progression of hepatic fibrosis was monitored by silver staining of collagen fibers,23 and activation of the HSCs was followed by immunostaining for α-SMA. After 5 weekly injections of CCl4, the typical pattern of fibrous septa was observed surrounding the nodules of regenerating hepatocytes found in livers with cirrhosis (Fig. 1A). Progression of liver fibrosis was accompanied by a significant increase in the number of α-SMA-positive cells (Fig. 1A), which were observed in fibrotic septa as well as in the liver parenchyma (Fig. 1A, in high magnification).

thumbnail image

Figure 1. Expression and activity of integrin-linked kinase (ILK) in a rat model of hepatic fibrosis. (A) Liver sections from rats receiving weekly injections of CCl4 for either 1 week (1 wk) or 5 weeks (5 wks). The pictures are representative of either silver-stained (silver) liver sections or immunohistochemical analysis using antibodies raised against either alpha-smooth muscle actin (α-SMA) or ILK. The inserts represent enlarged intraseptum and parenchymal regions of the liver sections; arrows point to α-SMA (magnification ×20). (B) Sequential increase of ILK expression in liver tissues of either control rats (CTL) or rats treated with CCl4 for 1 week (1 wk), 3 weeks (3 wks), or 5 weeks (5 wks), determined immunohistochemically using an anti-ILK antibody. Arrows point to ILK-positive cells in the perisinusoidal area (magnification ×40). (C) Localization of ILK-positive parenchymal cells and sinusoidal endothelial cells, using ILK- and CD31-specific antibodies, respectively. ILK-positive cells in the parenchymal area were detected in near proximity to the CD31-positive cells, suggesting that the ILK-positive cells localize preferentially in the perisinusoidal area. (D) ILK kinase activity was determined in the liver tissue homogenates from control (CTL) and CCl4-treated rats for 1-5 weeks. Briefly, ILK in the liver tissue homogenates was immunoprecipitated with an anti-ILK antibody, and the ILK-induced phosphorylation of an inactive protein kinase B (PKB) was determined using a phospho-PKB-specific antibody (*significantly different from CTL at P < .05, **significantly different from CTL at P < .005).

Download figure to PowerPoint

Measurement of the expression of ILK in normal and fibrotic livers was followed by immunostaining. As shown in Fig. 1A-B, the levels of ILK detected in normal liver tissue were minimal. In contrast, development of liver fibrosis was accompanied by increased expression of ILK. Significant expression of ILK was observed after the third week of CCl4 treatment and continued to increase throughout the treatment period (Fig. 1B). However, even though ILK-positive cells were predominantly localized in liver parenchymal areas after 3-4 weeks of CCl4 treatment, by 5 weeks ILK was also detected in fibrotic septa. ILK-positive cells in the liver parenchyma had the typical stellate-shaped appearance and did not stain positive for CD31, a marker for sinusoidal endothelial cells (Fig. 1C). Moreover, double immunostaining for α-SMA and ILK revealed colocalization of both markers, suggesting that activated HSCs indeed expressed ILK (Fig. 2A).

thumbnail image

Figure 2. Expression of integrin-linked kinase (ILK) in activated hepatic stellate cells. (A) Liver sections from rats treated for 3 weeks with a weekly injection of CCl4 were immunohistochemically stained red for alpha-smooth muscle actin (α-SMA) and green for ILK individually or combined (merged). Arrows point to ILK-expressing sites (original magnification ×20). (B) Hepatic stellate cells isolated from control rats seeded in plastic dishes and cultured up to 7 days. (C) Hepatic stellate cells isolated from rats that received CCl4 treatment for 2 weeks seeded in plastic dishes and cultured up to 7 days. Expression of ILK, α-SMA, and beta-actin were determined by Western blotting.

Download figure to PowerPoint

Changes in ILK kinase activity in liver tissue homogenates from control and CCl4-treated rats were determined as described in the Materials and Methods section. Similar to the changes in ILK expression, kinase activity significantly increased over the period of CCl4 treatment and was 198.2% ± 12.5% that of the controls (P < .05) by 2 weeks, reaching 315.2% ± 24.4% that of the controls by 5 weeks (P < .01; Fig. 1D).

ILK Is Upregulated during Culture Activation of HSCs.

To investigate whether culture activation of HSCs was associated with increased expression of ILK, freshly isolated HSCs, as well as those obtained from the livers of rats treated with CCl4 for 2 weeks, were plated in 35-mm plastic dishes and maintained in culture for up to 7 days. As shown in Fig. 2B, ILK was undetectable in freshly isolated and plated HSCs obtained from normal livers. However, ILK was detected after 3 days in culture, which was accompanied by increased expression of α-SMA (Fig. 2B). Therefore, similar to our in vivo findings, culture activation of HSCs was accompanied by increased expression of ILK. As expected from our observations in vivo, HSCs isolated from livers of CCl4-treated animals expressed ILK immediately after isolation and continued to express ILK over time in culture (Fig. 2C). Altogether, these findings strongly support the idea that ILK is expressed during HSC activation..

Genetic Manipulation of ILK Expression in CFSC-2G Cell Line.

To elucidate the function of ILK in activated HSCs/MFs, we employed cells from an immortalized rat liver myofibroblast-like cell clone, CFSC-2G.22 These cells have been fully characterized and shown to express features of HSCs in early passages. They express α-SMA, desmin, nestin, and glial fibrillary acidic protein (GFAP) mRNA.28 Moreover, they express low levels of α1(I) collagen mRNA, but these can be further upregulated in culture.29 Our findings confirmed our previous observations about the expression of GFAP, but the cells did not express detectable levels of fibulin-2, a marker of MF (Fig. 3A).

thumbnail image

Figure 3. Suppression of integrin-linked kinase (ILK) protein expression in CFSC-2G cells by small interfering RNA (siRNA). (A) Comparative expression of fibulin-2, glial fibrillary acid protein (GFAP) in cell lysates from CFSC-2G and NIH3T3 (3T3) cells was determined by Western blotting. β-Actin expression was determined as a loading control. (B) CFSC-2G cells were transfected with specific rat ILK siRNA using Lipofectamine 2000 (Invitrogen). Rat Lamin A/C siRNA was used as a negative control. Expression of ILK protein was determined by Western blotting. (C) Effect of ILK suppression on α-SMA expression was also determined by Western blotting. β-Actin was used as a loading control.

Download figure to PowerPoint

CFSC-2G cells were transfected with ILK siRNA, and expression of ILK was assessed 48 hours later by both Western blotting and quantitative real-time PCR. Efficiency of siRNA transfection (72.5%) was confirmed by determining the number of CFSC-2G cells expressing GFP-labeled nonspecific siRNA (Qiagen). As shown in Fig. 3A, ILK protein expression was suppressed (65.2% ± 5.82%; P <. 05), whereas steady-state ILK mRNA levels were decreased by 91.5% ± 4.1% (P < .01; Fig. 3B). In transfected HSCs, protein expression of α-SMA was significantly suppressed by ILK siRNA (57.8% ± 6.1%), suggesting the involvement of ILK in the activation of HSCs (Fig. 3C). The transfection of siRNA specific for lamin A/C, as a negative control, did not induce alterations in ILK expression (Fig. 3B-C). The inhibition of ILK expression by ILK siRNA was accompanied by a significant decrease in transforming growth factor beta 1 (TGF-β1) and type 1 procollagen mRNA expression (Fig. 7).

Effect of ILK Suppression in PKB and MAPK Signaling Pathways in CFSC-2G Cells.

ILK phosphorylates PKB/Akt and MAP kinase pathways, and through this mechanism it regulates several cell functions.30, 31–33 Therefore, it was important to investigate whether inhibition of ILK by siRNA altered these pathways in HSCs. To this end, we determined the changes in expression and phosphorylation of PKB and MAP kinase in HSCs cultured for 2 weeks. As illustrated in Fig. 4A, phosphorylation of PKB increased after 1 week in culture and followed the increased expression of ILK and α-SMA. This suggests the PKB signaling pathway is involved in HSC activation and is downstream of ILK. To test this hypothesis, CFSC-2G cells were transfected with ILK siRNA. As shown in Fig. 4B, ILK silencing resulted in the suppression of PKB phosphorylation, whereas total expression of PKB remained unchanged. Similarly, phosphorylation of extracellular signal–regulated kinase [Erk (p42/44)], p38, and JNK was significantly suppressed by silencing ILK, whereas the respective total expression of these kinases was unaffected (Fig. 4C). As a control for these experiments, cells were transfected with an siRNA specific for lamin A/C. As shown in Fig. 4B,C, no change in phosphorylation of PKB, Erk, and p38 was detected (Fig. 4B,C).

thumbnail image

Figure 4. Alteration in signal transduction pathways following ILK silencing. (A) Hepatic stellate cells isolated from control rats were plated in plastic dishes and cultured for either 1 week (1 wk) or 2 weeks (2 wks) in Dulbecco's modified eagle medium containing 10% fetal calf serum. Expression of total and phosphorylated protein kinase B (PKB) was determined by Western blotting. (B) CFSC-2G cells were transfected with rat ILK siRNA. Expression of total and phosphorylated PKB was also determined by Western blotting. (C) Total and phosphorylated expression of extracellular signal regulated kinase, p38 mitogen-activated protein kinase, and c-Jun N-terminal kinase were determined by Western blotting in cells transfected with scrambled or either ILK or Lamin A/C siRNA. Transfection with Lamin A/C was used as a negative control. The blots are representative of 3 independent transfections.

Download figure to PowerPoint

Role of ILK in Proliferation and Apoptosis of HSCs.

AKT and Erk1/2 signaling pathways are known to play a key role in cell survival and proliferation, respectively.34, 35 Therefore, ILK could play a role in sustaining the proliferation of the activated HSCs, thus preventing their death by apoptosis.34 To test this hypothesis we transfected CFSC-2G with ILK siRNA and determined the extent of PKB and MAPKs phosphorylation and HSC proliferation. As shown in Fig. 5A, the incorporation of BrdU in silenced ILK [ILK(−)] cells was significantly reduced as compared to control cells (52.67% ± 12.2% of control, P < .005). Furthermore, the number of apoptotic cells, as determined microscopically by using Hoechst22328 to visualize the morphological changes in cell nucleus, was significantly increased in cells 48 hours after transfection of ILK siRNA [5.2% ± 2.49% in CTL vs. 19.4 ± 12.4 in ILK(−), P < .005], suggesting the suppression of ILK-induced apoptosis in HSCs (Fig. 5B,C).

thumbnail image

Figure 5. Effect of ILK silencing on proliferation and apoptosis of CFSC-2G cells in culture. (A) Proliferative activity of the CFSC-2G cells was determined by bromodeoxyuridine (BrdU) incorporation assay. Assays were done in triplicate from 3 independent transfections [*significantly different from control (CTL) at P < .01]. (B) Apoptotic cells were determined by Hoechst 33342 staining. (C) Two hundred cells were randomly counted, and the percentage of apoptotic cells was calculated and expressed as a percentage of the total. The results are presented as the mean ± SD of 3 independent transfections (*significantly different from CTL at P < .05).

Download figure to PowerPoint

Effect of ILK Suppression on Wound Healing and Cell Spreading.

ILK plays a role in cytoskeletal organization during cell matrix interactions. Thus, ILK could play a role in cell spreading and migration when placed in culture. To assess cell migration, we utilized an in vitro wound-healing model. Closure of the wound was monitored over time under a phase-contrast microscope. As shown in Fig. 6A, 6 hours after scraping the cells, the wound was almost closed, with migratory cells that had moved from the edges of the wound. However, in the ILK-silenced cells, migration was more limited by 6 hours, and the wound was still noticeable. For quantitative determination, the area of the wound was measured at the beginning and after 6 hours. In the control group, the size of the remaining wound area after 6 hours was 28.42% ± 7.85% of the original wound, whereas in ILK-silenced cells it was 89.54% ± 3.8% of the original wound (P < .001, compared to controls; Fig. 6B). The possible involvement of differential cellular proliferation could be excluded because the ILK-silenced cell-induced incorporation of BrdU (97.8 ± 4.3% of CTL) after 6 hours was not significantly different from that in the CTL cells.

thumbnail image

Figure 6. Effect of ILK silencing on motility and spreading of hepatic stellate cells (HSCs). (A) The wound-healing assay was performed as described in the Materials and Methods section using either control (CTL) or ILK-silenced [ILK(−)] CFSC-2G cells. Wound closure was monitored over time under a microscope. A representative image of 3 independent assays is shown. The presence of cells in the wound site was confirmed by hematoxylin-eosin staining after fixation of the cell monolayer with 4% paraformaldehyde containing 0.01% Triton X100. (B) The size of the remaining wound area was determined and expressed as a percentage of the original size of the wound area [*significantly different from ILK(−) cells at P < .001]. (C) CFSC-2G cells were trypsinized 48 hours after siRNA transfection and reseeded in plastic dishes. The shape of the cells was monitored over time under a microscope. A representative image of 3 independent assays is shown. (D) Change in cell size was determined and expressed as the percentage above that 2 hours after seeding (*significantly different from the respective CTL at P < .05 2 hours after seeding compared to parental cells).

Download figure to PowerPoint

In addition, ILK silencing significantly decreased spreading of CFSC-2G cells (Fig. 6C). The spreading of the control CFSC-2G cells was 135.5% ± 22.4% 4 hours after inoculation and 212.0% ± 53.2% 6 hours after inoculation (P < .05, compared to the size of the control cells after 2 hours), whereas that of ILK-suppressed cells was 137.2% ± 15.4% after 4 hours and remained unchanged by 6 hours (134.8% ± 16.2%; Fig. 6D).

Effect of ILK Suppression on Fibrosis-Associated Gene Expression in CFSC-2G Cells.

Activation of HSCs was accompanied by increased expression of the 2 type I collagen genes. Thus, we determined by real-time PCR the expression of genes involved in liver fibrogenesis, namely, TGF-β1, matrix metalloprotease-9 (MMP-9), and α1(I) procollagen in CFSC-2G cells in which ILK was suppressed after transfection with ILK siRNA. As shown in Fig. 7, ILK silencing resulted in significant suppression of gene expression, and TGF-β1, α1(I) procollagen, and MMP-9 mRNA levels were 31.4% ± 6.2%, 23.9% ± 13.1% (P < .01), and 39.7% ± 30.0% (P < .05) of the controls, respectively.

thumbnail image

Figure 7. Alterations in fibrosis-associated gene expression in ILK-silenced CSFC-2G. Total RNA was extracted from ILK-expressing or -silenced CSFC-2G cells. Expression of mRNA of ILK, TGF-β1, MMP-9, and procollagen type Iα was determined by real-time PCR as described in the Materials and Methods section. PCR was performed in triplicate using the total RNA obtained from 3 independent experiments. The results are expressed as percentages of the respective control (CTL) using ILK-expressing cells. The controls were set at 100% (*P < .01, compared to CTL, **P < .001, compared to CTL; ILK, integrin-linked kinase; TGF-β1, transforming growth factor β1; MMP-9, matrix metalloprotease-9; PCR, polymerase chain reaction).

Download figure to PowerPoint

To validate the findings obtained with the CFSC-2G clone, similar experiments were performed with HSCs isolated from rat livers. As illustrated in Fig. 8, transfection of these cells with ILK siRNA resulted in a 52% reduction in ILK expression as determined by Western blotting (Fig. 8A), and this in turn resulted in a significant reduction in cell proliferation as determined by PCNA expression, attenuation of the expression of α-SMA, and partial inhibition of both PKB phosphorylation and cell spreading (Fig. 8A,B).

thumbnail image

Figure 8. ILK silencing in isolated rat hepatic stellate cells. Isolated rat hepatic stellate cells (HSCs) were transfected with either scrambled or ILK siRNA [ILK(−)] using an AMAXA (Cologne, Germany) transfection kit. (A) Protein expression of ILK, PCNA, α-SMA, total/phospho PKB, and β-actin was determined by Western blotting. (B) Isolated HSCs were trypsinized 48 hours after either control (CTL) or siRNA transfection and reseeded in plastic dishes. The shape of the cells was monitored over time under a microscope. A representative image of 3 independent assays is shown.

Download figure to PowerPoint

Discussion

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

Activation of HSCs and their transformation into myofibroblasts are accompanied by increased migration and proliferation.2–5 Because one of the first extracellular matrix components produced after injury is fibronectin,36 it could be postulated that cells require integrins for cell-matrix interaction and could migrate on a fibronectin carpet. Indeed, HSC adhesion to fibronectin facilitates their activation, whereas binding to laminin prevents it.37 Therefore, a better knowledge of membrane receptors and signal transduction pathways involved in cell-matrix interaction and cell migration could be useful in unraveling key steps in the activation cascade and in developing novel antifibrogenic therapies.

It has already been shown that focal adhesion kinase (FAK) is an important kinase in HSC migration and proliferation via activation of the PI3K and AKT pathways and, therefore, plays an important role in the adhesion of cells to the extracellular matrix and in their migration and proliferation.38 We previously showed that Rho kinase and myosin light-chain kinase (MLCK) also play key roles in cell adhesion by organizing the actin/myosin framework.39, 40 We further showed that inhibiting HMG-CoA reductase with simvastatin prevented geranylgeranylation of Rho kinase and greatly impaired HSC adhesion and contraction.41 Accordingly, Rho and MLCK could play a role in the organization of the cytoskeleton and in HSC contraction,39–41 events that occur after cells adhere to the extracellular matrix.

In the present study we showed that ILK, a kinase downstream of PI3K and upstream of PKB/Akt, is upregulated in vivo in CCl4-induced liver fibrosis. We further showed that activated HSCs in fibrotic livers express ILK by demonstrating the colocalization of ILK and α-SMA, the marker of HSC activation, in vivo after administration of CCl4 and during culture activation in vitro. Several weeks after administration of CCl4, ILK was also expressed by cells in the fibrous septa. Although these cells could be derived from portal fibroblasts,6, 7 Geerts et al showed that activated HSCs migrate and localize in areas in which fibrous tissue will be deposited within 24-48 hours after a single injection of CCl4.42

Studies performed with a well-characterized HSC clone (CFSC-2G) that showed an activated phenotype in culture29 revealed ILK may be involved in HSC activation. When expression of ILK was silenced with ILK siRNA, expression of α-SMA, a bona fide marker of HSC activation and its transformation into myofibroblasts, was downregulated. Another, preliminary study of human liver samples revealed ILK is also expressed in the perisinusoidal areas of livers with cirrhosis and within fibrous septa (Zhang et al., 2005, unpublished findings).

It has been already shown that ILK plays a key role in Akt/PKB activation.31 In this study we showed that ILK expression and activity are elevated in livers with CCl4-induced cirrhosis and that in cultured CFSC-2G cells, ILK phosphorylates serine 473 of PKB/Akt. Suppression of ILK activity by ILK siRNA decreased Akt/AKB phosphorylation. Activation of the AKT/PKB survival pathway can play an important role in sustaining the survival of activated HSCs. It could prevent apoptosis of HSCs, an event shown to occur after interruption of the administration of CCl4, resulting in resolution of liver fibrosis.8, 9 However, ILK could also play a role in inducing HSC proliferation. AKT/PKB phosphorylates and inhibits the activity of glycogen synthase kinase (GSK)–3β,43 one of the kinases involved in β-catenin modification.44 Thus, GSK-3β inactivation could result in β-catenin stabilization and nuclear translocation. It has been demonstrated that nuclear β-catenin can form transcriptional complexes with LEF and TCF, inducing transcription of c-Myc and cyclin D1.44, 45

Cross talk between ILK and MAP kinase has been reported in studies on anchoring-independent cell-cycle progression.46 Because MAP kinase serves as a downstream effector of β1 integrin,47 this fibronectin receptor, which is clustered in focal adhesion sites, could recruit ILK, and this, in turn, could regulate MAP kinase activity.48 Thus, by this additional mechanism, Erk (p42/44), p38, and JNK could control the cell cycle as well as cellular proliferation, and alterations in these mechanisms could induce apoptosis.

Our findings on the role of ILK in cell spreading, migration, and proliferation are supported by findings in ILK-null mice. In these animals the loss of ILK resulted in profound defects in cell spreading, adhesion, actin organization, and proliferation.49 Therefore, on the basis of our findings as well as those of others,36, 50 we speculate that binding of HSCs to fibronectin via its integrin receptors triggers the activation of FAK, PI3K, ILK, and the AKT/PKB pathway, thus inducing activation of HSCs and enhancing their migration and proliferation. ILK also upregulates the expression of MAP and Erk 1/2 kinases, and these can further influence cell proliferation and migration. Because of the key role of ILK in activation of HSCs and therefore in liver fibrosis, this kinase is an ideal target for the development of novel antifibrogenic therapies.

Acknowledgements

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References

The authors thank Dr. Mie Inao, Department of Medicine, Saitama Medical School, for her technical instruction. The authors also thank Yoko Jinzenji, University of Tsukuba, for her skillful assistance.

References

  1. Top of page
  2. Abstract
  3. Material and Methods
  4. Results
  5. Discussion
  6. Acknowledgements
  7. References
  • 1
    Friedman SL. Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. J Biol Chem 2000; 275: 22472250.
  • 2
    Reeves HL, Friedman SL. Activation of hepatic stellate cells—a key issue in liver fibrosis. Front Biosci 2002; 7: d808d826.
  • 3
    Reynaert H, Thompson MG, Thomas T, Geerts A. Hepatic stellate cells: role in microcirculation and pathophysiology of portal hypertension. Gut 2002; 50: 571581.
  • 4
    Geerts A. History, heterogeneity, developmental biology, and functions of quiescent hepatic stellate cells. Semin Liver Dis 2001; 21: 311335.
  • 5
    Pinzani M, Gentilini P. Biology of hepatic stellate cells and their possible relevance in the pathogenesis of portal hypertension in cirrhosis. Semin Liver Dis 1999; 19: 397410.
  • 6
    Ramadori G, Saile B. Mesenchymal cells in the liver—one cell type or two? Liver 2002; 22: 283294.
  • 7
    Saile B, Matthes N, Neubauer K, Eisenbach C, El-Armouche H, Dudas J, et al. Rat liver myofibroblasts and hepatic stellate cells differ in CD95-mediated apoptosis and response to TNF-alpha. Am J Physiol Gastrointest Liver Physiol 2002; 283: G435444.
  • 8
    Iredale JP, Benyon RC, Pickering J, McCullen M, Northrop M, Pawley S, et al. Mechanisms of spontaneous resolution of rat liver fibrosis. Hepatic stellate cell apoptosis and reduced hepatic expression of metalloproteinase inhibitors. J Clin Invest 1998; 102: 538549.
  • 9
    Issa R, Williams E, Trim N, Kendall T, Arthur MJ, Reichen Jet al. Apoptosis of hepatic stellate cells: involvement in resolution of biliary fibrosis and regulation by soluble growth factors. Gut 2001; 48: 548557.
  • 10
    Wright MC, Issa R, Smart DE, Trim N, Murray GI, Primrose JN, et al. Gliotoxin stimulates the apoptosis of human and rat hepatic stellate cells and enhances the resolution of liver fibrosis in rats. Gastroenterology 2001; 121: 685698.
  • 11
    Kojima N, Sato M, Imai K, Miura M, Matano Y, Senoo H. Hepatic stellate cells (vitamin A-storing cells) change their cytoskeleton structure by extracellular matrix components through a signal transduction system. Histochem Cell Biol 1998; 110: 121128.
  • 12
    Britton RS, Bacon BR. Intracellular signaling pathways in stellate cell activation. Alcohol Clin Exp Res 1999; 23: 922925.
  • 13
    Iwamoto H, Sakai H, Tada S, Nakamuta M, Nawata H. Induction of apoptosis in rat hepatic stellate cells by disruption of integrin-mediated cell adhesion. J Lab Clin Med 1999; 134: 8389.
  • 14
    Yoshiji H, Kuriyama S, Yoshii J, Ikenaka Y, Noguchi R, Hicklin DJ, Wu Y, et al. Vascular endothelial growth factor and receptor interaction is a prerequisite for murine hepatic fibrogenesis. Gut 2003; 52: 13471354.
  • 15
    Khyrul WA, LaLonde DP, Brown MC, Levinson H, Turner CE. The integrin-linked kinase regulates cell morphology and motility in a rho-associated kinase-dependent manner. J Biol Chem 2004; 279: 5413154139.
  • 16
    Nikolopoulos SN, Turner CE. Integrin-linked kinase (ILK) binding to paxillin LD1 motif regulates ILK localization to focal adhesions. J Biol Chem 2001; 276: 2349923505.
  • 17
    Nikolopoulos SN, Turner CE. Molecular dissection of actopaxin-integrin-linked kinase-Paxillin interactions and their role in subcellular localization. J Biol Chem 2002; 277: 15681575.
  • 18
    Li Y, Yang J, Dai C, Wu C, Liu Y. Role for integrin-linked kinase in mediating tubular epithelial to mesenchymal transition and renal interstitial fibrogenesis. J Clin Invest 2003; 112: 503516.
  • 19
    Liu Y. Epithelial to mesenchymal transition in renal fibrogenesis: pathologic significance, molecular mechanism, and therapeutic intervention. J Am Soc Nephrol 2004; 15: 112.
  • 20
    Issa R, Zhou X, Constandinou CM, Fallowfield J, Millward-Sadler H, Gaca MD, et al. Spontaneous recovery from micronodular cirrhosis: evidence for incomplete resolution associated with matrix cross-linking. Gastroenterology 2004; 126: 17951808.
  • 21
    Knittel T, Armbrust T, Schwogler S, Schuppan D, Ramadori G. Distribution and cellular origin of undulin in rat liver. Lab Invest 1992; 67: 779787.
  • 22
    Greenwel P, Schwartz M, Rosas M, Peyrol S, Grimaud JA, Rojkind M. Characterization of fat-storing cell lines derived from normal and CCl4-cirrhotic livers. Differences in the production of interleukin-6. Lab Invest 1991; 65: 644653.
  • 23
    Miyazaki T, Karube M, Matsuzaki Y, Ikegami T, Doy M, Tanaka N, et al. Taurine inhibits oxidative damage and prevents fibrosis in carbon tetrachloride-induced hepatic fibrosis. J Hepatol 2005.
  • 24
    Ikegami T, Matsuzaki Y, Fukushima S, Shoda J, Olivier JL, Bouscarel B, et al. Suppressive effect of ursodeoxycholic acid on type IIA phospholipase A2 expression in HepG2 cells. HEPATOLOGY 2005; 41: 896905.
  • 25
    Kaneko Y, Kitazato K, Basaki Y. Integrin-linked kinase regulates vascular morphogenesis induced by vascular endothelial growth factor. J Cell Sci 2004; 117: 407415.
  • 26
    Abramoff M, Magelhaes P, Ram S. Image Processing with ImageJ. Biophotonics Int 2004; 11: 3642.
  • 27
    Vouret-Craviari V, Boulter E, Grall D, Matthews C, Van Obberghen-Schilling E. ILK is required for the assembly of matrix-forming adhesions and capillary morphogenesis in endothelial cells. J Cell Sci 2004; 117: 45594569.
  • 28
    Schaefer B, Rivas-Estilla AM, Meraz-Cruz N, Reyes-Romero MA, Hernandez-Nazara ZH, Dominguez-Rosales JA, et al. Reciprocal modulation of matrix metalloproteinase-13 and type I collagen genes in rat hepatic stellate cells. Am J Pathol 2003; 162: 17711780.
  • 29
    Greenwel P, Rubin J, Schwartz M, Hertzberg EL, Rojkind M. Liver fat-storing cell clones obtained from a CCl4-cirrhotic rat are heterogeneous with regard to proliferation, expression of extracellular matrix components, interleukin-6, and connexin 43. Lab Invest 1993; 69: 210216.
  • 30
    Persad S, Attwell S, Gray V, Delcommenne M, Troussard A, Sanghera J, et al. Inhibition of integrin-linked kinase (ILK) suppresses activation of protein kinase B/Akt and induces cell cycle arrest and apoptosis of PTEN-mutant prostate cancer cells. Proc Natl Acad Sci U S A 2000; 97: 32073212.
  • 31
    Troussard AA, Mawji NM, Ong C, Mui A, St -Arnaud R, Dedhar S. Conditional knock-out of integrin-linked kinase demonstrates an essential role in protein kinase B/Akt activation. J Biol Chem 2003; 278: 2237422378.
  • 32
    Zhang X, Li Y, Huang Q, Wang H, Yan B, Dewhirst MW, Li CY. Increased resistance of tumor cells to hyperthermia mediated by integrin-linked kinase. Clin Cancer Res 2003; 9: 11551160.
  • 33
    Berken A, Abel J, Unfried K. beta1-integrin mediates asbestos-induced phosphorylation of AKT and ERK1/2 in a rat pleural mesothelial cell line. Oncogene 2003; 22: 85248528.
  • 34
    Osawa Y, Hannun YA, Proia RL, Brenner DA. Roles of AKT and sphingosine kinase in the antiapoptotic effects of bile duct ligation in mouse liver. HEPATOLOGY 2005; 42: 13201328.
  • 35
    Dekanty A, Giulianelli S, Coso OA, Rudland PS, Jimenez de Asua L. Differential involvement of ERK1–2 and p38MAPK activation on Swiss 3T3 cell proliferation induced by prostaglandin F2alpha. FEBS Lett 2006; 580: 25122516.
  • 36
    Martinez-Hernandez A, Amenta PS. The hepatic extracellular matrix. II. Ontogenesis, regeneration and cirrhosis. Virchows Arch A Pathol Anat Histopathol 1993; 423: 7784.
  • 37
    Friedman SL, Roll FJ, Boyles J, Arenson DM, Bissell DM. Maintenance of differentiated phenotype of cultured rat hepatic lipocytes by basement membrane matrix. J Biol Chem 1989; 264: 1075610762.
  • 38
    Reif S, Lang A, Lindquist JN, Yata Y, Gabele E, Scanga A, et al. The role of focal adhesion kinase-phosphatidylinositol 3-kinase-akt signaling in hepatic stellate cell proliferation and type I collagen expression. J Biol Chem 2003; 278: 80838090.
  • 39
    Yanase M, Ikeda H, Ogata I, Matsui A, Noiri E, Tomiya T, et al. Functional diversity between Rho-kinase- and MLCK-mediated cytoskeletal actions in a myofibroblast-like hepatic stellate cell line. Biochem Biophys Res Commun 2003; 305: 223228.
  • 40
    Yanase M, Ikeda H, Matsui A, Maekawa H, Noiri E, Tomiya T, et al. Lysophosphatidic acid enhances collagen gel contraction by hepatic stellate cells: association with rho-kinase. Biochem Biophys Res Commun 2000; 277: 7278.
  • 41
    Yanase M, Ikeda H, Matsui A, Noiri E, Tomiya T, Arai M, et al. HMG-COA reductase inhibitor modulates collagen GEL-contraction by hepatic myofibroblast-like stellate cell line: involvement of geranylgeranylated proteins. Comp Hepatol 2004; 3(Suppl 1): S21.
  • 42
    Geerts A, Lazou JM, De Bleser P, Wisse E. Tissue distribution, quantitation and proliferation kinetics of fat-storing cells in carbon tetrachloride-injured rat liver. Hepatology 1991; 13: 11931202.
  • 43
    Troussard AA, Tan C, Yoganathan TN, Dedhar S. Cell-extracellular matrix interactions stimulate the AP-1 transcription factor in an integrin-linked kinase- and glycogen synthase kinase 3-dependent manner. Mol Cell Biol 1999; 19: 74207427.
  • 44
    Brembeck FH, Rosario M, Birchmeier W. Balancing cell adhesion and Wnt signaling, the key role of beta-catenin. Curr Opin Genet Dev 2006; 16: 5159.
  • 45
    Bachar-Dahan L, Goltzmann J, Yaniv A, Gazit A. Engrailed-1 negatively regulates beta-catenin transcriptional activity by destabilizing beta-catenin via a GSK-3beta-independent pathway. Mol Biol Cell 2006; 17: 25722580.
  • 46
    Wang F, Weaver VM, Petersen OW, Larabell CA, Dedhar S, Briand P, et al. Reciprocal interactions between beta1-integrin and epidermal growth factor receptor in three-dimensional basement membrane breast cultures: a different perspective in epithelial biology. Proc Natl Acad Sci U S A 1998; 95: 1482114826.
  • 47
    Sastry SK, Lakonishok M, Wu S, Truong TQ, Huttenlocher A, Turner CE, et al. Quantitative changes in integrin and focal adhesion signaling regulate myoblast cell cycle withdrawal. J Cell Biol 1999; 144: 12951309.
  • 48
    Ishii T, Satoh E, Nishimura M. Integrin-linked kinase controls neurite outgrowth in N1E-115 neuroblastoma cells. J Biol Chem 2001; 276: 4299443003.
  • 49
    Zervas CG, Gregory SL, Brown NH. Drosophila integrin-linked kinase is required at sites of integrin adhesion to link the cytoskeleton to the plasma membrane. J Cell Biol 2001; 152: 10071018.
  • 50
    Chang ML, Chen JC, Alonso CR, Kornblihtt AR, Bissell DM. Regulation of fibronectin splicing in sinusoidal endothelial cells from normal or injured liver. Proc Natl Acad Sci U S A 2004; 101: 1809318098.