Molecular characterization of the role of orphan receptor small heterodimer partner in development of fatty liver

Authors


  • Potential conflict of interest: Nothing to report.

Abstract

The orphan receptor Small Heterodimer Partner (SHP, NROB2) regulates metabolic pathways, including hepatic bile acid, lipid, and glucose homeostasis. We reported that SHP-deletion in leptin-deficient OB−/− mice increases insulin sensitivity, and prevents the development of fatty liver. The prevention of steatosis in OB−/−/SHP−/− double mutants is not due to decreased body weight but is associated with increased hepatic very-low-density lipoprotein (VLDL) secretion and elevated microsomal triglyceride transfer protein (MTP) mRNA and protein levels. SHP represses the transactivation of the MTP promoter and the induction of MTP mRNA by LRH-1 in hepatocytes. Adenoviral overexpression of SHP inhibits MTP activity as well as VLDL-apoB protein secretion, and RNAi knockdown of SHP exhibits opposite effects. The expression of SHP in induced in fatty livers of OB−/− mice and other genetic or dietary models of steatosis, and acute overexpression of SHP by adenovirus, result in rapid accumulation of neutral lipids in hepatocytes. In addition, the pathways for hepatic lipid uptake and lipogenic program are also downregulated in OB−/−/SHP−/− mice, which may contribute to the decreased hepatic lipid content. Conclusion: These studies demonstrate that SHP regulates the development of fatty liver by modulating hepatic lipid export, uptake, and synthesis, and that the improved peripheral insulin sensitivity in OB−/−/SHP−/− mice is associated with decreased hepatic steatosis. (HEPATOLOGY 2007.)

The metabolic syndrome is a cluster of obesity-associated metabolic disorders that are highly prevalent in Western societies and represent major risk factors for cardiovascular disease.1 Among these is nonalcoholic fatty liver disease (NAFLD), a condition comprising a spectrum of liver pathological conditions ranging from steatosis alone to non-alcoholic steatohepatitis (NASH).2 Many factors may contribute to the accumulation of hepatocellular fat, but insulin resistance often has been associated with accumulation of fat in the liver.3 Conversely, fatty liver has been described as a risk factor for development of insulin resistance that is independent of overall body weight.4, 5

Like diabetes, NAFLD is a polygenic disease affected by a combination of environmental and genetic factors, with disease pathogenesis related to multiple “hits.”6 Potential candidate genes contributing to NAFLD include those involved in fat deposition, insulin sensitivity, and hepatic lipid oxidation, synthesis, storage, and export. In both animal models and humans, impaired very-low-density lipoprotein (VLDL) secretion can result in fatty liver.7, 8 Microsomal triglyceride transfer protein (MTP) is critical for the hepatic synthesis and secretion of VLDL, and frame-shift mutations in this gene are associated with abetalipoproteinemia in patients.9 MTP polymorphisms that decrease expression increase the risk of NAFLD.10

Nuclear receptors that regulate lipid metabolism in the liver are potential contributors to fatty liver. Thus, increased activity of peroxisome proliferator-activated receptors (PPARγ) has been directly associated with fatty liver formation.11 Small heterodimer partner (SHP) is a unique orphan receptor that physically interacts with a variety of other nuclear receptors and negatively regulates their transcriptional activity.12, 13 Studies with SHP−/− mice and transgenic lines expressing SHP in the liver have identified multiple regulatory roles for this orphan in metabolic pathways in the liver,14–16 energy balance in brown fat,17 and in glucose homeostasis.18 In particular, SHP deletion has been reported to decrease,15, 17 and sustained hepatic expression has been reported to increase, hepatic lipid accumulation.16 However, the underlying mechanism for how SHP regulates fatty liver remains unknown. To examine the role of SHP in an aggressive model of fatty liver, SHP−/− mice were bred with obese leptin-deficient OB−/− mice. Disruption of SHP in the OB−/− background (OB−/−/SHP−/−) improves brown fat function but does not overcome obesity. However, the OB−/−/SHP−/− mice exhibit markedly decreased steatosis and improved insulin sensitivity. This report for the first time elucidated the molecular basis for the role of SHP in development of fatty liver.

Abbreviations

DMEM, Dulbecco's minimum essential medium; HDL, high-density lipoprotein; MTP, microsomal triglyceride transfer protein; NAFLD, non-alcoholic fatty liver disease; PPARγ, peroxisome proliferator-activated receptors; RT, reverse transcription; SHP, Small Heterodimer Partner; TG, triglyceride; VLDL, very-low-density lipoprotein; WT, wild-type; UCP, uncoupling protein.

Materials and Methods

Animals.

SHP-deficient mice were generated with a mixed C57BL/129sv hybrid background.14 They were backcrossed with C57BL mice to the 10th generation with >99.99% pure C57BL background. The heterozygous leptin-deficient OB+/− mice (Jackson laboratory) were crossed with SHP+/− mice to generate OB+/−SHP+/− mice, which were further crossed with each other to generate OB+/+SHP+/+ (i.e., SHP+/+), OB+/+SHP−/− (i.e., SHP−/−), OB−/−SHP+/+ (i.e., OB−/−), and OB−/−SHP−/− mice. For genotyping of OB−/− or OB−/−/SHP−/− mice, specific primers 5′-TGTCCAAGATGGACCAGACTC and 5'′ACTGGTCTGAGGCAGGGAGCA were used. The PCR reactions were enzyme digested by DdeI, electrophoresed, and bands of three different sizes visualized. Mice were fed a standard rodent chow (Test Diet No. 5001) and water ad libitum in temperature-controlled (23°C) and virus-free facilities. Age-matched and sex-matched groups of 2-month-old mice were used unless otherwise indicated. On the day before being killed, mice were subjected to fasting overnight, and blood was collected. Pancreas, liver, and adipose tissues were removed and fixed for histological analysis, or snap frozen in liquid nitrogen and stored at −80°C until use. All protocols for animal use were approved by the Animal Care Committee at University of Kansas Medical Center and Baylor College of Medicine.

Histology and Immunohistochemistry.

All methods are described elsewhere.15, 17 Livers were fixed, dehydrated, embedded in paraffin, sectioned (4 μm), and stained with Harris hematoxylin-eosin (Sigma). For oil red O staining, frozen tissue sections were used. Brown adipose tissue and white adipose tissue were isolated and stained. Oil red O staining of hepatocytes was performed following the standard procedure.19

Serum and Tissue Chemistry, RNA and Protein Analysis.

All the methods were described elsewhere.17, 18 Briefly, serum or plasma was prepared and stored at −20°C. Enzymatic assay kits were used for the determination of non-esterified fatty acids (NEFA C, Wako), glucose, cholesterol, and triacylglycerol (Sigma). Serum insulin was measured using RIA (Crystal Chem). Plasma lipoprotein profile was analyzed by fast protein liquid chromatography. Total RNA was isolated using Tri-reagent (Invitrogen) for northern blotting. All cDNA probes were prepared by reverse transcription (RT)-PCR using appropriate primers (available on request). Western blotting was performed following standard procedures.

In Vivo Glucose Kinetics.

Glucose tolerance test and insulin tolerance test have been described elsewhere.18 Hyperinsulinemic euglycemic clamp study was performed using chronically cannulated mice. All groups of mice were fasted 6 to 8 hours before the experiment. Body weight and general appearance were used as indices of health. A variable infusion of 50% glucose was used to raise blood glucose levels to approximately 300 mg/dl. A 4-μCi bolus of tracer ([3-3H]glucose, NEN Life Science) was given at −100 minutes, followed by a constant 0.04 μCi/min for the duration of the study. The glucose turnover rate (mg/kg/min) was calculated as the rate of tracer infusion (dpm/min) divided by the blood glucose specific activity (dpm/mg) corrected to the body weight of the mouse.

Hepatocyte Culture, Adenoviral Transduction, RNA Interference.

Primary hepatocytes were isolated, infected the next day with viral supernatant at different multiplicities of infection for 2 hours, or transfected with SHP-RNAi.17 Gene expression was analyzed by Northern blot or semi-quantitative RT-PCR. In some cases, cells were transfected with expression plasmids as indicated.

Transient Transfection, In Vitro DNA Binding, Chip Assay.

All the methods have been described elsewhere.17 Various MTP promoter deletion constructs were generated. Mutagenesis was performed with the Exsite PCR-based site directed mutagenesis (Stratagene). For luciferase assays, HepG2 cells were used with Fugene-6 (Roche) and luciferase activity normalized against β-galactosidase activity (Promega). For in vitro DNA binding assay, the in vitro translated LRH-1 (Promega) was incubated with 32P-labeled duplex oligonucleotide probe, and DNA–protein complexes were resolved by electrophoresis. For Chip assay, primary hepatocytes or HepG2 cells were used and chromatin cross-linked, immunoprecipitated with rabbit anti-SHP or anti-LRH-1 antibodies,16 with rabbit normal IgG as negative control.

VLDL Production, Triglyceride Clearance, Lipase Activity.

In vivo VLDL production was measured in overnight-fasted mice intravenously injected with Tyloxapol. The clearance rate of exogenous triglycerides (TGs) was measured in mice fasted for 4 hours, and gavaged with olive oil (400 μl). Lipase activities were determined in post-heparin plasma purified from overnight-fasted mice intravenously injected with heparin. Hepatic lipase (Research Diagnosis), lipoprotein lipase (Roar Biomedical), and endothelial lipase (Marker Gene Technologies) kits were used to quantify TG hydrolysis. A fluorometer (360 excitation [Ex] nm and 460 nm emission [Em] wavelength) was used for these assays.

Metabolic Labeling of apoB and MTP Activity Assay in Hepatocytes.

The apoB pulse/chase labeling experiment was performed in hepatocytes.20 Briefly, primary hepatocytes were isolated and cultured overnight. The next day, the medium was replaced by Dulbecco's minimum essential medium (DMEM) containing 10% fetal bovine serum, 0.75 mM oleate, and 25 mM glycerol. After 20 hours, the medium was removed and the cells were washed 3 times with Hank's balanced sat solution buffer. The cells were pulsed with methionine- and cysteine-free DMEM containing 150 mCi/dish Express-35S–labeling mix (NEN) for 2 hours. After the 2-hour pulse, radioactivity was chased for 4 hours in DMEM. The chase medium was collected, and the cells were washed several times with Hank's balanced salt solution. Apob was immunoprecipitated from the medium samples with a polyclonal anti-apoB antibody (Biodesign). After immunoprecipitation, the apoB proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and exposed by autoradiography.

The MTP activity assay has been described elsewhere.21 In brief, primary hepatocytes were infected with SHP-virus or SHP-RNAi, washed with phopsphate-buffered saline, and then swelled in hypotonic buffer (1 mM Tris-Cl, pH 7.4, 1 mM MgCl2, and 1 mM EGTA). The cells were scraped and homogenized, the lysates centrifuged, and supernatants used for protein determination and MTP transfer assay using a kit (Chylos).

Statistics.

Data were analyzed using one-way ANOVA, followed by Student t test. P < 0.01 was considered significant.

Results

SHP Deficiency Alters Brown Fat Function But Not Obesity in OB−/− Mice.

The OB−/− genetic background causes severe obesity, diabetes, and fatty liver. To assess the impact of SHP on these pathologies, we generated OB−/−/SHP−/− (double null) mice. Loss of SHP was not sufficient to overcome the obesity caused by leptin deficiency. A small but not significant decrease was seen in body weight for OB−/−/SHP−/− mice compared with OB−/− mice in both sexes (Supplemental Fig. 1A, B) that was primarily attributable to decreased liver weight. The weights of different white fat and adipocyte size did not differ between the two genotypes (Supplemental Fig. 1C-G). Brown fat mass was decreased in OB−/−/SHP−/− mice (Supplemental Fig. 2A), apparently as a result of smaller brown adipocytes containing less lipid (Supplemental Fig. 2B). Uncoupling protein-1 (UCP-1) mRNA was significantly increased (Supplemental Fig. 2C), supporting the negative role of SHP in energy production.17 Because no marked differences were observed between males and females, subsequent studies were performed on male mice.

SHP Deficiency Improves Insulin Sensitivity in OB−/− Mice.

To initially evaluate glucose homeostasis in the OB−/−/SHP−/− double mutants, serum glucose and insulin concentrations were compared with those of OB−/− mice. Both non-fasting and fasting (F) glucose levels were comparable in mice of both genotypes, and loss of SHP did not affect serum insulin levels (Fig. 1A). However, OB−/−/SHP−/− mice cleared glucose more rapidly than OB−/− animals in the glucose tolerance test, indicating improved insulin sensitivity (Fig. 1B). After insulin administration (insulin tolerance test), blood glucose levels of OB−/−/SHP−/− mice were also lower than OB−/− littermates (Fig. 1B). The hyperinsulinemic-euglycemic clamp was employed to more critically assess insulin sensitivity in OB−/−/SHP−/− mice. Baseline glucose production was lower in OB−/−/SHP−/− mice (not shown), and insulin infusion reduced it by 65% as compared with OB−/− littermates (Fig. 1C), suggesting increased hepatic insulin sensitivity. The rate of glucose infusion was approximately 40% higher in OB−/−/SHP−/− mice (Fig. 1D), demonstrating enhanced whole-body insulin sensitivity. Consistently, whole-body glucose disposal rate stimulated by insulin was 20% higher in OB−/−/SHP−/− mice (Fig. 1E).

Figure 1.

SHP-deficiency improves insulin sensitivity in OB−/− mice. (A) Serum glucose and insulin levels under nonfasting and fasting conditions in OB−/− and OB−/−/SHP−/− mice (n = 8-12). (B) Glucose and insulin tolerance tests (glucose tolerance test and insulin tolerance test) were performed in mice fasted for 16 and 4 hours, respectively (n = 8-10). (C-E) Hyperinsulinemic euglycemic clamp was performed in mice fasted for 6 hours (n = 4). All values are means ± SEM.

SHP Deficiency Prevents Fatty Liver Development in OB−/− Mice.

Liver is a major site of both SHP expression and glucose metabolism. As expected, livers of OB−/− mice were significantly enlarged and pale in appearance, typical of fatty liver (Fig. 2A). In contrast, OB−/−/SHP−/− livers were much smaller and appeared normal (Supplemental Table 1 and Fig. 2A-C). Abundant lipid vacuoles were present in OB−/− hepatocytes, but to a much lesser degree in OB−/−/SHP−/− liver (Fig. 2B). Quantitation of liver TG and free fatty acid content revealed 85% and 56% reductions in OB−/−/SHP−/− liver, respectively (Fig. 2D, E). No significant differences were observed for hepatic cholesterol content or the levels of serum cholesterol or free fatty acid in the two groups (data not shown). These dramatic effects of the loss of SHP in the OB−/− background contrast with the normal liver size and lipid composition observed in 2-month-old SHP−/− livers relative to wild-type under normal circumstances14 but are consistent with both the decreased neutral lipid accumulation in older SHP−/− mice fed high-cholesterol and high-fat diets15, 17 and the increased lipid accumulation in transgenic mice overexpressing SHP in the liver.16

Figure 2.

SHP-deficiency prevents fatty liver in OB−/− mice. (A) Gross morphology of liver. The liver of OB−/− mouse looks pale and is markedly enlarged, typical of fatty liver. Note that the fatty liver is markedly diminished in the OB−/−/SHP−/− mice. (B) Histological analysis of liver by HE staining in OB−/− and OB−/−/SHP−/− mice (n = 3). One representative image is shown. (C) Ratio of liver weight to body weight of OB−/− and OB−/−/SHP−/− mice (n = 15). (D, E) Liver TG and free fatty acid contents were determined in liver extracts of OB−/− and OB−/−/SHP−/− mice (n = 10-12). All above values are means ± SEM. (F) The expression of SHP in mouse models with fatty liver, induced by genetic factors (OB−/− and KKAy mice, 2 months), or by high-sucrose and high-fat diets (2-month-old mice fed either chow, high sucrose, or high fat diet for 2 months). Total RNA was isolated, and equivalent amounts were pooled (n = 5) and hybridized with the indicated 32P-labeled cDNA probes by Northern blot. W, SHP+/+; S, SHP−/−; O, OB−/−; OS, OB−/−/SHP−/−; C, control, lean C57BL/6J mice. (G) Neutral lipids with oil red O staining of SHP+/+primary hepatocytes after SHP-virus transduction or SHP-RNAi transfection. Shown are phase-contrast images of hepatocytes taken at 20× magnification.

To further examine the association of SHP with fatty liver, we analyzed SHP expression in OB−/− and other steatotic mouse models. SHP mRNA was markedly increased in OB−/− livers (O) relative to wild-type (W) and also those of KKAy mice, as well as in the fatty livers of mice fed high sucrose or high fat diets (Fig. 2F), suggesting a pathophysiological response of SHP to the state of steatosis. Consistent with this, adenoviral overexpression of SHP in primary hepatocytes increased neutral lipid accumulation, as indicated by oil red O staining, while decreasing SHP expression via RNA interference decreased staining (Fig. 2G).

Surprisingly, serum TG levels were elevated in OB−/−/SHP−/− mice relative to OB−/− mice (Fig. 3A). This could be attributable to either decreased catabolism or increased lipoprotein production. In initial studies of dietary lipid accumulation following administration of olive oil by oral gavage, loss of SHP increased the accumulation of serum TG in both OB−/−/SHP−/− mice and SHP−/− mice (Fig. 3B), indicative of slower clearance. To assess the role of hepatic lipid export, we measured VLDL production after injecting tyloxapol, which inhibits lipoprotein lipase and prevents lipoprotein clearance. The loss of leptin function resulted in dramatically decreased serum TG accumulation in the OB−/− mice relative to wild-type or SHP−/− mice, and this was partially reversed by the additional loss of SHP function (Fig. 3C). The changes of VLDL production parallel the changes of plasma apoB protein levels (Fig. 3C, top). However, a decrease,22, 23 increase,24 or no change25 in VLDL secretion have also been reported in OB−/− mice, and the reason for the discrepant observations is unknown. Nevertheless, SHP deletion led to both slower TG clearance and higher rates of hepatic lipid secretion, which may be associated with the increased serum TG levels in OB−/−/SHP−/− mice.

Figure 3.

SHP-deficiency changes lipoprotein metabolism in OB−/− mice. (A) Serum TG was measured in nonfasting and overnight-fasted mice (n = 10-15). (B) Measurement of serum TG after gavage with oil. The clearance rate of exogenous TG was measured in mice fasted for 4 hours (n = 8-10). (C) Measurement of VLDL export. Overnight-fasted mice of each genotype (n = 10) were intravenously injected with tyloxapol, and serum TGs were examined. Upper panel shows the apoB protein levels in the plasma of each genotype determined by Western blot. All values are means ± SEM (*P < 0.01; **P < 0.001). (D, E) Distribution of triglyceride (TG) and cholesterol (Chol) within the plasma lipoproteins. Plasma (200 μl) was pooled from five mice of each genotype after a 4-hour fast and fractionated on a fast protein liquid chromatography column. The sum of triglyceride and cholesterol levels in the VLDL, LDL, and HDL fractions are presented. (F-H) Measurement of lipoprotein lipase activities and hormone sensitivity lipase (HSL) expression. Overnight-fasted mice of each genotype (n = 10) were intravenously injected with heparin, and post-heparin plasma was subjected to lipase assays. Values are mean ± SEM. HSL expression was determined by semiquantitative PCR analysis.

To characterize lipoprotein composition, fast protein liquid chromatography analysis was performed. The elution profile by TG content revealed that leptin-deficiency markedly reduced serum VLDL-TG (Fig. 3D), consistent with decreased VLDL-export (Fig. 3C). Loss of SHP modestly increased VLDL-TG as compared with controls (SHP+/+ vs. SHP−/−, OB−/− vs. OB−/−/SHP−/−). Elution profiles determined by cholesterol content revealed that leptin-deficiency led to the appearance of an additional particle (HDL1) with intermediate size between HDL2 and LDL peaks (Fig. 3E), which was also seen in hepatic lipase−/−,26 HNF-1α −/−,27 and apoA-I−/−28 mice. Loss of SHP function resulted in a further increase in HDL2 but a decrease in HDL1 cholesterol.

Lipases play a critical role in lipoprotein clearance, but lipoprotein lipase activity was not affected by loss of SHP (not shown). Hepatic lipase activities were increased in SHP-deleted mice (Fig. 3F), which may be a result of the loss of SHP repression through farnesoid X receptor.29 Therefore, it cannot account for higher high-density lipoprotein (HDL) levels in the animals, as increased hepatic lipase promotes uptake of HDL to the liver.30 Endothelial lipase activities were reduced in OB−/− mice, and further diminished in SHP−/− and OB−/−/SHP−/− mice (Fig. 3G), which may in part account for the increased HDL in SHP mutants.31 The expressions for hormone-sensitive lipase were undetectable in lean SHP+/+ and SHP−/− livers, but were elevated in obese OB−/− and OB−/−/SHP−/− mice (Fig. 3H).

Mechanism of Decreased Fatty Liver in OB−/−/SHP−/− Mice.

Given the changes in lipid and lipoprotein profiles resulting from SHP disruption, we explored the hepatic expression of a wide set of genes involved in lipid metabolism in wild-type (WT), SHP−/− (S), OB−/− (O), and OB−/−/SHP−/− (OS) mice. These genes could be grouped into several categories based on their responses in the various genotypes (Fig. 4). Thus, ApoAII, ABCA1, and LDL receptor were not markedly affected by loss of either gene. ApoAIV was markedly upregulated in both OB−/− strains but was not dependent on SHP. ApoAV and apoE showed an opposite response, being upregulated in both SHP−/− strains but not dependent on leptin. MTP and apoB also showed a primary response to loss of SHP, but with a modest decrease in both OB−/− strains. PPARγ, along with SREBP-1c and its downstream targets FAS and SCD-1, showed responses to both genes that correlated with fatty liver: up in OB−/−, but decreased in OB−/−/SHP−/− mice. A number of additional genes showed other responses, with apoAI, apoCI, apoCII, apoM, and SR-BI decreasing substantially in the fatty OB−/− livers and showing at least some relative increase in both SHP−/− strains. In contrast, the loss of either SHP or leptin resulted in increased apoCIII expression. Hepatic UCP-1 was slightly higher in SHP−/− mice, but not in OB−/−/SHP−/− mice. In contrast, UCP-2 mRNAs exhibited opposite expression pattern as compared with UCP-1 (Supplemental Fig. 3A). In genes involved in fatty acid oxidation, including PPARα, AOX, and CPT-1, their expressions did not differ markedly in OB−/− and OB−/−/SHP−/− mice (Supplemental Fig. 3B).

Figure 4.

The effect of SHP-deficiency on hepatic gene expression in OB−/− mice. The expression of genes in lipoprotein synthesis, catabolism, uptake, and in lipid export, uptake, and synthesis. Total RNA was isolated from each mouse, and equivalent amounts were pooled (n = 5-7) and hybridized with the indicated 32P-labeled cDNA probes by Northern blot. W, SHP+/+; S, SHP−/−; O, OB−/−; OS, OB−/−/SHP−/−. The undetectable levels for PPARγ and SREBP-1 in WT mice are due to short exposure time.

These patterns of expression, which are generally consistent with the opposite effects of transgenic SHP overexpression,16 indicate that the decreased fatty liver in the OB−/−/SHP−/− mice is a consequence of both increased VLDL production due to increased MTP expression, and decreased lipid uptake and de novo lipogenesis, associated with decreased expression of PPARγ, SREBP-1c, and downstream targets.

SHP Regulation of MTP Expression.

Of the potential SHP target genes identified by these expression studies, MTP is of particular interest because of its important role in lipoprotein assembly and secretion.32 Thus, the expression of MTP protein was examined by Western blotting.33 Basal MTP protein levels were increased in both SHP−/− and OB−/−/SHP−/− livers, as compared with SHP+/+or OB−/− controls (Fig. 5A). Similar changes were observed for apoB and apoE proteins (Fig. 5A). To further elucidate the molecular basis for direct SHP regulation of MTP expression and function, primary hepatocytes of WT and SHP−/− mice were used in subsequent studies. The basal levels of cellular MTP protein and apoB protein secreted in the culture medium were also increased in SHP−/− hepatocytes. As a more critical determinant of VLDL production, levels of MTP activity were assayed in WT or SHP−/− primary hepatocytes, and SHP levels were also acutely modulated using adenoviral SHP overexpression or RNA interference. MTP activity was increased in SHP−/− relative to WT hepatocytes (Fig. 5B). MTP activity was also decreased by SHP overexpression in both WT and SHP−/− hepatocytes, but was increased by SHP RNAi in the WT cells. Consistent with the change of MTP activity, apoB secretion was also reduced by SHP virus but increased by SHP RNAi (Fig. 5C).

Figure 5.

SHP regulation of VLDL secretion in hepatocytes. (A) Illustrating MTP, apoB, and apoE protein levels in livers from groups (n = 3-5) of SHP+/+ (W), SHP−/− (S), OB−/− (O), and OB−/−/SHP−/− (OS) mice, MTP proteins in hepatocytes, and VLDL-apoB proteins secreted from hepatocytes. MTP protein levels were assayed by immunoprecipitation of whole cell proteins using anti-MTP antibody followed by Western blot. For metabolic labeling of apoB, the cells were pulsed with 35S-methionine for 2 hours, and secretion of radiolabel was chased for 4 hours in DMEM. ApoB was immunoprecipitated from the media with a polyclonal anti-apoB antibody, separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis. (B, C) Cell autonomous effect of SHP on VLDL production in hepatocytes, as determined by MTP activity (B) and VLDL-apoB protein secretion (C). Primary mouse hepatocytes were transduced with GFP (G) and SHP (S)-adenovirus, or transfected with GFP (G) and SHP (S)-RNAi. MTP activities of cells were assayed using MTP transfer assay as described in the experimental procedures. Values are means ± SEM (n = 5-7). ApoB proteins were assayed from the media after cells were pulse/chase labeled with 35S-methionine [35S-Met/Cys] as described. Fold changes of apoB protein level were quantified by phosphoimage. Levels of SHP proteins were assayed by Western blot using anti-SHP antibody. The relative poor quality is attributable to lack of good SHP antibody.

SHP has been reported to suppress MTP expression,34 but the molecular basis is unclear. Thus, we searched the MTP promoter for nuclear receptor response elements and identified several potential binding sites for LRH-1, which is a potent target for SHP repression. A series of constructs with serial deletions of the 5′-flanking region of the mouse MTP promoter showed fourfold to five fold induction in response to LRH-1 cotransfection in HepG2 cells, which was lost with the shortest −109 construct (Fig. 6A). As expected, the response of the −475MTP-Luc and −170MTP-Luc constructs to LRH-1 was dose dependent and was strongly repressed by SHP coexpression (Fig. 6B). Mutations were introduced singly and in combination into three potential LRH-1 elements within this proximal promoter region, which were designated L1, L2, and L3 (mut1 to mut5) (Fig. 6C). Inactivation of L1 (mut1) did not alter MTP promoter activity, whereas inactivation of either the L2 (mut2) or L3 (mut3) sites decreased it, with L2 being more potent than L3. Addition of the L1 mutation to the L3 mutation had no effect, but the combination of L2 and L3 (mut5) further decreased LRH-1 responsiveness by 60% to 80%. Thus, both L2 and L3 are important for LRH-1 regulation of MTP gene expression.

Figure 6.

Transrepression of MTP by SHP. (A) Transient transfection assays with mouse MTP (mMTP)-Luc deletion constructs in HepG2 cells in the presence of mouse LRH-1 (mLRH-1) expression plasmid. The experiments were repeated three times with similar results, and one representative result is shown. (B) HepG2 cells were transiently transfected with a reporter construct containing 475 bp and 170 bp mMTP promoter Luc together with mLRH-1 in the absence or presence of mouse SHP (mSHP) expression vector. (C) Mutagenesis assay. The three putative LRH-1 sites were mutated using PCR-based site-directed mutagenesis. Transient transfection assay was performed in HepG2 cells with mutated mMTP Luc together with mLRH-1 expression vector. (D) Gel shift assay. Specific binding of mLRH-1 to the potential LRH-1 element located at -160bp in the proximal mMTP promoter. Competitor oligonucleotides: L2, mut (L2 mutant), and pos (positive control, LRH-1 site in the CYP7A promoter). (E) ChIP assay. Cross-linked chromatin of HepG2 cells transfected with -475mMTP-Luc, together with mSHP or mLRH-1 expression vectors, was precipitated with anti-mSHP, anti-mLRH-1 antibodies, or IgG as indicated, with primers amplifying the proximal LRH-1 binding sequence. Similar results were also obtained by using the −237mMTP and −170mMTP-Luc, and by using mouse primary hepatocytes. M, DNA marker. (F) Cell autonomous overexpression of SHP on MTP mRNA. Primary SHP−/− hepatocytes were infected with a control virus expressing GFP (G) or SHP (S) for 2 hours at multiplicities of infection of 10 and 50. Cells were allowed to grow for additional 2 days, and RNA was isolated for Northern blot. (G) Cell autonomous knockdown of SHP on MTP mRNA. Primary SHP+/+ hepatocytes were transfected with control GFP (G) or SHP siRNA (S). Cells were grown for additional 2 days, and RNA was isolated for semi-quantitative RT-PCR analysis. (H) Primary SHP+/+hepatocytes were co-transfected with mSHP and/or mLRH-1 expression plasmids. Cells were grown for additional 2 days, and RNA was isolated for semi-quantitative RT-PCR analysis. For all transfection: Luciferase activity was normalized against β-galactosidase activity and was expressed as fold induction. Each value represents mean of four independent experiments ± SEM.

These results were confirmed by direct binding using electrophoretic mobility shift assays. As expected, LRH-1 did not bind to the L1 duplex oligonucleotide. In contrast, recombinant LRH-1 bound well to a probe containing the L2 site. This binding was specifically competed by the unlabeled L2 oligonucleotide, but not by the mutant L2 oligonucleotide (Fig. 6D). LRH-1 binding was also specifically competed by the LRH-1 site from the CYP7A promoter (pos). In addition, the L3 site showed relatively weaker binding to LRH-1 than the L2 site (not shown).

Chromatin immunoprecipitation was used to examine the occupancy of the MTP promoter by SHP and LRH-1 in HepG2 cells. A proximal MTP promoter fragment (−475MTP-Luc), but not a negative control fragment containing no LRH-1 site (not shown), could be specifically immunoprecipitated by antibodies to either receptor (Fig. 6E).

To critically test the direct effect of SHP on MTP gene expression, primary hepatocytes from SHP−/− mice were transduced with SHP expressing adenovirus. This SHP overexpression resulted in decreased levels of MTP, LRH-1, and apoB transcripts (Fig. 6F), compared with green fluorescent protein virus. Conversely, knockdown of SHP by RNA interference in SHP+/+ hepatocytes markedly increased MTP mRNA (Fig. 6G). To further confirm the counter-regulatory effects of SHP and LRH-1 on MTP expression, SHP+/+ hepatocytes were transfected with SHP and/or LRH-1 expression plasmids. SHP overexpression caused a significant reduction, whereas LRH-1 resulted in approximately twofold induction in MTP mRNA, compared with control cells (Fig. 6H). Co-expression of SHP and LRH-1 reduced MTP mRNA below the basal level, indicating that SHP effectively inhibited LRH-1–stimulated MTP expression. In addition, apoE mRNA was also repressed by SHP virus but increased by SHP RNAi (Supplemental Fig. 3C), suggesting direct SHP regulation.

Discussion

Liver TG levels are a reflection of the balance of complex processes of input, output, synthesis, and oxidation of fatty acids. In leptin-deficient OB−/− mice, this balance is tipped toward TG accumulation and fatty liver. In mice lacking both leptin and SHP, however, enhanced lipid secretion (MTP) as well as decreased de novo fatty acid synthesis (SREBP-1c and FAS) and uptake (PPARγ) shift the balance toward fat depletion. The markedly decreased lipid accumulation in the OB−/−/SHP−/− livers is associated with improved insulin sensitivity. This is likely to be attributable to both beneficial effects of the decreased lipid levels on hepatic glucose metabolism and the improved insulin sensitivity associated with loss of SHP function.18

This shift is associated with altered expression of many genes involved with lipid metabolism. Among these, the association of the increase in hepatic VLDL export with an increase in MTP mRNA in the SHP−/− livers was particularly interesting. In patients suffering from hepatic steatosis associated with genetic abetalipoproteinemia, defective hepatic VLDL production is correlated with decreased MTP activity,35 and inhibition of MTP by specific antagonists increases liver lipid content.36 A recent report showed that increased expression of MTP and VLDL secretion by the transcription factors Foxa2/Pgc-1beta decreased hepatic TG content in livers of ob/ob mice.20 Thus, a concomitant increase in MTP mRNA, protein and activity should facilitate the removal of excess lipid stores from the liver. Previous results suggested activation of MTP promoter by HNF4α. However, SHP was not found in inhibition of HNF4α transactivation on MTP in a previous34 and this study (not shown). In addition, we did not observe changes of HNF4α mRNA in SHP−/− and OB/SHP−/− livers as compared with their littermates, although SHP was reported to be a negative regulator for HNF4α.37 These observations suggest that HNF4α is unlikely the intermediate factor by which SHP regulates MTP transcription. We found that the orphan receptor LRH-1 can also bind to the MTP promoter and increase MTP expression in hepatocytes, and that this transactivation is repressed by SHP. Along with these promoter studies, both chromatin immunoprecipitation and the effects of acute modulation of SHP levels confirm that SHP is a direct transrepressor of MTP expression. The functional relevance of this regulation is underscored by the increased MTP protein, MTP activity, and VLDL-apoB secretion in SHP−/− hepatocytes. The mRNA for apoB is also upregulated in SHP-deleted livers, which could be attributable to an indirect effect of MTP or a direct effect of SHP. The increased apoB is also likely to contribute to the increased VLDL export.

PPARγ is another important regulatory factor that has been associated with steatosis, and the marked reduction of PPARγ expression in SHP−/−18 and OB−/−/SHP−/− livers (this study) is consistent with the observation that liver-specific deletion of PPARγ results in reduced steatosis.11 Increased PPARγ expression was observed in the SHP transgenics,16 and acute PPARγ overexpression results in marked lipid accumulation.38 Although previous results have linked SHP to PPARγ function by suggesting that it does not inhibit, but augments PPARγ transactivation,39 the direct effects of SHP on hepatic PPARγ expression remain to be determined.

SREBP-1c plays an important role in regulating lipogenic program in the liver and is also a SHP target.40 Unexpectedly, decreased, but not increased hepatic SEBP-1c mRNA was observed in OB−/−/SHP−/− mice. This suggests that in vivo SREBP-1 signaling is more dominantly regulated by factors other than SHP. The parallel upregulation of PPARγ and SREBP-1c in human SHP transgenic mice,16 and parallel downregulation of PPARγ and SREBP-1c in OB−/−/SHP−/− mice, suggests that the decreased SREBP-1c may be a secondary effect of decreased PPARγ. This is supported by a recent report that overexpression of PPARγ strongly induces SREBP-1c and lipogenesis in hepaocytes.19

The protective effects of the loss of SHP described here and previously15, 17 are generally consistent with the opposite consequences of increased SHP expression. Thus, we found that SHP expression is increased in OB−/− livers and in other mouse models of steatosis, and that acute SHP overexpression in cultured hepatocytes increases lipid accumulation. These results are consistent with the lipid accumulation observed in the livers of transgenic mice with increased hepatic SHP expression.16 Which signal triggers SHP induction during fatty liver formation requires future investigation. Despite this, the transgenic overexpression of SHP did not result in downregulation of MTP or apoB, as well as several other genes including apoAV, apoCIII, and apoE.16 In addition, ABCA1 expression was decreased by SHP overexpression, whereas no change in its mRNA is observed in SHP−/− and OB−/−/SHP−/− livers. These apparent discrepancies could be due to differential regulation of these genes by mouse SHP and human SHP, which was used in the transgenic studies, or could reflect differences in expression of the native SHP promoter and the transthyretin promoter used in the transgenics. Nevertheless, human MTP promoter was shown to be repressed by SHP.34 More broadly, it is likely that the numerous additional inputs that control the expression of these genes respond differently to the absence or overexpression of SHP. One such additional input is bile acid levels, which regulate SHP expression via activation of the bile acid receptor FXR. Acute elevation of bile acids decreases liver triglycerides,40 and synthetic FXR agonists also lower TG levels.41 Thus, acute induction of SHP expression via the FXR pathway and either transgenic or adenoviral SHP overexpression have essentially the opposite effect on lipid accumulation. In addition, FXR−/− livers accumulate TGs despite decreased SHP expression.42 This discrepant fatty liver phenotype between SHP−/− and FXR−/− mice reflects the complexity of the different sets of genes regulated by SHP and FXR, respectively, in controlling hepatic lipid homeostasis. It is apparent that SHP is one important component of a network of factors that modulate hepatic fat metabolism, and that alterations of SHP activity may have different effects in different circumstances.

The causes for steatosis in mice are complex, involving both intrahepatic and extrahepatic factors in multiple metabolic pathways.43 In spite of the mouse models used in this study, whether upregulation of SHP function serves as a common biomarker in fatty livers under various other circumstances remains to be determined.44 Whether changes of SHP function occur in patients with steatosis also must be determined in future studies.

The finding of reduced serum VLDL-TG levels, in the setting of reduced expressions for MTP, apoB, and apoE is consistent with a defect in VLDL-TG export in OB−/− mice. Conversely, the increase in HDL-cholesterol in OB−/− mice is attributable to both typical HDL2 and larger HDL1, and may be caused by decreased hepatic HDL uptake.45 HDL-cholesterol is considered antiatherogenic, because its plasma concentration is inversely correlated with atherosclerotic risk. The OB−/− mice had increased levels of HDL with a marked decrease in VLDL-TG relative to WT mice, and thus were particularly resistant to the development of atherosclerotic lesions.46 Higher serum TG is a risk factor for atherosclerosis, which was elevated in OB−/−/SHP−/− mice as compared with OB−/− mice. However, this elevation did not reach higher statistical significance than WT controls.14 The VLDL-TG was also comparable between OB−/−/SHP−/− and OB−/− mice. This was accompanied by a reduction in HDL1 and an increase in HDL2 levels, as well as up-regulation of SR-BI, apoE, and apoM. The increases in SR-BI and apoE, together with slightly increased apoAI,28 are predicted to enhance the clearance of HDL1 by the liver in OB−/−/SHP−/− mice. In addition, apoM has been proposed to protect against atherosclerosis, by leading to a reduction of HDL1 and a redistribution of cholesterol to HDL2.47 Thus, despite hyperlipidemia, the OB−/−/SHP−/− mice are postulated to have a reduced risk for atherosclerosis by the single or combined effect of activation of apoM, apoE, or SR-BI function.

In summary, specific deletion of the SHP gene in OB−/− mice alters hepatic TG partitioning and enhances liver insulin action, which appear to be beneficial metabolic changes. Modulation of SHP activity may promise potential therapeutic intervention for fatty liver disease and its associated metabolic disorders.

Acknowledgements

The authors thank Dr. Kazuhiro Oka for the adenoviruses. We thank Drs. Larry Swift and David Ong for the MTP antibody, Dr. Iannis Talianidis for the SHP and LRH-1 antibodies, Dr. Johan Auwerx for the KKAy mice, and Dr. Curt Hagedorn for critical reading of the manuscript.

Ancillary