Pregnane X receptor is essential for normal progression of liver regeneration

Authors

  • Guoli Dai,

    1. Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS
    Search for more papers by this author
  • Lin He,

    1. Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS
    Search for more papers by this author
  • Pengli Bu,

    1. Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS
    Search for more papers by this author
  • Yu-Jui Yvonne Wan

    Corresponding author
    1. Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS
    • Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS 66160
    Search for more papers by this author
    • fax: 913-588-7501.


  • Potential conflict of interest: Nothing to report.

Abstract

Pregnane X receptor (PXR) mediates xenobiotic and endobiotic metabolism as well as hepatocyte proliferation. To determine the role of PXR in liver regeneration, 2/3 partial hepatectomy (PH) was performed on wild-type and PXR-null mice. Our results showed that hepatic steatosis was markedly suppressed in mice lacking PXR 36 hours after PH, concomitant with reduction of hepatocyte proliferation at the same time point. Gene expression analysis revealed the role of PXR in regulating the transcription of genes involved in lipid uptake, transport, biosynthesis, oxidation, and storage during liver regeneration. When PXR was absent, the second wave of hepatocyte proliferation was severely suppressed, which was accompanied by the inactivation of STAT3. Lack of PXR inhibited the second phase of liver growth, leading to 17% less liver mass at the anticipated end point of liver regeneration (day 10). Conclusion: PXR is required for normal progression of liver regeneration by modulating lipid homeostasis and regulating hepatocyte proliferation. (HEPATOLOGY 2008.)

An unique feature of the liver is its remarkable ability to regenerate in response to liver mass loss due to a variety of injuries. Whether the regenerative process is able to appropriately initiate, sustain, and complete determines the final outcome of liver damage. Therefore, elucidation of the mechanisms responsible for hepatic compensatory growth will ultimately lead to novel clinical therapeutic strategies for chemical, traumatic, or infectious liver injuries.

Molecular mechanisms governing the initiation, expansion, and termination of liver regeneration include complex and well-orchestrated signaling cascades involving cytokines, growth factors, and matrix remodeling.1–4 Among the concurrent early signaling events are production of interleukin-6 and tumor necrosis factor alpha and activation of urokinase, Notch, β-catenin, signal transducer and activator of transcription protein 3 (STAT3), nuclear factor-kappa B, c-fos, c-jun, hepatocyte growth factor receptor, and epidermal growth factor receptor. These hemodynamic changes that occur in the first few hours after liver mass loss relate directly or indirectly to preparative events for the entry of hepatocytes into the cell cycle. Continuing from or following those early response events are the production of direct mitogens, including hepatocyte growth factor and transforming growth factor alpha, and substances enhancing the effect of the direct mitogens, such as tumor necrosis factor and norepinephrine. These factors form complex communication networks between hepatocytes and nonparenchymal cells in autocrine, paracrine, or endocrine manners, rendering the hepatocytes to enter into and progress through the cell cycle. Subsequent to the expansion phase is the termination of liver regrowth, known to be partly regulated by transforming growth factor beta and activins. These termination factors inhibit hepatocyte proliferation, induce hepatocyte apoptosis, and regulate hepatic organ mass.4–7

In addition to cytokines and growth factors originated intrahepatically or extrahepatically, nuclear receptor–mediated metabolic signals have been integrated into the machinery modulating liver regeneration. Farnesoid X receptor (FXR)–dependent bile acid homeostatic signaling has been proposed to be required for both initiation and termination of liver regeneration.8 Disruption of peroxisome proliferator-activated receptor alpha (PPARα)–mediated lipid signaling pathway delays the initiation of liver regeneration.9, 10 Mice nullizygous for constitutive androstane receptor, one of the major xenobiotic receptors, show a transient delay in hepatocyte proliferation.8 Selective ablation of retinoid X receptor alpha in hepatocytes shortens hepatocyte lifespan during liver regeneration.11 These findings indicate that these nuclear receptors and potentially others participate in the hepatic regenerative response to liver mass loss, functioning in combination with cytokines and growth factors. Thus, the liver is like “a car with multiple cylinders,” possessing overlapping systems that trigger regeneration in response to a variety of problems.12

Pregnane X receptor (PXR), which is highly expressed in the liver, was identified as one of the major nuclear receptors sensing the insults of xenobiotics, such as drugs and toxins, and regulating the subsequent metabolic response.13–17 Further investigation uncovered the role for PXR in metabolism of endobiotics, such as bile acid16, 18, 19 and bilirubin.20, 21 Activated PXR transactivates a network of genes encoding phase I and phase II enzymes as well as transporters for detoxification and elimination of potentially harmful compounds.22 Additionally, activation of PXR stimulates hepatocyte proliferation and liver growth by an unknown mechanism, leading to an increase of hepatic metabolic capacity.18, 23 Moreover, a recent finding showed that PXR plays an important role in regulating lipid homeostasis by activating genes that facilitate lipogenesis and suppress fatty acid β-oxidative pathway.24

Taken together, the importance of PXR in mediating metabolic signaling and the association of PXR with hepatocyte proliferation led us to hypothesize that PXR plays a role in liver regeneration. To test this hypothesis, the current study was performed using a widely used partial hepatectomy (PH) model combined with a genetic approach. Our data demonstrated that PXR is a critical regulator ensuring normal progression of liver regeneration.

Abbreviations

ACC-1, acetyl-CoA-carboxylase 1; FAE, long chain free fatty acid elongase; FXR, farnesoid X receptor; mRNA, messenger RNA; PH, partial hepatectomy; PPARα, peroxisome proliferator-activated receptor alpha; PXR, pregnane X receptor; qRT-PCR, quantitative real-time polymerase chain reaction; SD, standard deviation; STAT3, signal transducer and activator of transcription protein 3.

Materials and Methods

Mice, PH, and Sample Preparation.

Wild-type and PXR-null male mice (4–6 months old), having a mixed genetic background of C57BL6 and SvJ129,16 were kept in steel microisolator cages at 22°C with a 12-hour/12-hour light/dark cycle. Food and water were provided ad libitum throughout the entire feeding period. Standard two-thirds liver resection was performed following the procedure described by others.25 Briefly, using inhalation anesthesia (isoflurane), the 3 most anterior liver lobes (right upper, left upper, and left lower lobes), totaling 68% of the liver, were tied at the origins of the lobes with 3 knots and then resected. The peritoneum was reapproximated with a running suture and then the skin was closed. Sterile saline (3 mL) was administered subcutaneously after closing the abdomen to replace fluid loss from the surgery. Mice were placed under warming lights while awakening from anesthesia. All the experimental procedures were strictly standardized. The surgery was performed between 10:00 AM and 12:00 AM. Mice were sacrificed at the indicated time points. Livers were immediately excised, frozen in liquid nitrogen, and kept at −80°C until use. Liver samples were also fixed in 10% formalin, embedded in paraffin, and stained with hematoxylin-eosin (H&E) for histological analysis. All of the animal experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Ki-67 Immunostaining.

Ki-67 immunostaining was performed with primary Ki-67 antibody (NeoMarkers, Fremont, CA) according to the manufacturer's instruction to monitor hepatocyte proliferation. The number of proliferating hepatocytes was determined by counting the Ki-67–positive hepatocytes in at least 6 low-magnification (40×) microscope fields for each sample.

Liver Lipid Content.

Liver triglyceride and cholesterol levels were measured as described elsewhere.24 Liver tissue was homogenized in a buffer containing 18 mM Tris (pH 7.5), 300 mM mannitol, 50 mM ethylene glycol tetraacetic acid, and 0.1 mM phenylmethysulfonyl fluoride. The homogenate (400 μL) was mixed with chloroform/methanol (2:1, 4 mL) and incubated overnight at room temperature with gentle shaking. After H2O (800 μL) was added, the homogenates were vortexed and then centrifuged for 5 minutes at 3000g. The lower lipid pellets were dissolved in a mixture of tert-butyl alcohol (60 μL) and Triton X-114/methanol (2:1) mixture (40 μL). Triglyceride and cholesterol levels were then measured using the Stanbio Assay kit (Stanbio Laboratory, Boerne, TX) according to the manufacturer's instruction.

Quantitative Real-Time Polymerase Chain Reaction.

Total RNA was isolated from frozen liver tissue using the TRIzol reagent according to the manufacturer's protocol (Invitrogen, Carlsbad, CA). Complementary DNAs were synthesized with total RNA (1 μg) from each sample, diluted 10 times with water, and subjected to quantitative real-time polymerase chain reaction (qRT-PCR) to quantify messenger RNA (mRNA) levels using TaqMan probe (Applied Biosystems, Foster City, CA). Primers and probes were designed using Primer Express 2.0 (Applied Biosystems). The probe was labeled with the reporter dye 6-carboxyfluorescein. TaqMan Universal PCR Master Mix (Applied Biosystems) was used to prepare the PCR mix. Primers and probes were added to a final concentration of 90 and 125 nmol, respectively, in a total volume of 20 μL. The amplification reactions were carried out in the ABI-Prism 7900 sequence detection system (Applied Biosystems) with initial hold steps (50°C for 2 minutes, followed by 95 °C for 10 minutes) and 40 cycles of a 2-step PCR (92°C for 15 seconds, 60°C for 1 minute). The primer (Integrated DNA Technologies, Coralvillem, IA) and probe (Sigma, St. Louis, MO) sequences used for qRT-PCR are listed in Table 1. The relative standard curve method was used for relative quantification of the amount of mRNA of each sample normalized to the albumin transcript level.

Table 1. Sequences of Primers and Probes for Quantitative Real-Time PCR
GenesPrimers (5′-3′)Probes (5′-3′)
PXRForward: CAGTTGCTGCGCATCCAA[DFAM]TCGCACCCCTTTGCCACCCC[DBH1]
 Reverse: TGCTGCTAAATAACTCTTGCATGAG 
Cyp3a11Forward: TCACAGACCCAGAGACGATTAAGA[DFAM]TGTGCTAGTGAAGGAATGTTTTTCT[DBH1]
 Reverse: CCCGCCGGTTTGTGAAG 
PPARαForward: GATTCAGAAGAAGAACCGGAACA[DFAM]TCTGTCGGGATGTCACACAATGCAATTC[DBH1]
 Reverse: TGCTTTTTCAGATCTTGGCATTC 
PPARγForward: CCCAATGGTTGCTGATTACAAA[DFAM]CTGAAGCTCCAAGAATACCAAAGTGCGATC[DBH1]
 Reverse: GAGGGAGTTAGAAGGTTCTTCATGA 
CD36Forward: TCCAGCCAATGCCTTTGC[DFAM]TCACCCCTCCAGAATCCAGACAACCA[DBH1]
 Reverse: TGGAGATTACTTTTTCAGTGCAGAA 
FAEForward: TGACTATGAACTATGGCGTGCAT[DFAM]CCGTCATGTACTCTTACTACGCCTTGCG[DBH1]
 Reverse: CCGGGAGACTCGGAAACC 
AlbuminForward: ACGAGAAGCTTGGAGAATATGGA[DFAM]CAAAATGCCATTCTAGTTCGCTACACCCAG[DBH1]
 Reverse: GCCCACTCTTCCTAGGTTTCTTG 

Western Blotting.

Liver homogenate (40 μg) was separated by polyacrylamide gel electrophoresis under reducing conditions. Proteins from the gels were electrophoretically transferred to nitrocellulose. Antibodies of STAT3 (Cell Signaling Technology, Danvers, MA), phosphor-STAT3 (Tyr705) (Cell Signaling Technology, Danvers, MA), and β-actin (Santa Cruz Biotechnology, Santa Cruz, CA) were used as probes. Immune complexes were detected using the enhanced chemiluminescence system (Pierce, Rockford, IL).

STAT3 DNA Binding Activity Assay.

Hepatic nuclear extract was prepared using Cellytic Nuclear Extraction kit (Sigma, St. Louis, MO) according to the manufacturer's protocol. Briefly, frozen liver tissue (100 mg) was homogenized in a hypotonic buffer supplemented with a cocktail of protease and phosphatase inhibitors (Pierce, Rockford, IL). The homogenates were centrifuged for 20 minutes at 10,000g. The crude nuclei pellets were resuspended in an extraction buffer (150 μL) containing protease and phosphatase inhibitors, shaken gently for 30 minutes, and subsequently centrifuged for 5 minutes at 20,000g. The supernatant (nuclear extract) was aliquoted, snap-frozen in liquid nitrogen, and stored at −80°C. STAT3 DNA binding activity was evaluated using an Upstate Non-Radioactive STAT3 EZ-TFA Transcription Factor Assay kit (Upstate, Temecula, CA) according to the manufacture's manual. Briefly, a double-stranded biotinylated oligonucleotide containing the STAT consensus sequences (5′-TTCCCGTAA-3′ and 5′-TTCCGGGAA-3′) was mixed with hepatic nuclear extract (10 μg) in an assay buffer provided by the kit in the wells of a 96-well streptavidin-coated plate. After 1 hour incubation at room temperature, the unbound materials were removed by washing. A rabbit anti-STAT3 primary antibody was added and allowed for binding for 1 hour at room temperature. After washing, a horseradish peroxidase-conjugated secondary antibody was then added to the assay wells and incubated at room temperature for 30 minutes. Followed by washing, a chemiluminescent substrate was added to each assay well. The luminescence of samples was measured with a microplate luminometer. The STAT3 DNA binding activity was expressed as relative light units. Each sample was assayed as triplicates.

Statistical Analysis.

Data are given as mean ± standard deviation (SD). Statistical analysis was performed using Student t test or one-way analysis of variance. Significance is defined by P < 0.05.

Results

Impact of PXR Absence on Liver Growth After PH.

To evaluate the influence of PXR absence on PH-induced liver regeneration, wild-type and PXR-null mice were subjected to PH or sham operation. Mice were sacrificed after surgery during the time frame of the first wave of hepatocyte proliferation (24, 36, and 48 hours),2 within the period of the second wave of hepatocyte proliferation (5 days),26 and at the end point of liver regeneration (10 days).27 Liver-to-body-weight ratio was monitored as a liver growth index. The results are summarized in Fig. 1.

Figure 1.

Liver-to-body-weight ratio in wild-type (WT) and PXR-null (KO) mice after partial hepatectomy (PH). WT or KO mice were subjected to PH (A) or sham operation (B). Mice were sacrificed at indicated time points following surgery. Liver-to-body weight ratio was recorded as a liver growth index. Results are shown as mean of liver-to-body-weight ratios ± SD (n = 3–6 for each genotype at each time point). *P < 0.05.

The liver-to-body-weight ratio of wild-type mice increased progressively and reached 4.4% at 10 days after surgery, which is within the normal range of liver-to-body-weight ratio (Fig. 1A). However, mice lacking PXR exhibited aberrant liver regrowth (Fig. 1A). At 36 hours following PH, the liver-to-body-weight ratio of PXR-null mice (1.9%) was significantly lower than that of wild-type mice (2.5%). Significant differences of liver-to-body-weight ratios were not observed at 48 hours and 5 days between 2 genotypes of mice. However, 10 days after PH, when the liver is supposed to restore its original mass, the liver-to-body-weight ratio of PXR-null mice reached only 3.6%, leading to approximately 17% less liver mass than wild-type mice. Our data indicated that PXR knockout caused a temporary delay of liver growth at 36 hours after PH and persistent inhibition of liver growth after day 5 following PH, leading to a marked liver mass deficit of the regenerated livers at day 10 after surgery. Significant differences in liver-to-body-weight ratios were not observed between wild-type and PXR-null mice subjected to sham operation at each time point after surgery (Fig. 1B). Our findings showed that PXR is essential for the completion of liver regeneration.

Impact of PXR Absence on Hepatocyte Proliferation During Liver Regeneration.

Proliferation of hepatocytes constitutes the fundamental cellular event during liver regeneration. It has been well demonstrated that PXR activation induces hepatocyte proliferation.18, 23 This finding prompted us to determine whether PXR exerts an effect on hepatocyte proliferative response to liver mass loss. Ki-67 immunostaining was performed on liver sections from the experiment described in Fig. 1.

At 36 hours after PH, the number of Ki67-positive hepatocytes in PXR-null livers was significantly reduced compared with that in wild-type livers (Fig. 2). This observation indicates that PXR participates in mediating the initial hepatocyte proliferation in response to PH. Thus, the decreased liver-to-body-weight ratio 36 hours after PH in PXR-null mice was due, at least in part, to the reduced hepatocyte proliferation (Fig. 1). More prominently, 5 days after PH, the number of Ki67-positive hepatocytes in wild-type mice was 3.4-fold higher than that in PXR-null mice. This finding revealed a critical role of PXR in regulating the second wave of hepatocyte proliferation. The data are also consistent with the observation that the increase of liver-to-body-weight ratio was inhibited after 5 days following PH because of a lack of PXR (Fig. 1). The representative liver sections immunohistochemically stained for Ki67 are shown in Fig. 2B. In addition, hepatic mitotic figures were counted 48 hours (mitosis peak) and 5 days after PH. The result showed that the number of hepatocytes undergoing mitosis was not significantly different between 2 genotypes of mice at 48 hours (6.0 ± 1.96 in wild-type mice versus 4.53 ± 2.12 in PXR-null mice), whereas lack of PXR resulted in a reduction of the number of cells undergoing mitosis at 5 days (1.4 ± 0.99 in wild-type mice versus 0.14 ± 0.13 in PXR-null mice) following PH (Fig. 2C). The data are consistent with Ki-67 immunostaining analysis.

Figure 2.

Hepatocyte proliferation during partial hepatectomy (PH)-induced liver regeneration in wild-type (WT) and PXR-null (KO) mice. (A) Ki-67 immunostaining was performed with the formalin-fixed and paraffin-embedded tissue sections prepared from the livers harvested in the experiment described in Fig. 1. Ki-67–positive hepatocytes were counted (40× optical field), and the results are shown as mean ± SD (n = 3 to 6 for each genotype at each time point, *P < 0.05; ***P < 0.001). (B) The representative liver sections immunohistochemically stained for Ki-67 were shown for WT and KO mice 36 h and 5 days after PH. (C) Hepatic mitotic figures were counted (40× optical field) in the livers of both genotypes of mice at 48 hours and 5 days after PH. The data are shown as mean ± SD (n = 3 to 6 for each genotype at each time point, ***P < 0.001).

Modulation of Hepatic Lipid Homeostasis by PXR During Liver Regeneration.

A marked change of hepatic lipid homeostasis occurs during liver regeneration.28, 29 Triglyceride and cholesterol esters accumulated in hepatocytes are proposed to serve as an energy source supporting cell proliferation and tissue regrowth.30 PXR activation results in an increased hepatic deposit of triglycerides.24 These reports led us to determine whether PXR plays a role in regulating lipid homeostasis during liver regeneration. Liver histology was examined and hepatic triglyceride and cholesterol contents were quantified in wild-type and PXR-null mice subjected to PH.

At 36 hours after PH, wild-type mice accumulated large lipid droplets in the hepatocyte cytosol, whereas the lipid accumulation was drastically reduced in the livers of mutant mice (Fig. 3A). Lipid droplets were not seen in the livers of sham-operated control mice for each genotype (Fig. 3A). The morphology of hepatic lipid accumulation was not markedly different between the two genotypes of mice at other time points studied (data not shown). Corresponding biochemical data supported the morphological observation (Fig. 3B,C). In wild-type mice, both triglyceride and cholesterol reached peak levels 36 hours after liver resection. In contrast, the elevation of hepatic triglyceride and cholesterol levels was not seen in the PXR-null mice. At other time points studied, absence of PXR did not alter the hepatic triglyceride and cholesterol levels (Fig. 3B,C). These observations demonstrated that PXR plays a temporal role in regulating lipid homeostasis during liver regeneration. Decreased hepatic triglyceride and cholesterol accumulation in PXR-null mice 36 hours after PH might also explain the decreased liver-to-body-weight ratio of PXR-null mice at the same time point (Fig. 1).

Figure 3.

Hepatic lipid content during partial hepatectomy (PH)-induced liver regeneration in wild-type (WT) and PXR-null (KO) mice. Hematoxylin-eosin staining of liver sections of WT and KO mice sacrificed 36 hours after PH or sham operation (sham) was used for morphological analysis (A). Hepatic triglyceride (B) and cholesterol (C) content was measured using the livers harvested from the experiment described in Fig. 1. The results are shown as mean ± SD (n = 3 to 6 for each genotype at each time point). *P < 0.05; ***P < 0.001.

The mRNA Expression of PXR and Cyp3a11 During Liver Regeneration.

On activation, PXR transactivates the expression of itself as well as its targets such as Cyp3a11.31 To determine the functional status of PXR during normal liver regeneration, hepatic PXR and Cyp3a11 mRNA levels were quantified. The result showed that PXR and Cyp3a11 mRNA levels in regenerating livers were 4-fold and 2.5-fold higher, respectively, than that in sham-operated controls 24 hours after surgery (Fig. 4A,B). PH did not significantly change the mRNA levels of PXR and Cyp3a11 at the other time points (data not shown). Simultaneous induction of PXR and Cyp3a11 mRNA expression suggests that PXR is activated 24 hours after PH.

Figure 4.

PXR and Cyp3a11 mRNA levels during liver regeneration. Wild-type mice were subjected to sham operation (sham) or partial hepatectomy (PH) and sacrificed 24 hours following surgery. The hepatic mRNA levels of PXR (A) and Cyp3a11 (B) were quantified by real-time PCR and are expressed as mean of fold changes compared with sham-operated controls ± SD (n = 3 for each surgery group). *P < 0.05.

Expression of Genes Involved in Lipid Metabolism During Liver Regeneration.

In an attempt to explore the molecular mechanism underlying PXR-mediated lipid metabolism during liver regeneration, expression of genes known to be critical in lipogenesis, β-oxidation, and transport was profiled by relative qRT-PCR. The average hepatic mRNA level of each gene in wild-type livers at 24 hours after sham operation was set as 1.0.

PPARα is a critical regulator of hepatic lipid oxidation.32 Our data showed that PXR deficiency resulted in reduced PPARα mRNA levels in the livers of sham-operated mice (Fig. 5A). This observation suggests that PXR controls the basal PPARα mRNA level. Twenty-four hours after PH when PXR expression is activated (Fig. 4), wild-type livers expressed 17.4-fold lower PPARα transcript than PXR-null livers, indicating that PXR activation suppressed PPARα expression. Beyond 24 hours after PH, wild-type regenerating livers expressed slightly higher PPARα mRNA levels than PXR-null regenerating livers. These results indicate that PXR activation markedly suppresses the mRNA expression of PPARα 24 hours after PH.

Figure 5.

Expression of genes involved in lipid metabolism during liver regeneration. Total RNA was extracted from the livers collected in the experiment described in Fig. 1. The hepatic mRNA levels of PPARα (A), PPARγ (B), FAE (C), CD36 (D), and ACC-1 (E) of wild-type (WT) and PXR-null (KO) mice at the indicated time points after partial hepatectomy (PH) or sham operation (Sham) were measured by quantitative real-time PCR. Data are expressed as mean of fold changes compared with sham controls of wild-type mice 24 hours after surgery ± SD (n = 3-6 for each surgery group of each genotype at each time point). *P < 0.05; **P < 0.01; ***P < 0.001.

PPARγ is involved in the regulation of hepatic lipid storage.33, 34 PXR-null mice subjected to sham operation or PH consistently expressed lower levels of hepatic PPARγ mRNA than wild-type mice at every studied time point after surgery (Fig. 5B). These observations indicated that deletion of PXR leads to down-regulation of PPARγ expression. At 36 hours after PH, although the hepatic PPARγ mRNA expression was up-regulated in both genotypes of mice, the PPARγ transcript level in wild-type livers was more than 2-fold higher than that in PXR-null livers.

Long-chain free fatty acid elongase (FAE), a lipogenic enzyme highly expressed in the liver, has been shown to be up-regulated by activation of PXR.24 Our data showed that, 36 hours after PH, hepatic FAE mRNA level in wild-type mice was 5.2-fold higher than that in PXR-null mice (Fig. 5C). Thus, PH-induced FAE mRNA expression at 36 hours after PH is PXR dependent.

CD36 is a free fatty acid transporter responsible for the uptake of fatty acid.35–37 A recent report demonstrated that CD36 is a direct PXR target gene.24 At 24 hours and 48 hours post-PH, wild-type livers expressed at least 3-fold higher CD36 mRNA than PXR-null livers (Fig. 5D). At 36 hours after surgery, PH induced hepatic CD36 gene expression to similar levels regardless of genotypes (Fig. 5D). These data confirmed that CD36 is a PXR target gene. However, PH-induced CD36 gene expression might be PXR-independent.

Acetyl-CoA-carboxylase 1 (ACC-1) is a lipogenic enzyme known to be regulated by sterol regulatory element-binding protein 1c.38 Marked induction of ACC-1 gene expression was seen in both wild-type and PXR-null livers 36 hours after surgery. However, the level of hepatic ACC-1 transcript was consistently lower in PXR-null mice than that in wild-type mice. The data indicated that PXR is involved in the regulation of ACC-1 gene expression during liver regeneration.

PXR-Dependent STAT3 Activity During Liver Regeneration.

Cytokine signaling, transduced by the Janus-activated kinase/STAT3 pathway, promotes liver regeneration.39, 40 Evidence suggests that PXR may modulate cytokine signaling during inflammation.41 To evaluate whether absence of PXR affects STAT3-mediated signaling during liver regeneration, hepatic functional status of STAT3 was analyzed by Western blotting and STAT3 DNA binding activity assay (Fig. 6).

Figure 6.

Hepatic STAT3 activity after partial hepatectomy (PH) in wild-type (WT) and PXR-null (KO) mice. (A) Total and phosphorylated STAT3 were assessed by western blot in the livers of WT and KO mice sacrificed 36 hours and 5 days after PH. Beta-actin is included as a loading control. (B) STAT3 DNA binding activity was studied using nuclear extracts prepared from the livers of 2 genotypes of mice at the same time points after PH as described. Data are expressed as mean of relative light units (RLU) ± SD (n = 3 for each genotype at each time point). ***P < 0.001.

At 36 hours after PH, abundant phosphorylated STAT3 was detected in the livers of both wild-type and PXR-null mice, suggesting that PXR may not have an effect on cytokine signaling during the first peak of cell proliferation. However, 5 days after PH, phophorylated STAT3 was only detected in wild-type, but not in PXR-null, mice. The findings demonstrated the essential role of PXR in regulating STAT3-mediated signaling pathway during the second wave of hepatocyte proliferation. As a control, total STAT3 protein was abundant in all of the samples regardless of genotypes and time points examined (Fig. 6A). To further confirm the functional status of STAT3, DNA-binding activity of STAT3 was evaluated using liver nuclear extracts prepared from the livers of wild-type and PXR-null mice sacrificed 36 hours and 5 days after PH. The result showed that hepatic STAT3 DNA binding activity was not different between the 2 genotypes of mice at 36 hours, whereas PXR absence resulted in significantly reduced STAT3 DNA binding activity 5 days after the surgery (Fig. 6B). The data are consistent with Western blot analysis.

Discussion

This study demonstrates the essential role of PXR in mediating the normal hepatic regenerative response to liver mass loss. During the first 5 days of growth, a transient drop of liver-to-body-weight ratio because of lack of PXR was evident 36 hours after PH. This observation can be explained by significantly reduced fat accumulation and hepatocyte proliferation due to PXR absence. Subsequently, the liver growth was comparable between wild-type and PXR-null mice 48 hours and 5 days after PH. This suggests that the role of PXR in the first phase of liver regeneration can be compensated. Beyond 5 days, however, loss of PXR led to persistent inhibition of liver growth, which resulted in a significant liver mass deficit 10 days after PH. In agreement with this observation, the second wave of hepatocyte proliferation, which drives the late phase liver growth, was largely reduced as a consequence of PXR absence. Further investigation revealed the inactivation of STAT3 5 days after PH in PXR-null livers, which contributes at least in part to the mechanisms responsible for PXR-dependent suppression of the second wave of hepatocyte proliferation. We conclude that PXR is an essential regulator for hepatocyte proliferation and liver growth, especially during the late stage of liver regeneration.

Our finding expanded the roles of nuclear receptors in liver regeneration. Genetically associated and functionally overlapped with PXR, xenobiotic receptor constitutive androstane receptor has been shown to participate in the early period of the hepatic regenerative response to PH.8 Mice lacking constitutive androstane receptor exhibited a modest decrease in liver growth only at day 1 after PH.8 FXR, a nuclear receptor mediating bile acid signaling, has been demonstrated to be required for normal liver regeneration.8 At the early stage of liver regeneration (the first 3 days after PH), FXR absence causes a strong inhibition of liver growth accompanied by decreased hepatocyte proliferation.8 At the late stage, liver growth somehow catches up, and liver regeneration is able to complete even in the absence of FXR.8 The role of PXR in the hepatic regenerative response to PH was examined by Huang et al.8 Liver regrowth was estimated using a percentage of original liver weight, which may be more sensitive than using the liver-to-body-weight ratio to detect liver growth in the first few days after PH because the denominator used, liver rather than body weight, is smaller. As a result, no defect in liver regrowth was observed in PXR-null mice. The PXR-null mice used by us and by Huang et al. have the same genetic background and were distributed from the same source.16 In this study, we chose to use liver-to-body-weight ratio because the body weight obtained from the experimental animals might be more accurate than using the original liver weight, which has to be estimated from nonexperimental animals. Using liver-to-body-weight ratio and the number of Ki-67–positive hepatocytes as a cell proliferation index, our data indicate that PXR is an essential regulator for liver regeneration. Functional loss of PXR results in suppression of liver growth, concomitant with the reduction of hepatocyte proliferation and the inactivation of STAT3. Taken together, these nuclear receptors and potentially others may function coordinately at the same time or at different stages to ensure normal progress of liver regeneration. Identification of the roles of these nuclear receptors in liver regeneration provides considerable insights into the molecular mechanisms by which the liver is able to restore its original mass, structure, and function in response to injury.

Intracellular lipid droplet formation (steatosis) occurs during early liver regeneration.28 Hepatocytes accumulate triglyceride and cholesterol esters in the lipid droplets, which are proposed to serve as an energy source supporting cell proliferation and tissue regrowth.30 The role of fat in liver regeneration has been studied in different models. Reduced lipid droplet accumulation attributable to lack of caveolin-1, an essential component of distinct domains (caveolae) of plasma membrane, causes failure of cell division and consequent animal death in response to PH.29 Leptin supplementation reduces hepatocellular fat accumulation and glucocorticoid increases cellular fat accumulation during adipocyte differentiation. Suppression of hepatocellular fat accumulation, by administration of leptin or genetic deletion of glucocorticoid receptor, impairs hepatocyte proliferation and liver regeneration after PH.28 These findings support the notion that fat accumulation is required for normal liver regeneration. However, pathological preexistence of steatosis severely compromises the hepatic regenerative response to PH, which has been demonstrated using genetically based models of steatosis, such as ob/ob mice (leptin deficiency)42–44 and db/db mice (leptin receptor deficiency).45 In addition, preexistence of steatosis and obesity induced by chronic exposure to a high-fat diet caused significant impairment of liver regeneration after PH.46 Clinically, obese patients with fatty livers tend to have poor outcomes after liver resection, liver transplantation, or other types of liver injuries.47 These observations suggest that preexisting steatosis harms subsequent liver regeneration. In contrast, animals with steatosis induced by other special diets, such as the methionine-choline-deficient diet48, 49 or orotic-acid–supplemented diet,50 showed normal or only slightly delayed liver regeneration. These conflicts need to be further analyzed to comprehensively evaluate the roles of “pathological” versus “physiological” steatosis in liver regeneration. In our study, lack of PXR reduces hepatic fat accumulation accompanied by suppressed hepatocyte proliferation 36 hours after PH, leading to a reduction of liver-to-body-weight ratio in PXR-null mice. These results suggest that PXR-mediated lipid accumulation is required for the hepatic regenerative response to liver resection. Further investigation is needed to understand the mechanism by which PXR-mediated lipid homeostasis regulates hepatocyte proliferation.

Steatosis can be observed as early as 12 hours and persists until 48 hours after PH by histological examination.28 We found that steatosis was most dramatic at 36 hours after PH by histological and biochemical analyses. However, the liver regeneration–induced steatosis peak was not present because of a lack of PXR (Fig. 3). The finding indicated that PXR is responsible for the peak formation of fat accumulation in the regenerating liver. Xie's group demonstrated a novel function of PXR in regulating hepatic lipid homeostasis.24 Activation of PXR results in hepatic lipid accumulation by inhibition of PPARα and up-regulation of PPARγ, FAE, and CD36, and these responses are independent of sterol regulatory element-binding protein 1c.24

The current study demonstrated that PXR regulates the mRNA levels of these genes involved in multiple aspects of lipid metabolism during liver regeneration. Twenty-four hours after PH, when PXR is activated, wild-type mice have reduced mRNA levels of PPARα and increased mRNA levels of PPARγ, CD36, and ACC-1 in comparison with PXR-null mice. These PXR-dependent changes of gene expression might lead to inhibition of lipid β-oxidation and enhancement of lipid uptake, storage, and biosynthesis, which contribute at least in part to the subsequent peak formation of lipid accumulation. Thirty-six hours after PH, when lipid accumulation reached peak, wild-type mice expressed higher mRNA levels of PPARγ, FAE, and ACC-1 than PXR-null mice, which might facilitate lipid storage and biosynthesis. Hence, PXR might have a stage-specific effect on lipid metabolism during liver regeneration, which is concomitant with hepatocyte proliferation.

It is unclear how PXR deficiency suppresses the second wave of hepatocyte proliferation, leading to inhibition of the second phase of liver growth. Studies on liver regeneration using the PH model largely focus on the molecular and cellular events that occur in the first few days after the surgery. The regulation of the second wave of hepatocyte proliferation has yet to be characterized. STAT3 plays a crucial role in organ development and cell proliferation.51 Activated by cytokines and growth factors, STAT3 is rapidly activated after PH.52 Liver-specific STAT3 knockout mice have normal liver development but demonstrate irregular immediate-early gene activation and have reduced mitogenic response after PH.40 These observations indicate that STAT3 contributes to the acute phase hepatic response and hepatocyte proliferation during liver regeneration. Among the STAT family members (STAT1-6), hepatic STAT1, STAT3, and STAT5 proteins could be detected. However, only STAT3 was activated 36 hours and 5 days after PH in wild-type mice. Lack of PXR did not significantly affect hepatic total protein levels of STAT1, STAT3, and STAT5, but led to STAT3 inactivation day 5 after PH (data not shown and Fig. 6). Inactivation of hepatic STAT3 was closely associated with reduction of hepatocyte proliferation in PXR-null mice at day 5 following PH. The data suggested that STAT3 may also be an important regulator of second wave of hepatocyte proliferation, responsible for the later phase growth of regenerating livers.

In summary, our study demonstrates that PXR is a critical regulator of liver regeneration. During the early stage of liver growth, PXR participates in mediation of hepatocyte proliferation, and modulation of lipid metabolism by regulating the transcription of genes responsible for lipid uptake, transport, biosynthesis, and oxidation. During the late stage of liver mass restoration, PXR regulates hepatocyte proliferation possibly by modulating STAT3 activity, ensuring the sustaining of liver growth. Lack of PXR impairs normal progression of liver regeneration.

Acknowledgements

We thank Dr. Wen Xie, Center for Pharmacogenetics and Department of Pharmaceutical Sciences, University of Pittsburgh, for providing us with the PXR-null mice. We thank Matthew Wortham and Barbara Brede for critical review of the manuscript.

Ancillary